CN113106119B

CN113106119B - Method, system and application for inhibiting expression of endogenous genes of blueberry fruits

Info

Publication number: CN113106119B
Application number: CN202110414401.1A
Authority: CN
Inventors: 周扬颜; 莫翱玮; 陈文秀; 孙卫健; 许鹏昊; 郭鹏
Original assignee: Shandong Dafengyuan Agricultural Co ltd
Current assignee: Shandong Dafengyuan Agricultural Co ltd
Priority date: 2021-04-16
Filing date: 2021-04-16
Publication date: 2022-09-27
Anticipated expiration: 2041-04-16
Also published as: CN113106119A

Abstract

The invention provides a method for inhibiting the expression of endogenous genes of blueberry fruits, which comprises the following steps: immersing the punched blueberry fruits into agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a TI auxiliary plasmid and agrobacterium infection suspension consisting of 2- (N-morpholine) ethanesulfonic acid, magnesium chloride and acetosyringone agrobacterium infection liquid to obtain a mixture; and putting the mixture into a vacuum environment with the pressure of 0.01-0.085MPa for treatment for 3-15 min. Wherein the RNAi expression cassette in the T-DNA donor vector contains an RNAi vector target sequence having an expression element, a site for insertion of the RNAi vector target sequence having the expression element, or a DNA fragment having the expression element for replacement of the RNAi vector target sequence. The method can effectively inhibit the expression of the endogenous genes of the blueberry fruits.

Description

Method, system and application for inhibiting expression of endogenous genes of blueberry fruits

Technical Field

The invention belongs to the field of plant genetic engineering, relates to a method, a system and application for inhibiting endogenous gene expression of blueberry fruits, and particularly relates to a method, a system and application for inhibiting endogenous blueberry ACO1 gene expression.

Background

Blueberries (Latin: Vaccinium Spp. English: Blueberry), also known as Vaccinium myrtillus and blueberries, belong to the Ericaceae (Ericaceae) Vaccinium subfamily (Vaccinioideae) plant genus Vaccinium. The blueberry is rich in nutrition, not only is rich in conventional nutrient components, but also contains extremely rich flavonoid and polysaccharide compounds. The blueberry fruit contains the functional substances for preventing cranial nerve aging, enhancing cardiac function, improving eyesight, resisting cancer and the like. The late maturity of the blueberries is realized by inhibiting the expression of genes related to the maturation of the blueberries, so that the mass maturation of the blueberries is avoided, and the blueberry mature-preventing agent has a series of industrial values for storage and picking of the blueberries.

Fruit ripening, senescence and quality development are complex processes, which are the result of the combined action of multiple factors, such as genetics and environment, wherein hormone regulation is one of the important factors for regulating fruit ripening and quality. Ethylene, one of the five major plant hormones, is a structurally simple organic molecule with complex biological functions, which affects the growth and development of higher plants, including promoting fruit ripening, flower senescence, petal and leaf abscission, inhibiting the elongation of the stems of most dicotyledonous plants, stimulating root development, and the like. Ethylene also plays an important role in plant response to biotic and abiotic stresses, including pathogen invasion, water immersion, cold injury, mechanical injury, and the like. The biosynthetic pathway for ethylene in higher plants has been demonstrated by Yarg and Hoffman, the first step being the conversion of s-adenosylmethionine (SAM) to ACC catalyzed by 1-aminocyclopropane-1-carboxylic acid synthetase (ACS), followed by the oxidation of ACC by ACC oxidase (ACO) to form ethylene, which is involved in plant growth and development, and thus, the ACO gene is a key gene for ethylene synthesis.

Transient transfection is one of the ways to introduce DNA into eukaryotic cells. In transient transfection, recombinant DNA is introduced into a highly infectious cell line to obtain transient and high-level expression of the gene of interest. At present, the common transient expression method in fruits is an injection method, but the method is mostly suitable for fruits with soft pulp, such as tomatoes, strawberries and the like.

Because the cell combination of blueberry fruits is too tight, the structure and the characteristics of the fruits are different from those of the fruits studied in the past, and the transient expression method for common fruits is not suitable for the blueberry fruits, so the method of needle injection is not feasible.

Since agrobacterium can only infect cells at the wound of plant tissue in the presence of a specific induction factor, and the infection is directly carried out by using an injection mode in the researches, the infection efficiency is severely limited. Subsequent research work has higher requirements on the transient transfection efficiency in blueberry fruits, so that the demand of an efficient transient transfection method for blueberry fruits is very urgent.

Disclosure of Invention

The invention particularly relates to a method for inhibiting endogenous genes of blueberry fruits by transient expression of blueberry fruits based on vacuum infiltration. The method comprises the following steps of suspending activated agrobacterium by using agrobacterium infection liquid containing a T-DNA donor vector of RNAi expression elements; pricking blueberry fruits with toothpick heads; putting the blueberry fruits into an agrobacterium infection solution, and vacuumizing to promote the agrobacterium to permeate plant tissues; and (4) dark culturing the blueberry fruits infected by the agrobacterium. The method combines fruit pretreatment and vacuum treatment to realize the infiltration of agrobacterium into blueberry fruits, thereby realizing the efficient infection of blueberry fruit cells by agrobacterium and realizing the efficient transient expression of exogenous genes to inhibit endogenous genes.

