CN113117062A - Porcine circovirus 2d type inactivated vaccine and preparation method thereof - Google Patents
Porcine circovirus 2d type inactivated vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN113117062A CN113117062A CN202110450228.0A CN202110450228A CN113117062A CN 113117062 A CN113117062 A CN 113117062A CN 202110450228 A CN202110450228 A CN 202110450228A CN 113117062 A CN113117062 A CN 113117062A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- porcine circovirus
- type
- inactivated
- pcv2d
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 229940031551 inactivated vaccine Drugs 0.000 title claims abstract description 26
- 238000002360 preparation method Methods 0.000 title claims abstract description 11
- 244000309749 Porcine circovirus 2D Species 0.000 title claims abstract description 10
- 229960005486 vaccine Drugs 0.000 claims abstract description 30
- 241000700605 Viruses Species 0.000 claims abstract description 17
- 241001670114 Porcine circovirus type 2-D Species 0.000 claims abstract description 16
- 238000003756 stirring Methods 0.000 claims abstract description 16
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims abstract description 13
- 239000002671 adjuvant Substances 0.000 claims abstract description 10
- 239000006285 cell suspension Substances 0.000 claims abstract description 7
- 210000001728 clone cell Anatomy 0.000 claims abstract description 7
- 230000000415 inactivating effect Effects 0.000 claims abstract description 7
- 238000002156 mixing Methods 0.000 claims abstract description 7
- 239000003795 chemical substances by application Substances 0.000 claims abstract 2
- 238000000034 method Methods 0.000 claims description 12
- 239000007788 liquid Substances 0.000 claims description 9
- 230000000937 inactivator Effects 0.000 claims description 6
- 241000202347 Porcine circovirus Species 0.000 claims description 5
- 210000004027 cell Anatomy 0.000 claims description 5
- 230000002779 inactivation Effects 0.000 claims description 5
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 4
- 238000004321 preservation Methods 0.000 claims description 4
- VEZXCJBBBCKRPI-UHFFFAOYSA-N beta-propiolactone Chemical group O=C1CCO1 VEZXCJBBBCKRPI-UHFFFAOYSA-N 0.000 claims description 3
- 201000010099 disease Diseases 0.000 claims description 3
- 229960000380 propiolactone Drugs 0.000 claims description 3
- 230000001804 emulsifying effect Effects 0.000 claims description 2
- 239000000203 mixture Substances 0.000 claims description 2
- 230000008569 process Effects 0.000 claims description 2
- 239000012646 vaccine adjuvant Substances 0.000 claims description 2
- 229940124931 vaccine adjuvant Drugs 0.000 claims description 2
- 239000001963 growth medium Substances 0.000 claims 1
- 230000000694 effects Effects 0.000 abstract description 10
- 230000004083 survival effect Effects 0.000 abstract description 10
- 210000004369 blood Anatomy 0.000 abstract description 3
- 239000008280 blood Substances 0.000 abstract description 3
- 238000004519 manufacturing process Methods 0.000 abstract description 3
- 230000009385 viral infection Effects 0.000 abstract description 3
- 230000003053 immunization Effects 0.000 description 28
- 238000002649 immunization Methods 0.000 description 27
- 238000012360 testing method Methods 0.000 description 19
- 241001673669 Porcine circovirus 2 Species 0.000 description 18
- 239000000427 antigen Substances 0.000 description 8
- 102000036639 antigens Human genes 0.000 description 8
- 108091007433 antigens Proteins 0.000 description 8
- 210000002966 serum Anatomy 0.000 description 8
- 241000282898 Sus scrofa Species 0.000 description 6
- 230000037396 body weight Effects 0.000 description 6
- 208000015181 infectious disease Diseases 0.000 description 6
- 108090000623 proteins and genes Proteins 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 5
- 239000003814 drug Substances 0.000 description 4
- 238000007689 inspection Methods 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 241001465754 Metazoa Species 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 244000144980 herd Species 0.000 description 3
- 230000001900 immune effect Effects 0.000 description 3
- 235000019786 weight gain Nutrition 0.000 description 3
- 230000004584 weight gain Effects 0.000 description 3
- 208000031504 Asymptomatic Infections Diseases 0.000 description 2
- 241001533384 Circovirus Species 0.000 description 2
- 201000004624 Dermatitis Diseases 0.000 description 2
- 238000002965 ELISA Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 210000004237 neck muscle Anatomy 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 208000028489 postweaning multisystemic wasting syndrome Diseases 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 208000019838 Blood disease Diseases 0.000 description 1