In order to solve the problems that the efficiency of inhibiting the endogenous genes of blueberry fruits is low and the like caused by the infection of blueberry fruits by agrobacterium in the prior art, the invention provides a method for inhibiting the expression of the endogenous genes of blueberry fruits in a first aspect, and the method comprises the following steps:

s1: punching the surface of the blueberry fruit to obtain punched blueberry fruit;

s2: immersing the punched blueberry fruits into an agrobacterium infection suspension to obtain a blueberry fruit infection suspension mixture;

the agrobacterium infection suspension comprises recombinant agrobacterium and an agrobacterium infection solution;

the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a TI auxiliary plasmid;

the T-DNA donor vector comprises an RNAi expression cassette comprising an RNAi vector target sequence having an expression element, a site for insertion of the RNAi vector target sequence having the expression element, or a DNA fragment having the expression element for replacement of the RNAi vector target sequence;

the agrobacterium infection solution contains 2- (N-morpholine) ethanesulfonic acid, magnesium chloride and acetosyringone;

s3: and putting the blueberry fruit infection suspension mixture into a vacuum environment to obtain the blueberry fruit subjected to vacuum treatment, wherein the pressure of the vacuum environment is 0.01-0.085MPa, and the treatment time is 3-15 min.

In some embodiments, the RNAi expression cassette is transient gene expression.

In some embodiments, in step S1, the blueberry fruit is selected from the large green stage blueberry fruits.

In some embodiments, in step S1, the depth of the perforations is 4-5 mm.

In some embodiments, in step S1, the inner diameter of the punch hole is 1-2 mm.

In some embodiments, in step S1, the number of holes punched in a blueberry fruit is 3-10.

In some embodiments, in step S1, the holes of a blueberry fruit are punched at intervals of 5-15 mm.

In some embodiments, in step S1, the punching is performed using a sterile needle or a sterile rod.

In some embodiments, in step S2, the T-DNA donor vector and the Ti helper plasmid are simultaneously or sequentially transformed into the agrobacterium tumefaciens host bacterium to form the recombinant agrobacterium.

In some embodiments, in step S2, the T-DNA donor vector is transformed into the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid to form the recombinant agrobacterium.

In some embodiments, in step S2, the RNAi vector target sequence is recombined into the T-DNA donor vector using the Gateway cloning method.

In some embodiments, in step S2, the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105.

In some embodiments, in step S2, the promoter of the RNAi vector target sequence in the T-DNA donor vector is a NOS promoter, a MAS promoter, or a CaMV 35S promoter.

In some embodiments, in step S2, the terminator of the RNAi vector target sequence in the T-DNA donor vector is a NOS terminator.

In some embodiments, in step S2, the T-DNA donor vector is a binary expression vector.

In some embodiments, in step S2, the T-DNA donor vector is the binary expression vector pCAMBIA-1300 or the binary expression vector Gateway ^TM 277 vector.

In some embodiments, in step S2, the agrobacterium-infected fluid comprises: 8-12mM MgCl ₂ 150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, aqueous solution, pH 5.0-6.0.

In some embodiments, in step S2, the Agrobacterium-infected liquid is used after filter sterilization with a frit having a pore size of 0.02 μm.

In some embodiments, in step S2, the propagation medium of the recombinant agrobacterium is LB liquid medium containing an antibiotic.

In some embodiments, in step S2, the propagation medium of the recombinant Agrobacterium is LB liquid medium containing 30-80mg/l rifampicin and 50-150mg/l kanamycin.

In some embodiments, in step S2, the propagation culture of the recombinant agrobacterium is performed to the use concentration OD ₆₀₀ ＝0.5-1.0。

In some embodiments, in step S2, the agrobacterium infection suspension is prepared by:

centrifuging the culture of the recombinant agrobacterium, and removing a supernatant to obtain a first precipitate;

washing the first precipitate with the agrobacterium-infected liquid, centrifuging, and removing a supernatant to obtain a second precipitate;

and re-suspending the second precipitate by using the agrobacterium infection liquid to obtain the agrobacterium infection suspension.

In some embodiments, in step S2, the conditions for each centrifugation are: centrifuging at 4000-.

In some embodiments, in step S2, the agrobacterium-infected liquid is activatedThe method comprises the following steps: culturing the recombinant agrobacterium with LB liquid culture medium to bacterial liquid OD ₆₀₀ ＝0.5-1.0。

In some embodiments, in step S2, the RNAi vector target sequence is directed against the blueberry ACO1 gene.

In some embodiments, the protein sequence encoded by the blueberry ACO1 gene is shown in SEQ ID No. 6.

In some embodiments, the coding sequence of the blueberry ACO1 gene is shown in SEQ ID No. 5.

In some embodiments, RNAi is performed against the target sequence of the blueberry ACO1 gene as shown in SEQ ID No. 7.

In some embodiments, in step S3, the pressure of the vacuum environment is 0.016-0.08 MPa.

In some embodiments, in step S3, the processing time is 5-10 min.

In some embodiments, in step S3, the vacuum-treated blueberry fruit is washed clean.

In some embodiments, in step S3, the composition of the wash solution is: 8-12mM MgCl ₂ 150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

The method further comprises the steps of:

s4: and (4) culturing the blueberry fruits subjected to vacuum treatment in a dark environment.

In some embodiments, in step S4, the incubation temperature is 20-28 ℃.

In some embodiments, in step S4, the culturing period is 1-10 days.

In some embodiments, in step S4, the humidity of the cultivation is 65-80%.

In some embodiments, in step S4, the humidity is maintained in a solution environment of: 8-12mM MgCl ₂ 150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

In a second aspect of the invention, a system for inhibiting the expression of endogenous genes in blueberry fruit is provided, the system comprising:

the punching device is used for punching the blueberry fruits;

a sealable container for holding blueberry fruit;

a vacuum evacuation device for evacuating the sealable container;

the method comprises the following steps of (1) carrying out agrobacterium infection suspension, wherein the agrobacterium infection suspension comprises recombinant agrobacterium and an agrobacterium infection solution; the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a Ti auxiliary plasmid; the T-DNA donor vector comprises an RNAi expression cassette comprising an RNAi vector target sequence having an expression element, a site for insertion of the RNAi vector target sequence having the expression element, or a DNA fragment having the expression element for replacement of the RNAi vector target sequence; the agrobacterium infection solution contains 2- (N-morpholine) ethanesulfonic acid.

In some embodiments, the gene expression is transient gene expression.

In some embodiments, the puncturing device is a sterile needle or a sterile rod.

In some embodiments, the diameter of the needle where the sterile needle is thick is 1-2 mm.

In some embodiments, the sterile shaft has a diameter of 1-2 mm.

In some embodiments, said T-DNA donor vector is transformed into said agrobacterium tumefaciens host bacterium containing said Ti helper plasmid to form said recombinant agrobacterium.

In some embodiments, the RNAi vector target sequence is recombined into the T-DNA donor vector using the Gateway cloning method to provide the T-DNA donor vector containing the RNAi vector target sequence.

In some embodiments, said T-DNA donor vector and said Ti helper plasmid are used to transform said agrobacterium tumefaciens host bacterium, simultaneously or sequentially, to form said recombinant agrobacterium.

In some embodiments, the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105.

In some embodiments, in the T-DNA donor vector, the promoter of the RNAi vector target sequence is a NOS promoter, a MAS promoter, or a CaMV 35S promoter.

In some embodiments, in the T-DNA donor vector, the terminator of the RNAi vector target sequence is a NOS terminator.

In some embodiments, the T-DNA donor vector is a binary expression vector.

In some embodiments, the T-DNA donor vector is a binary expression vector pCAMBIA-1303 or a binary expression vector Gateway ^TM 277 vector.

In some embodiments, the agrobacterium infection fluid comprises the following components: 8-12mM MgCl ₂ 150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

In some embodiments, the Agrobacterium-infected liquid is formed after filter sterilization using a frit having a pore size of 0.02 μm.

In some embodiments, the RNAi vector target sequence is directed to a blueberry ACO1 gene.

In some embodiments, the RNAi vector target sequence is directed to the target sequence shown in SEQ ID No. 7.

In some embodiments, the system further comprises: a centrifugal machine.

In a third aspect, the invention provides the use of the method of the first aspect or the system of the second aspect in inhibiting the expression of endogenous genes in blueberry fruits.

In some embodiments, the RNAi expression cassette is transiently expressed.

In some embodiments, the variety of blueberries is selected from JE, duke, jewelry, regex, mist, early blue, blue gold, blue tower, dolomitic.

The invention has the beneficial effects that: the method for improving the infection of the blueberry fruit by the agrobacterium tumefaciens is provided, and the agrobacterium tumefaciens is permeated into fruit tissues by combining fruit period selection and vacuum treatment, so that the blueberry cell is efficiently infected by the agrobacterium tumefaciens; and the high-efficiency transient expression of exogenous genes in the blueberry fruits can be realized.

1) The gene expression has tissue specificity, and the genetic operation in the blueberry fruit can better research the gene expression condition in the fruit, so that the research result is prevented from being effective in other tissues but ineffective in the fruit.

The fruit is directly used for genetic research, which is more beneficial to promoting the scientific research of improving the fruit.

2) The transgenic plant has high manufacturing cost and long time for tissue culture and plant propagation, and the invention can be rapidly researched.

3) Some genetic operations are lethal to plants, and corresponding operations cannot develop to obtain complete transgenic plants, so that the research work of related gene transgenic models of blueberries is limited, the defects can be avoided by operating from fruits, the blueberry genetics can be researched more comprehensively, and a new model is provided for improving the quality of the blueberries.

The gene ACO1 is constructed on a plant expression vector and is introduced into blueberries for expression, the obtained ACO1 interference transgenic blueberries are subjected to fruit maturation related physiological biochemical and molecular biological detection, and the ACO1 is confirmed to change the maturation process of the blueberries, so that a foundation is laid for the later-stage capability of improving the maturation process of the blueberries and other non-respiratory-climacteric fruits by using the gene.

The invention respectively separates and clones a complete cDNA fragment and a C-terminal specific terminal sequence fragment of a blueberry fruit ripening gene, transfers a target gene into a receptor plant by using an agrobacterium-mediated method and interferes expression, and further verifies the function of the gene in the blueberry fruit ripening process through experiments, thereby laying a foundation for the capacity of improving the blueberry and other non-respiratory transition type fruit ripening processes by using the gene in the later period.

The ACO1 gene is subjected to interference expression in blueberries, and the ripening process of fruits can be remarkably delayed, so that the marketing time of the fruits can be artificially controlled, the taste characteristics of the fruits are not changed, compared with the method for treating the fruits by using artificial hormones, the method is more environment-friendly, and the effect is more stable, so that the method has obvious advantages and irreplaceable importance. The method can provide convenience for the large-scale production of the non-respiratory-jump fruits, can reasonably regulate and control the time of the fruits to appear on the market, greatly reduces the loss caused by actual over-mature rot, can save the cost for agricultural production and improve the management level, and therefore, the method has wide market application prospect.