- 208000005753 Circoviridae Infections Diseases 0.000 description 1
- 208000003322 Coinfection Diseases 0.000 description 1
- 206010010356 Congenital anomaly Diseases 0.000 description 1
- 208000011231 Crohn disease Diseases 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000219322 Dianthus Species 0.000 description 1
- 208000004232 Enteritis Diseases 0.000 description 1
- 241000606807 Glaesserella parasuis Species 0.000 description 1
- 241000204045 Mycoplasma hyopneumoniae Species 0.000 description 1
- 206010029164 Nephrotic syndrome Diseases 0.000 description 1
- 241001135989 Porcine reproductive and respiratory syndrome virus Species 0.000 description 1
- 241000125945 Protoparvovirus Species 0.000 description 1
- 241000194021 Streptococcus suis Species 0.000 description 1
- 241000282887 Suidae Species 0.000 description 1
- 206010044565 Tremor Diseases 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 235000021053 average weight gain Nutrition 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000000546 chi-square test Methods 0.000 description 1
- 231100000676 disease causative agent Toxicity 0.000 description 1
- 208000035475 disorder Diseases 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 238000004945 emulsification Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000000556 factor analysis Methods 0.000 description 1
- 208000014951 hematologic disease Diseases 0.000 description 1
- 208000018706 hematopoietic system disease Diseases 0.000 description 1
- 230000008629 immune suppression Effects 0.000 description 1
- 210000000987 immune system Anatomy 0.000 description 1
- 238000010166 immunofluorescence Methods 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000008774 maternal effect Effects 0.000 description 1
- 244000000010 microbial pathogen Species 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000001543 one-way ANOVA Methods 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 230000000704 physical effect Effects 0.000 description 1
- 239000002504 physiological saline solution Substances 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 208000023504 respiratory system disease Diseases 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000013112 stability test Methods 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 231100000419 toxicity Toxicity 0.000 description 1
- 230000001988 toxicity Effects 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000005303 weighing Methods 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5252—Virus inactivated (killed)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Virology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Dispersion Chemistry (AREA)
- Molecular Biology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to the field of veterinary vaccines, in particular to a porcine circovirus 2d type inactivated vaccine and a preparation method thereof, wherein the preparation method comprises the following steps: (1) adding a vaccine inactivating agent into the porcine circovirus type 2d virus solution according to the proportion of 1:2000, and then stirring and inactivating for 48 hours at the temperature of 4 ℃; (2) mixing the inactivated virus solution and PK15 clone cell suspension according to the ratio of 1: 9; (3) mixing with adjuvant, and stirring to obtain oil-in-water vaccine. The PCV2d inactivated vaccine prepared by the invention has obvious effects on improving the production performance and survival rate of piglets, and has equivalent effect to commercial seedlings; the PCV2d inactivated vaccine can obviously reduce the virus load in blood and effectively reduce the virus infection of swinery; the PCV2d inactivated vaccine has good stability and high safety.
Description
Technical Field
The invention relates to the field of veterinary vaccines, and in particular relates to a porcine circovirus type 2d inactivated vaccine and a preparation method thereof.
Background
Porcine circovirus type 2 (PCV 2) is the causative agent of Postweaning Multisystemic Wasting Syndrome (PMWS). PCV2 is ubiquitous in all countries and regions, and swine herds at all stages show a strong susceptibility [1 ]. PCV2 mainly attacks the immune system of pigs after infection, so that the body is in an immune suppression state, and other pathogenic microorganisms are secondarily infected, thereby seriously influencing the economic development of the pig industry [2 ]. The hazard of PCV2 is not limited to the hazard of the virus itself, but is also manifested by secondary infection with Haemophilus parasuis, Streptococcus suis, Mycoplasma hyopneumoniae, porcine reproductive and respiratory syndrome virus, parvovirus, and the like [3 ].
According to the differences of PCV2 gene sequences, the PCV2 gene can be divided into five subtypes [4-5] of PCV2a, PCV2b, PCV2c, PCV2d and PCV2 e. The 66 PCV2 isolated from the southern China large region were subjected to gene analysis by Wei et al [6] in 2011-2012, and the result shows that 45 of the 66 PCV2 are PCV2d types and account for 68.2 percent. In 2013-2015, Zhan et al [7] performed gene comparison on 62 PCV2 isolates in southern China, and found that PCV2d type was as high as 72.6%. Qu et al [8] found an infection rate of 67% of PCV2d in PCV2 positive samples in an epidemiological survey of the Hunan area in 2012-2016. These indicate that PCV2d has increasingly become the main epidemic strain in our country. GUO and the like [9] use three strains of PCV2a, PCV2b and PCV2d to respectively carry out virus attack on healthy piglets of 30 days, and the result shows that the nucleic acid copy number of a PCV2d virus attack group in a pathological organ is higher than that of PCV2a and PCV2b groups, which indicates that the toxicity of PCV2d is stronger than that of PCV2a and PCV2b, at present, most of China is PCV2 positive fields, and is difficult to purify and has no specific curative drugs.
Reference documents:
[1] zhao Chen, Wang Min, Liu Chang Hui, etc. progress of porcine circovirus type 2 molecular epidemiology and vaccine research [ J ] Chinese veterinary medicine J2015, 49(2):63-69.
[2]MADEC F,ROSE N,GRASLAND B,et al.Post-weaning multisystemic wasting syndrome and other pcv2-related problems in pigs:a 12-year experience.[J].Transbound Emerg Dis,2008,55(7):273-83.
[3] Langhuawu, Chengchun, Wuhuawei, et al, research progress on porcine circovirus disease and its biological taxonomy [ J ] Chinese veterinary science 2012,42(5): 545-one 550.
[4]Franzo Giovanni,Cortey Martí,de Castro Alessandra Marnie Martins Gomes,et al.Genetic characterisation of porcine circovirus type 2(pcv2)strains from feral pigs in the brazilian pantanal:an opportunity to reconstruct the history of pcv2 evolution.[J].Vet Microbiol,2015,178(1-2):158-62.
[5]CHIOU Mingtang,LIN Chaonan,YANG Chengyao,et al.Genotypic change and phylogenetic analysis of porcine circovirus type 2in taiwanese pig herds[J].s.n.,2012,74(10):1303-1310.
[6]WEI Chunya,ZHANG Minze,CHEN ye,et al.Genetic evolution and phylogenetic analysis of porcine circovirus type 2infections in southern china from 2011to 2012.[J].Infect Genet Evol,2013,17:87-92.
[7]Yang Zhan,Naidong Wang,Zhe Zhu,et al.In silico analyses of antigenicity and surface structure variation of an emerging porcine circovirus genotype 2b mutant,prevalent in southern china from 2013to 2015[J].Journal of General Virology,2016,97(Pt4):922-933.
[8]QU Tailong,LI Runcheng,YAN Meijun,et al.High prevalence of pcv2d in hunan province,china:aretrospective analysis of samples collected from 2006to 2016.[J].Arch Virol,2018,163(7):1897-1906.
[9]Longjun Guo,Yujie Fu,Yiping Wang,et al.A porcine circovirus type 2(pcv2)mutant with 234amino acids in capsid protein showed more virulence in vivo,compared with classical pcv2a/b strain[J].PLoS One,2012,7(7).
[10] The isolation and whole gene sequence analysis of Liangqian pig circovirus type 2, Lianglingqi, Zhang Guang, etc. [ J ]. Heilongjiang animal veterinarian, 2018(11):20-22+250.
[11] Dianthus hainanensis, Tandong Haidong, Zhangguan shou, Daqing City and the investigation of non-immune pig herd porcine circovirus infection [ J ] animal medicine progress, 2017,38(1): 119-.
[12] Shiqing, Shiang, plum fruit, etc. 2016-year-old analysis of genetic evolution of pathogenic porcine circovirus in Henan, J, Chinese veterinary science, 2018,38(5): 857-year-old 862.
[13] Wuming Zhen, Jiangyupong, Aoqiao, etc. PCV2 molecular epidemiological investigation and genetic variation analysis in Jinhua Zhejiang [ J ] Chinese veterinary science, 2019(10):1890-1896.