Drawings

FIG. 1 is a diagram of a map of pCAMBIA-1300 binary expression vector.

FIG. 2 is a graph showing a comparison of the relative values of the RNA expression levels of EGFP.

FIG. 3 is Gateway ^TM pDONR ^TM Map of vector 221.

FIG. 4 shows Gateway ^TM 277vector map diagram.

FIG. 5 recombinant Gateway ^TM 277vector plasmid electropherogram.

FIG. 6 is a schematic diagram of the comparison of blueberry ACO1 gene expression level.

FIG. 7 is a control schematic of soluble sugar content.

FIG. 8 is a comparison of the content of anthocyanins.

FIG. 9 is a comparative graph showing fruit firmness.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Referring to the kit, the procedure was performed according to the instructions for the kit.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Defining:

RNAi gene target sequence:

target sequences silenced or interfered by RNAi means, RNAi silencing or degrading RNAi gene target sequences through a series of biochemical reactions, such as transcripts of blueberry ACO1 gene or fragments thereof, which are desired to down-regulate expression or silencing.

RNAi vector target sequence:

in the vector, a sequence with a sequence homology with the RNAi gene target sequence can be expressed, and the RNAi vector target sequence serves as single-stranded or double-stranded RNA for degrading or silencing the RNAi gene target sequence in a transcript, for example, a homologous sequence fragment on the vector capable of degrading or silencing blueberry ACO1 gene after expression.

RNAi expression cassette:

a gene expression unit having a promoter, terminator and the RNAi vector target sequence described above, e.g., a T-DNA donor vector, can be transferred into plant tissue by Agrobacterium mediation, and can be transcribed in the plant tissue described above, so as to express a gene expression unit capable of degrading or silencing an endogenous gene of the host by virtue of the genetic machinery of the T-DNA donor vector and/or the host cell.

Example 1: transient expression method based on vacuum infiltration is utilized to express EGFP gene in blueberry fruit

1. Agrobacterium culture

Binary expression vector pCAMBIA-1300: sequence information: https:// www.ncbi.nlm.nih.gov/nucleotide/KX400856.1, referable to FaPAO5 regulations spring/spring levels as a signaling along the street berry from road pending [ J ]. Plant Direct,2020,4(5), professor group of Shenyuanyue of Beijing college of agriculture, the map of which is shown in FIG. 1.

Agrobacterium tumefaciens GV3101 was purchased from Bomeide.

And transferring the binary expression vector pCAMBIA-1300 into the obtained competent agrobacterium tumefaciens GV3101 by a freeze-thaw conversion method to obtain the transformed agrobacterium tumefaciens.

After Agrobacterium tumefaciens GV3101 strain containing pCAMBIA-1300 binary expression vector is activated conventionally, the activation steps are: picking single colony in LB liquid culture medium of 5-10ml, placing in constant temperature shaking table (200rpm/30 ℃) overnight, pouring out bacterial liquid, adding fresh LB liquid of 5-10mlThe culture medium is continuously shaken until the bacterial liquid OD is reached ₆₀₀ ≈0.5-1.0。

Culturing at 30 ℃ for about 12h in 10ml LB liquid medium (containing 50mg/l Rif (rifampin) +100mg/l Kan (kanamycin)) to OD ₆₀₀ And the value is about 0.8, and the next step of experiment is carried out. A total of 3 parts of the same Agrobacterium culture were prepared.

2. Selection of blueberry fruit

According to the blueberry fruit development law, the blueberry fruit development stage is divided into 6 stages: a green period: about 6 days after fruit setting; middle green period: about 14 days after fruit set; ③ period of heavy green: the whole fruit is light green; fourthly, initial purple period: the initial part of the surface of the fruit turns purple; the purple stage: large area of fruit surface is changed into purple; sixthly, the full violet stage: the fruit surface turns purple.

The 'jewelry' variety of big green blueberry fruits with consistent development period, no insect eyes, no deformity and uniform size are selected.

3. Fruit pretreatment

Punching 6 holes with the same depth (depth: 4-5mm) on the blueberry fruits from all directions by using sterilized toothpicks, wherein the spacing distance between the holes is kept consistent (distance: 4 mm). The pre-treated fruit required immediate follow-up experiments.

4. Infection with Agrobacterium

Preparing an agrobacterium infection solution: 10mM MgCL ₂ 200 μ M AS (acetosyringone), 10mM MES (2- (N-morpholine) ethanesulfonic acid), aqueous, pH 5.7; after the preparation, the mixture is filtered and sterilized by a filter head with the specification of 0.02 mu m.

Preparing an agrobacterium infection control solution: 10mM MgCl ₂ 200 μ M AS, aqueous solution, pH 5.7, after preparation, filter sterilized with a 0.02 μ M filter.

Centrifuging 10ml of agrobacterium liquid at 6000rpm for 5min, removing supernatant, washing with 10ml of prepared agrobacterium infection liquid for 1 time, centrifuging at 6000rpm for 5min, removing supernatant, and re-suspending with 10ml of the agrobacterium infection liquid to obtain suspension 1.

Meanwhile, centrifuging another 1 part of 10ml of agrobacterium liquid for 5min, removing the supernatant, and infecting the control liquid with 10ml of agrobacterium for heavy suspension to obtain suspension 2.