[14] The immune effects of maternal antibodies to different porcine circovirus type 2 vaccines [ J ] Guangdong veterinary science and technology of livestock raising, 2018,43(6):32-34.
[15] Influence of the type and frequency of the porcine circovirus type 2 vaccine on the immune efficacy and productivity [ J ] Heilongjiang veterinary drug 2015(23) 163-.
[16]SNO M,COX E,HOLTSLAG H,et al.Efficacy and safety of a new intradermal pcv2 vaccine in pigs[J].Trials Vaccinol,2016,5:24-31.
[17] Dianthus hainanensis, Tandong Hayao, Zhangguan, et al, porcine circovirus type 2 synthetic immunity and maternal antibody assessment study [ J ] animal medicine progress, 2017,38(12):39-43.
[18] Wuxin, YaoJingming, Mengsan, et al. Observation and analysis of the immune efficacy of inactivated vaccine against porcine circovirus disease [ J ]. Chinese veterinary medicine, 2014,41(5): 231-.
Disclosure of Invention
The invention aims to provide a porcine circovirus 2d type inactivated vaccine and a preparation method thereof, which can be applied to prevention and control of circovirus and provide guarantee for breeding safety and economic development of a pig farm.
In order to achieve the purpose, the invention adopts the following technical scheme:
a preparation method of porcine circovirus 2d type inactivated vaccine comprises the following steps:
(1) adding a vaccine inactivator into the porcine circovirus type 2d virus liquid according to the volume ratio of 1:2000, wherein the volume ratio of the vaccine inactivator to the porcine circovirus type 2d virus liquid is 1:2000, and stirring and inactivating for 48 hours at 4 ℃;
(2) mixing the inactivated porcine circovirus 2d type virus liquid and PK15 clone cell suspension according to the volume ratio of 1:9, namely mixing the porcine circovirus 2d type virus liquid with the PK15 clone cell suspension;
(3) mixing with adjuvant, and stirring to obtain oil-in-water vaccine.
Further, the inactivation process in the step (1) comprises adding the vaccine inactivator while stirring, then stirring and inactivating at 4 ℃ for 48 hours, and then placing in a 37 ℃ water bath for 2 hours.
Further, the vaccine inactivator is beta-propiolactone.
Further, the cell concentration of the PK15 clone cell suspension in the step (2) is 2X 105one/mL.
Further, the vaccine adjuvant in the step (3) is ISA206, the inactivated virus liquid is placed in an emulsification container, the ISA206 adjuvant is slowly added according to the proportion of 3:1 of the water phase and the oil adjuvant while stirring, and then the mixture is stirred for 30min at the speed of 800r/min to prepare the oil-in-water type vaccine.
The invention also provides the porcine circovirus type 2d inactivated vaccine prepared by the preparation method.
Further, the porcine circovirus type 2d inactivated vaccine contains an inactivated porcine circovirus type 2d, the porcine circovirus type 2d is named as PCV2d-HuB/2020, and the preservation number is CCTCC NO: v202122.
The invention has the beneficial effects that:
(1) the PCV2d inactivated vaccine prepared by the invention has obvious effects on improving the production performance and survival rate of piglets, and has equivalent effect to commercial seedlings;
(2) the PCV2d inactivated vaccine prepared by the invention can obviously reduce the virus load in blood and effectively reduce the virus infection of swinery;
(3) the PCV2d inactivated vaccine has good stability and high safety.
Drawings
FIG. 1 is a diagram showing the results of detecting the serum antibody levels of groups of different ages in days before and after immunization in the examples.
Detailed Description
In order that the above objects, features and advantages of the present invention can be more clearly understood, a more particular description of the invention will be rendered by reference to the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments disclosed below.
The PCV2 inactivated vaccine is prepared by adopting a 2d strain of PCV2, and the immune effect of the piglet is evaluated by immunizing the piglet of 35 days old and utilizing indexes such as serum antibody, antigen positive rate and the like.