Experimental groups: the holed fruits were carefully transferred with tweezers into the aforementioned suspension 1, gently submerged therein. The sample was placed in a vacuum desiccator (model GM-0.33A, available from Tianjin, Jinteng laboratories, Inc.) and evacuated to a pressure of 0.08MPa for 5 min.

Meanwhile, a control group 1 is made, and the difference with the experimental group is that the vacuum pumping treatment is carried out, the pressure is 0.016MPa, and the temperature is kept for 5 min; the control group 2, except that no vacuum treatment, other experimental conditions were completely consistent with those of the experimental group; the difference between the control group 3 and the experimental group is that the reaction is maintained at 0.08MPa for 10 min; control group 4, the difference from the experimental group, was that the fruits were infested with suspension 2 and kept under vacuum pressure of 0.08MPa for 5 min. The suspension 1 was also injected into the fruit from the surface of the blueberry fruit by sucking with a syringe without a needle, and used as a control group 5.

5. Dark culture of infected sample

The fruits of the experimental and control groups 1-4 were each removed and washed 2 times with 30ml of the aforementioned Agrobacterium-free infection solution. At the same time, a layer of filter paper was laid on a glass plate and 5ml of sterile Agrobacterium infection solution described previously was added for wetting. The washed fruits were gently placed on filter paper, placed in a dark environment, and cultured at 24 ℃. For blueberry fruits injected with the bacterial liquid, the blueberry fruits are directly cultured in the dark at room temperature and carefully moisturized (the humidity is 90%).

6. Fruit RNA extraction

Respectively taking about 0.5g of each fruit which is cultured in dark for nine days and then placed for nine days, grinding the fruit in liquid nitrogen, and extracting the total RNA of the fruit by using a plant total RNA extraction kit (purchased from Tiangen company) according to the operation of a kit specification.

qPCR assay analysis of over-expressed Gene expression in blueberry

Quantitative PCR analysis is carried out on potential EGFP RNA in total RNA of the blueberry fruits treated in the previous steps by taking F1(SEQ ID NO.1) and R1(SEQ ID NO.2) as primers.

F1：5’-ATGGTGAGCAAGGGCGAGGAG

R1：5’-TTACTTGTACAGCTCGTCCATGC

Calculating the relative value of the RNA expression quantity of EGFP in other groups by taking the RNA expression quantity of EGFP in the control group 5 as 1, testing for three times in parallel, taking an average value, and respectively and sequentially representing the RNA expression quantity of EGFP in blueberry fruits treated by the experimental group, the control group 1, the control group 2, the control group 3, the control group 4 and the control group 5 by a qPCR (fluorescent dye method) experimental analysis result as shown in figure 2, A, B, C, D, E, F, wherein the expression quantity represents obvious difference.

It can be seen that the RNA expression level of EGFP was very low in control group 2 which had not been treated with vacuum and control group 4 which had been treated with the Agrobacterium-infected control solution.

EGFP was expressed in a moderate amount of RNA in control group 5 injected with a syringe.

In the experimental group, the RNA expression level of EGFP was higher in the control group 1 and the control group 3.

Therefore, the methods in the experimental group, the control group 1 and the control group 3 can effectively express the exogenous genes in the blueberry fruits.

Example 2: cloning of the ACO1 Gene

According to GenBank number: the Arabidopsis thaliana ACO1 gene of NM _127517, the homologous gene corresponding to the blueberry from Blast at www.vaccinium.org website, utilizes Snapgene software to design primers F2(SEQ ID NO.3) and R2(SEQ ID NO.4) for amplifying blueberry ACO1 gene, and has the following sequence.

F2：5’-ATGGAGGTCCCTGTTATAGACTTTGA

R2：5’-TCAAACCGGAAGACTCTGGTGC

Aiming at blueberry (jewelry) fruits, a plant total RNA extraction kit is used for extracting total RNA.

Reverse transcription: the reverse transcription kit of Tiangen is used.

And performing PCR amplification on the blueberry ACO1 gene by using F2 and R2 by taking the cDNA as a template.

The agarose gel electrophoresis pattern of the amplified product showed a band of about 900bp in length.

Sequencing the amplified product to obtain a blueberry ACO1 gene coding sequence (SEQ ID NO.5) as follows:

5’-ATGGAGGTCCCTGTTATAGACTTTGATAAGCTTGATGGTGAGAAGAGAGGTGAAACCATGGCACTTCTCCACCAAGCTTGTGAAAAGGGGGGCTTCTTTCAGATTGAGAACCATGGAATTGACACAGAGTTGATGGACAAAGTCAAGTACTTGGTGAATCAGCATTATGAGGAGAATATGAAAAAAAGCTTCTACGAATCGGACATAGCCAAGGGATTGGAGGAGAAAAGGATTACCTCTGATACAGACTGGGAAAGCACCTTCTTCGTTTGGCATCGTCCGAATTCCAACATCAATGAGCTCACAAACCTCTCAGATGACCTCCGCATGACGATGGATGCGTATATCAATCAACTGATCAAGCTAGCAGAGAAACTGTCGGAGCTCATGTGCGAAAATCTTGGTTTAGAGAAAGATTACATAAAGGAAGCATTTTCAGGAAGCAAAGGTCCATCTGTAGGAACCAAAGTGGCTAAATACCCACAATGTCCTCACCCTGAACTTGTTAGAGGGCTTCGTGAGCATACGGATGCTGGTGGGATCATTCTCTTACTCCAAGACGATGAAGTCCCAGGTCTTCAATTCCATAAAGATGGAAAATGGGTAGAAATTCCACCTTCTAAGAATAACAGCATCTTTATCAACACAGGTGATCAAGTGGAAGTGGTAACTAATGGAAGGTACAAGAGTACTTTGCACCGTGTAATCGCAGATAAGAACGGAAGCAGAATCTCTATCGCCACCTTCTACAATCCCGCTGGAGATGCTGTCATTTCTCCAGCTCCCAAACTCTTATACCCCAACCACTTCCGTTTTCAAGATTATCTGAACCTTTATGGTTCAACTAAGTTTGAAGACAAGGGTCCCCGATTCGAATCCATGAAGAAAATGCCGAACGGGCACCAGAGTCTTCCGGTTTGA

the corresponding amino acid sequence (SEQ ID NO.6) of the blueberry ACO1 gene protein is as follows:

MEVPVIDFDKLDGEKRGETMALLHQACEKGGFFQIENHGIDTELMDKVKYLVNQHYEENMKKSFYESDIAKGLEEKRITSDTDWESTFFVWHRPNSNINELTNLSDDLRMTMDAYINQLIKLAEKLSELMCENLGLEKDYIKEAFSGSKGPSVGTKVAKYPQCPHPELVRGLREHTDAGGIILLLQDDEVPGLQFHKDGKWVEIPPSKNNSIFINTGDQVEVVTNGRYKSTLHRVIADKNGSRISIATFYNPAGDAVISPAPKLLYPNHFRFQDYLNLYGSTKFEDKGPRFESMKKMPNGHQSLPV

example 3: construction of RNAi vector for ACO1 Gene

In this example, the Gateway cloning technique was used, and the vectors used in the steps (II), (III) and (IV) were purchased from Thermo Fisher Scientific, Inc. and were used according to the vector instructions.

(one) primer design

The RNAi gene target sequence (ACO1-RNAi, SEQ ID NO.7) of the corresponding blueberry ACO1 gene is as follows:

AUGGAGGUCCCUGUUAUAGACUUUGAUAAGCUUGAUGGUGAGAAGAGAGGUGAAACCAUGGCACUUCUCCACCAAGCUUGUGAAAAGGGGGGCUUCUUUCAGAUUGAGAACCAUGGAAUUGACACAGAGUUGAUGGACAAAGUCAAGUACUUGGUGAAUCAGCAUUAUGAGGAGAAUAUGAAAAAAAGCUUCUACGAAUCGGACAUAGCCAAGGGAUUGGAGGAGAAAAGGAUUACCUCUGAUACAGACUGGGAAAGCACCUUCUUCGUUUGGCAUCGUCCGAAUUCCAACAUCAAUGAGCUCACAAACCUCUCAGAUGACCUCCGCAUGACGAUGGAUGCGUAUAUCAAUCAACUGAUCAAGCUAGCAGAGAAACUGUCGGAG

primers F3(SEQ ID NO.8) and R3(SEQ ID NO.9) for adding attB joints to the RNAi gene target sequence of blueberry ACO1 gene are designed according to the RNAi gene target sequence (SEQ ID NO.7) of ACO1 gene by utilizing Snapgene software, and the sequences are as follows.

F3:5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGTCCCTGTTATAGA

R3:5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCCGACAGTTTCTCTGCTAGCTT

PCR was carried out using F3 and R3 as primers and the same materials and methods as in example 2, and the amplification product was referred to as attB-ACO1 product.

(II) BP reaction

Materials:

BP Clonase ^TM II Enzyme Mix

1. a1.5 ml centrifuge tube was taken, and the following ingredients were added at room temperature and mixed well:

attB-ACO1 product (. gtoreq.10 ng/. mu.l; final content 15-150ng), 1-7. mu.l 221vector (150 ng/. mu.l) 1. mu.l (i.e., donor vector Gateway) ^TM pDONR ^TM 221vector, available from Thermo Fisher Scientific, inc, for structural drawing see fig. 3);

TE buffer, pH 8.0, was added to a final volume of 8. mu.l.

2. BP clone ^TM II enzyme mix was placed on ice for 2min, vortexed 2 times for 2s each.

3. Add 2. mu.l BP clone to the sample mixture of step 1 ^TM II enzyme mix, mix the reaction product by simple vortexing twice.

4. Unused BP clone ^TM II putting the enzyme mix back to a refrigerator at the temperature of 20 ℃ below zero for storage.

And (3) incubating the mixture obtained in the step 3 for 1h at the temperature of 5.25 ℃.

6. The reaction was stopped by adding 1. mu.l of protease K solution. And (3) incubating for 10min at 37 ℃ to obtain a BP reaction product.

(III) conversion

Mu.l of the BP reaction product (code: 221-ACO1-RNAi) was added to 50. mu.l of Trans1-T1 E.coli competent cells, gently mixed, incubated on ice for 30min, heat-shocked at 42 ℃ for 60s, added to 500. mu.l of LB medium, and shake-cultured at 37 ℃ and 180rpm for 1 hour. Mu.l and 100. mu.l of the recombinant vector were applied to LB (50mg/l kanamycin) solid plates, followed by positive identification, sequencing (preservation of sequencing colonies), and quality improvement to obtain recombinant donor vectors for use.

(tetra) LR reaction

Reagent: gateway ^TM LR Clonase ^TM II Enzyme Mix

1–7μL 221-ACO1-RNAi(50–150ng)；

1 μ L277 vector (150 ng/. mu.L) (i.e., the object vector Gateway) ^TM 277vector, available from Thermo Fisher Scientific, inc, structural drawing see fig. 4);

TE buffer, pH 8.0, was added to a final volume of 8. mu.L.