1 materials and methods
1.1 sources of viruses and cells
The virus is separated from positive disease material in a certain pig farm of Huanggang Hubei, is PCV2d type by sequencing analysis, is named as PCV2d-HuB/2020 strain, and is tested for TCID50Is 107.0mL, preserved in China center for type culture Collection with a preservation date of 2021 year, 3 months and 20 days, and a preservation number of CCTCC NO: v202122; PK15 cells, purchased from American Type Culture Collection (ATCC).
The PCV2d-HuB/2020-ORF 2:
ATGACGTATCCAAGGAGGCGTTACCGGAGAAGAAGACACCGCCCCCGCAGCCATCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCCTCCACCCCCGCCACCGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAACACCCGCCTCTCCCGCACCATCGGTTATACTGTCAAGAAAACCACAGTCAGAACGCCCTCCTGGAATGTGGACATGATGAGATTTAATATTAATGATTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCTCACTGTGCCCTTTGAATACTACAGAATAAGGAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCAATCACCCAGGGTGACAGGGGAGTGGGCTCCACTGCTGTTATTCTAGATGATAACTTTGTAACAAAGGCCAATGCCCTAACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACCATAACCCAGCCCTTTTCCTACCACTCCCGCTACTTTACCCCGAAACCTGTCCTTGATGGGACAATCGATTACTTCCAACCCAATAACAAAAGAAATCAGCTGTGGCTGAGACTACAAACTACTGGAAATGTAGACCACGTAGGCCTCGGCACTGCGTTCGAAAACAGTATATACGACCAGGACTACAATATCCGTATAACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCACTTAACCCTAAGTGA
1.2 Primary reagents and test animals
ISA206 adjuvant, purchased from french seebeck; DNA extraction kit, purchased from Jinruinhui Biotech, Inc.; porcine circovirus type 2 ELISA antibody detection kit (batch number: B20181214), purchased from Kinno, Korea; commercial seedling A and commercial seedling B (both 2B type strain inactivated seedlings) are purchased from the market. And (3) carrying out autotrophy on 120 healthy piglets of 21 days old in a large-scale group farm.
1.3 preparation and testing of inactivated vaccines
Slowly adding beta-propiolactone into porcine circovirus type 2d virus liquid according to the volume ratio of 1:2000, stirring while adding, then stirring and inactivating for 48h at the temperature of 4 ℃, and then placing in a water bath at the temperature of 37 ℃ for 2 h; taking inactivated porcine circovirus 2d type virus liquid and PK15 clone cell suspension (the cell concentration is 2 multiplied by 10)5pieces/mL) were mixed at a ratio of 1:9 and inoculated into 25cm2The cell culture flask of (1); setting virus positive control, blind transmission for 3 generations, and performing inactivation test by indirect immunofluorescence method [10](ii) a Placing the qualified inactivated virus liquid into an emulsifying container, slowly adding ISA206 adjuvant according to the proportion of 3:1 of the water phase and the oil adjuvant, stirring while adding, and then stirring for 30min at 800r/min to prepare the oil-in-water type vaccine.
And (4) carrying out aseptic and physical property inspection on the finished seedlings, and carrying out aseptic inspection according to the appendix of the current Chinese veterinary pharmacopoeia.
1.4 testing and evaluating the immune Effect of piglets
Randomly dividing 120 piglets of 21 days old into four groups, wherein each group comprises 30 piglets; respectively a test group, a commercial seedling A group, a commercial seedling B group and a control group. The neck muscle of each piglet in the three groups of the test group, the commercial vaccine A group and the commercial vaccine B group is injected with 2mL of corresponding vaccine, and the neck muscle of the control group is injected with 2mL of physiological saline. Serum was collected 7 days, 14 days, 21 days, 35 days, and 105 days after immunization, respectively. Weighing 35 days and 105 days after immunization, recording death number, and counting survival rate.
The detection of the amount of nucleic acid in serum 21 days and 105 days after immunization adopts a real-time fluorescent quantitative PCR (qPCR) method. Primers were designed based on the known PCV2 gene sequence in Genbank, with the primer sequence F: CCAGGAGGGCGTTCTGACT, R: CGTTACCGCTGGAGAAGGAA, primers were synthesized from the Huada gene. The amplification system was 20 μ L: TB Green Premix DimerEraser (2X) 10. mu.L, ROX Reference Dye (50X) 0.4. mu.L, upstream and downstream primers each (10. mu. mol/L) 0.6. mu.L, template 2. mu.L, and sterilized water 6.4. mu.L. The standard product is prepared and verified in the laboratory. The reaction procedure is as follows: 30S at 95 ℃; 5S at 95 ℃, 30S at 55 ℃, 34S at 72 ℃ and 40 cycles.
The detection of the antibody level in the serum adopts an indirect ELISA method and strictly detects according to the kit steps.
1.5 statistics and analysis
SSPS22.0 software is adopted for the test data, the data among all groups are subjected to One-factor analysis of variance (One-Way ANOVA), and the positive rate of the antigen and the antibody is compared by adopting chi-square test.
2 results and analysis
2.1 testing of vaccines
No fluorescence was observed under the fluorescence microscope, indicating complete inactivation. The appearance test is milky white, and the stability test is as follows: the demulsification phenomenon does not occur after the centrifugation at 800 Xg for 15 min. And forming sterile drops during sterile inspection, and performing the sterile inspection to be qualified.
2.2 evaluation of immune Effect on piglets
2.2.1 Effect of vaccine on body weight and survival
After the immunization for 105 days, the survival rate of the test group is 93 percent, the survival rate of the commercial seedling A group is 95 percent, the survival rate of the commercial seedling B group is 93 percent, and the survival rate of the non-immune control group is 70 percent; the survival rates of the test group and the commercial seedling group are higher than those of the control group. As can be seen from Table 1, there was no significant difference in body weight of the groups before immunization (P <0.05), and the weight gain of the test group, commercial seedling A group and commercial seedling B group was significantly higher than that of the control group (P <0.05) 35 days after immunization and 105 days after immunization.
Table 1: immunization 35 days, after 105 days, each group's body weight (kg/head)
| Index (I) | Control group | Test group | Commercial seedling A group | Commercial seedling B group |
| Body weight before immunization | 7.42±1.01a | 7.81±1.42a | 7.26±0.94a | 7.59±1.41a |
| Body weight 35 days after immunization | 16.33±1.30a | 18.74±1.40b | 17.67±1.29b | 17.82±1.19b |
| Body weight 105 days after immunization | 48.07±1.44a | 56.64±1.17b | 59.38±1.38b | 60.86±1.23b |
| Mean weight gain 35 days after immunization | 8.91±1.26a | 10.93±1.38b | 10.42±1.06b | 10.23±1.22b |
| Weight gain 105 days after immunization | 40.65±1.02a | 48.836±1.3b | 52.13±1.19b | 53.27±1.37b |
Note: in Table 1, the shoulder marks of the same row at the same age of the same day have the same lower case letters, indicating that the difference between groups is not significant (P > 0.05); shoulder marks containing non-identical lower case letters indicate significant P (< 0.05) differences between groups.
2.2.2 Effect of vaccine on piglet blood disease load
Each group of serum antigen test was negative 21 days after immunization. As can be seen from table 2, the antigen content and antigen positive rate of the test group and the two commercial vaccine groups are significantly lower than those of the negative control group (P <0.05) 105 days after immunization, and the antigen positive rate of the test group is significantly lower than those of the two commercial vaccine groups (P < 0.05).
Table 2: antigen content and antigen positive rate of each group 105 days after immunization
| Group of | Copy number (/ mL) | Positive rate (%) |
| Control group | 1.10E+08a | 83.3a |
| Test group | 5.60E+05b | 34.8b |
| Commercial seedling A group | 3.72E+06b | 57.9c |
| Commercial seedling B group | 3.22E+06b | 48.0c |
2.2.3 Effect of vaccine on piglet antibody levels
FIG. 1 is a diagram showing the results of detecting the serum antibody levels of groups at different ages of days before and after immunization in the examples, and Table 3 shows the results of detecting the positive rates of the serum antibodies of the groups before and after immunization. As can be seen from FIG. 1 and Table 3, the antibody levels of the groups before immunization are high, and the antibody positive rate is 100%, which indicates that the swine herd maternal antibody level is good; the antibody level of each group continuously drops and reaches the lowest point 35 days after immunization, but the test group still can maintain higher positive rate at the moment, and the antibody level is higher than that of the other three groups; antibodies were all elevated within each group 105 days after immunization, with no significant differences between groups (P > 0.05).