2. LR clone ^TM II enzyme mix was placed on ice for 2min, vortexed 2 times for 2s each.

3. Add 2. mu.l LR clone to the sample mixture of step 1 ^TM II enzyme mix, mix the reaction product by simple vortexing twice.

4. Unused LR clone ^TM II putting the enzyme mix back to a refrigerator at the temperature of 20 ℃ below zero for storage.

6. The reaction was stopped by adding 1. mu.l of protease K solution and vortexed. And (4) incubating for 10min at 37 ℃ to obtain an LR reaction product.

(V) transformation

Mu.l of LR reaction product (277-ACO1-RNAi) was added to 50. mu.l of Trans1-T1 E.coli competent cells, mixed gently, incubated on ice for 30min, heat-shocked at 42 ℃ for 60s, added with 500. mu.l of LB medium, and shake-cultured at 37 ℃ and 180rpm for 1 h. Mu.l and 100. mu.l were applied to LB (100. mu.g/ml spectinomycin) solid plates, respectively, after which the strain P was preserved, and 293 plasmid was extracted and recombined. The obtained competent Agrobacterium tumefaciens GV3101 was transformed by the same method as in step 1 of example 1 to obtain a transformed Agrobacterium.

The F4 and R4 primers were used for general PCR and verified by agarose gel electrophoresis, and the recombination was successful, as shown in FIG. 5.

Example 4: infection of fruit

1. Selection of blueberry fruit

The same procedure as in step 2 of example 1 was followed to select "jewelry" variety of large green stage blueberry fruit.

2. Fruit pretreatment

Same as in step 3 of example 1.

3. Infection with Agrobacterium

The pretreated blueberry fruit was infected with the transformed agrobacterium prepared in example 3, the procedure was the same as in example 1, step 4.

And (3) obtaining the blueberry fruit infected by the recombinant agrobacterium.

4. Dark culture of infected sample

Same as the experimental group in example 1. Dark culture was performed for 2 days.

Example 5: determination of ACO1 expression amount

The ACO1-RNA content of blueberry fruits and wild blueberry fruits (two groups of blueberry fruits are fruits in the same batch) infected by the recombinant agrobacterium cultured in the dark in the example 4 are respectively measured.

(1) Extracting total RNA of blueberry fruit

And extracting the total RNA in 3 blueberry fruits in each group by using a total RNA extraction kit of the Tiangen plant.

(2)qPCR

F4(SEQ ID NO.10) and R4(SEQ ID NO.11) are used as primers, and quantitative PCR (fluorescent dye method) analysis is carried out on the potential ACO1 gene expression quantity in the total RNA of each blueberry fruit.

F4：5’-AAAGGTCCATCTGTAGG

R4：5’-GTAAGAGAATGATCCCA

(3) Results

Interfering with the expression of the ACO1 gene, the expression level of the fruit ACO1 gene is obviously reduced (the gene expression level is shown in a figure 6). Experimental data the significance of differences analysis was performed using SPSS. The experiment was set up in triplicate and the data was analyzed by taking the average of the triplicates.

Example 6: determination of soluble sugar content

Blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (two groups of blueberry fruits are fruits of the same batch) are respectively subjected to blueberry soluble sugar content measurement.

(1) Measurement method

The measurement of soluble sugar in fruit was carried out using a digital display sugar meter (Shanghai apparatus electro-physical optical apparatus Co., Ltd., model WYA-3S). According to the method of the instrument specification, respectively smearing the blueberry fruit juice on a sugar measuring instrument, reading the reading, wherein the unit is as follows: % of the total weight of the composition.

(2) Measurement results

Experimental data differential significance analysis was performed using SPSS. The experiment was set up in triplicate and the data was analyzed by taking the average of three replicates (see figure 7 for soluble sugar content control).

The expression of the ACO1 gene is interfered, and the content of soluble sugar in the fruit is obviously reduced.

Therefore, compared with wild blueberries, the interference of ACO1 gene expression inhibits fruit ripening.

Example 7: anthocyanin content determination

The blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (two groups of blueberry fruits are fruits in the same batch) are respectively subjected to anthocyanin content measurement.

(1) Measurement method

(i) Preparation of anthocyanin extract

The main anthocyanin in the blueberry is pelargonidin-3 glucoside, and the anthocyanin extracting solution mainly takes pelargonidin-3 glucoside as an extraction main component. The extracting solution is prepared by the following steps of: methanol: water: glacial acetic acid 60 mL: 60mL of: 30mL of: 15mL of the anthocyanin extract is prepared, and the total volume of the anthocyanin extract is 165 mL.

(ii) Extraction of anthocyanins

Weighing about 3.0g of frozen blueberry fruits, freezing by liquid nitrogen, grinding, completely adding into a 50mL centrifuge tube, accurately adding 20mL of prepared anthocyanin extract, carrying out water bath for 4h at 40 ℃, cooling to room temperature, then carrying out 15000Xg, 4 ℃, centrifuging for 20min (Eppendorf5804R) to remove impurities such as cell fragments, carefully absorbing a proper amount of supernatant into a new centrifuge tube by using a pipette gun, adding a prepared buffer solution, and diluting by corresponding times.