Table 3: sero-antibody positive rate of each group before and after immunization
| Group of | Pre-immune | 7 days after immunization | 14 days after immunization | 35 days after immunization | 105 days after immunization |
| Control group | 100％a | 100％a | 100％a | 71％a | 100％a |
| Test group | 100％a | 100％a | 100％a | 96％b | 100％a |
| Commercial seedling A group | 100％a | 100％a | 100％a | 67％a | 100％a |
| Commercial seedling B group | 100％a | 100％a | 100％a | 72％a | 100％a |
Note: the same column shoulder marks in table 3 contain the same lower case letters indicating that the differences between groups were not significant (P > 0.05); shoulder marks containing non-identical lower case letters indicate significant P (< 0.05) differences between groups.
In this example, the average gain of the immunized group was significantly higher than the control group, PCV2 infection often resulted in porcine dermatitis and nephrotic syndrome, exudative dermatitis, congenital tremor and enteritis, granulomatous enteritis, reproductive disorders, porcine respiratory disease syndrome, subclinical infection characterized by poor growth performance [16 ]; the inactivated vaccine developed in the research can obviously improve the average weight gain of piglets, and shows that the vaccine has a good effect on effectively improving the subclinical infection of PCV 2.
3. Conclusion
(1) The PCV2d inactivated vaccine prepared by the research has obvious effects on improving the production performance and survival rate of piglets, and has equivalent effect to commercial vaccine.
(2) The vaccine prepared by the research can obviously reduce the virus load in blood and effectively reduce the virus infection rate of swinery.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Jiangxi Zhengbang science and technology GmbH
Jiangxi Zhengbang Academy of Agricultural Sciences
<120> porcine circovirus 2d type inactivated vaccine and preparation method thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 705
<212> DNA
<213> Porcine circovirus (Portone circovirus)
<400> 1
atgacgtatc caaggaggcg ttaccggaga agaagacacc gcccccgcag ccatcttggc 60
cagatcctcc gccgccgccc ctggctcctc cacccccgcc accgttaccg ctggagaagg 120
aaaaatggca tcttcaacac ccgcctctcc cgcaccatcg gttatactgt caagaaaacc 180
acagtcagaa cgccctcctg gaatgtggac atgatgagat ttaatattaa tgattttctt 240
cccccaggag ggggctcaaa ccccctcact gtgccctttg aatactacag aataaggaag 300
gttaaggttg aattctggcc ctgctcccca atcacccagg gtgacagggg agtgggctcc 360
actgctgtta ttctagatga taactttgta acaaaggcca atgccctaac ctatgacccc 420
tatgtaaact actcctcccg ccataccata acccagccct tttcctacca ctcccgctac 480
tttaccccga aacctgtcct tgatgggaca atcgattact tccaacccaa taacaaaaga 540
aatcagctgt ggctgagact acaaactact ggaaatgtag accacgtagg cctcggcact 600
gcgttcgaaa acagtatata cgaccaggac tacaatatcc gtataaccat gtatgtacaa 660
ttcagagaat ttaatcttaa agacccccca cttaacccta agtga 705
Claims (7)
1. A preparation method of porcine circovirus 2d type inactivated vaccine is characterized by comprising the following steps:
(1) adding a vaccine inactivating agent into the porcine circovirus type 2d virus solution according to the volume ratio of 1:2000, and stirring and inactivating for 48h at the temperature of 4 ℃;
(2) mixing the inactivated virus solution and PK15 clone cell suspension according to the ratio of 1: 9;
(3) mixing with adjuvant, and stirring to obtain oil-in-water vaccine.
2. The method for preparing the porcine circovirus type 2d inactivated vaccine according to claim 1, which is characterized in that: in the inactivation process in the step (1), the vaccine inactivator is added and stirred at the same time, then stirring is carried out at the temperature of 4 ℃ for inactivation for 48h, and then the mixture is placed in a water bath at the temperature of 37 ℃ for 2 h.
3. The method for preparing the porcine circovirus type 2d inactivated vaccine according to claim 2, which is characterized in that: the vaccine inactivator is beta-propiolactone.
4. The method for preparing the porcine circovirus type 2d inactivated vaccine according to claim 1, which is characterized in that: the cell concentration of the PK15 clone cell suspension in the step (2) is 2X 105one/mL.
5. The method for preparing the porcine circovirus type 2d inactivated vaccine according to claim 1, which is characterized in that: and (3) putting the inactivated virus liquid into an emulsifying container, slowly adding the ISA206 adjuvant according to the proportion of 3:1 of the water phase to the oil adjuvant while stirring, and then stirring for 30min at 800r/min to prepare the oil-in-water type vaccine, wherein the vaccine adjuvant in the step (3) is ISA 206.
6. The porcine circovirus type 2d inactivated vaccine prepared by the method of any one of claims 1 to 5, which is characterized in that: contains inactivated PCV2d type PCV2d-HuB/2020 strain of porcine circovirus, and the strain TCID50Is 107.0The culture medium is/mL, has been preserved in China center for type culture Collection with the preservation number of CCTCC NO: v202122.
7. The porcine circovirus type 2d PCV2d-HuB/2020 CCTCC NO: the application of V202122 in preparing vaccine for preventing and treating diseases caused by porcine circovirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110450228.0A CN113117062A (en) | 2021-04-25 | 2021-04-25 | Porcine circovirus 2d type inactivated vaccine and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110450228.0A CN113117062A (en) | 2021-04-25 | 2021-04-25 | Porcine circovirus 2d type inactivated vaccine and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113117062A true CN113117062A (en) | 2021-07-16 |
Family
ID=76779733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110450228.0A Pending CN113117062A (en) | 2021-04-25 | 2021-04-25 | Porcine circovirus 2d type inactivated vaccine and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113117062A (en) |
-
2021
- 2021-04-25 CN CN202110450228.0A patent/CN113117062A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104334186B (en) | PCV/ mycoplasma hyopneumoniae combination-vaccines | |
| TWI508974B (en) | Porcine circovirus type 2, immunogenic composition containing the same, test kit, and application thereof | |
| US8703468B2 (en) | Porcine circovirus type 2B isolate and uses thereof | |
| CN101610786B (en) | Prevention and treatment of sub-clinical pcvd | |
| CN110387355B (en) | Recombinant porcine pseudorabies virus strain and vaccine for expressing porcine circovirus Cap protein gene as well as preparation method and application thereof | |
| WO2009030684A2 (en) | Reduction of concomitant infections in pigs by the use of pcv2 antigen | |
| EP4176899A1 (en) | Porcine circovirus type 2 (pcv2) subunit vaccine | |
| US20140348874A1 (en) | Method for the reduction of pcv-2 in a herd of swine | |
| EP3460053A1 (en) | Porcine astroviruses and the uses thereof | |
| CN111876391A (en) | Feline panleukopenia virus FPV BJ05 strain and application thereof | |
| CN115141812A (en) | Acremonium carbonum vaccine strain and application thereof | |
| CN106854647B (en) | Duck viral hepatitis bivalent yolk antibody and preparation method and application thereof | |
| CN102727883B (en) | Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof | |
| CN100489092C (en) | Type II genetic marker strain of porcine circovirus and its application | |
| Liu et al. | Genetic and immunogenicity analysis of porcine circovirus type 2 strains isolated in central China | |
| CN113521271A (en) | Porcine reproductive and respiratory syndrome bivalent inactivated vaccine and preparation method thereof | |
| CN108300703B (en) | Deer source bovine viral diarrhea inactivated vaccine and preparation method thereof | |
| CN113117062A (en) | Porcine circovirus 2d type inactivated vaccine and preparation method thereof | |
| CN108660115B (en) | Porcine circovirus type 3 strain, vaccine composition thereof, preparation method and application | |
| CN112522212B (en) | Porcine epidemic diarrhea virus strain and combined immunization method of inactivated vaccine and interferon thereof | |
| CN115161291A (en) | Cat parvovirus strain and application thereof | |
| CN110343670B (en) | Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof | |
| CN109897832B (en) | Porcine circovirus type 3 virus strain and application thereof | |
| CN110974951B (en) | Bivalent inactivated vaccine and preparation method thereof | |
| CN109504664B (en) | III type duck hepatitis A virus chicken embryonated attenuated strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210716 |