(iii) Determining the total content of anthocyanidin by pH differential method

1mL of the prepared sample (supernatant) was added with 4mL of 0.4M sodium acetate (NaAc) buffer solution having a pH of 4.5 or 4mL of 0.025M potassium chloride (KCl) buffer solution having a pH of 1.0, mixed well, allowed to stand at room temperature for 20min, transferred into a cuvette having an optical path length of 1cm, measured for absorbance at 495nm and 700nm using a UV-2102C-type UV-visible spectrophotometer, and double distilled water (ddH) was used ₂ O) zero-setting, repeated 3 times per developmental period.

The concentration of anthocyanidin is calculated as follows:

concentration of anthocyanidin (mg. g) ^-1 )＝A x MW x DF x1000/ε

A ═ a (a495nm, Ph 1.0 to a700nm, Ph 1.0) - (a495nm, Ph 4.5 to a700nm, Ph 4.5) (i.e., the difference between absorbance values at 495nm and 700nm minus the difference between absorbance values at 495nm and 700nm under Ph 1.0 and Ph 4.5), MW is molar mass (433.2g/mol), DF is dilution factor, and ∈isabsorbance coefficient (15600).

The blueberry is mainly calculated by the molar absorption coefficient (15600) of anthocyanin pelargonium-3-glucoside (pelargonidin-3-glucoside). The anthocyanin content (mg) in 1g of the sample was finally expressed.

(2) Measurement results

Experimental data the significance of differences analysis was performed using SPSS. The experiment was set up in triplicate and the data was analysed by taking the average of three replicates (see figure 8 for anthocyanin content control).

The expression of the ACO1 gene is interfered, and the anthocyanin content of the fruit is obviously reduced.

Example 8: measurement of fruit hardness

The blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (the three groups of blueberry fruits are fruits in the same batch) are respectively subjected to fruit hardness measurement.

(1) Measurement method

Measuring hardness of the fruit with GY-4 fruit durometer (GY-4) perpendicular to the surface of the fruit, wherein the hardness is in kg/cm ² 。

(2) Measurement results

Experimental data the significance of differences analysis was performed using SPSS. The experiment was set up in triplicate and the data was analyzed by taking the average of three replicates (see figure 9 for fruit firmness control).

The ACO1 gene expression is interfered, and the hardness of the fruit is obviously improved.

It will be appreciated by those skilled in the art that the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The embodiments disclosed above are therefore to be considered in all respects as illustrative and not restrictive. All changes which come within the scope of or equivalence to the invention are intended to be embraced therein.

Sequence listing

<110> agriculture Co Ltd in Dafeng Yuan Shandong

<120> method, system and application for inhibiting endogenous gene expression of blueberry fruits

<130> C1CNCN210180

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggtgagca agggcgagga g 21

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttacttgtac agctcgtcca tgc 23

<210> 3

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggaggtcc ctgttataga ctttga 26

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaaccgga agactctggt gc 22

<210> 5

<211> 921

<212> DNA

<213> blueberry (Vaccinium spp)

<400> 5

atggaggtcc ctgttataga ctttgataag cttgatggtg agaagagagg tgaaaccatg 60

gcacttctcc accaagcttg tgaaaagggg ggcttctttc agattgagaa ccatggaatt 120

gacacagagt tgatggacaa agtcaagtac ttggtgaatc agcattatga ggagaatatg 180

aaaaaaagct tctacgaatc ggacatagcc aagggattgg aggagaaaag gattacctct 240

gatacagact gggaaagcac cttcttcgtt tggcatcgtc cgaattccaa catcaatgag 300

ctcacaaacc tctcagatga cctccgcatg acgatggatg cgtatatcaa tcaactgatc 360

aagctagcag agaaactgtc ggagctcatg tgcgaaaatc ttggtttaga gaaagattac 420

ataaaggaag cattttcagg aagcaaaggt ccatctgtag gaaccaaagt ggctaaatac 480

ccacaatgtc ctcaccctga acttgttaga gggcttcgtg agcatacgga tgctggtggg 540

atcattctct tactccaaga cgatgaagtc ccaggtcttc aattccataa agatggaaaa 600

tgggtagaaa ttccaccttc taagaataac agcatcttta tcaacacagg tgatcaagtg 660

gaagtggtaa ctaatggaag gtacaagagt actttgcacc gtgtaatcgc agataagaac 720

ggaagcagaa tctctatcgc caccttctac aatcccgctg gagatgctgt catttctcca 780

gctcccaaac tcttataccc caaccacttc cgttttcaag attatctgaa cctttatggt 840

tcaactaagt ttgaagacaa gggtccccga ttcgaatcca tgaagaaaat gccgaacggg 900

caccagagtc ttccggtttg a 921

<210> 6

<211> 306

<212> PRT

<213> blueberry (Vaccinium spp)

<400> 6

Met Glu Val Pro Val Ile Asp Phe Asp Lys Leu Asp Gly Glu Lys Arg

1 5 10 15

Gly Glu Thr Met Ala Leu Leu His Gln Ala Cys Glu Lys Gly Gly Phe

20 25 30

Phe Gln Ile Glu Asn His Gly Ile Asp Thr Glu Leu Met Asp Lys Val

35 40 45

Lys Tyr Leu Val Asn Gln His Tyr Glu Glu Asn Met Lys Lys Ser Phe

50 55 60

Tyr Glu Ser Asp Ile Ala Lys Gly Leu Glu Glu Lys Arg Ile Thr Ser

65 70 75 80

Asp Thr Asp Trp Glu Ser Thr Phe Phe Val Trp His Arg Pro Asn Ser

85 90 95

Asn Ile Asn Glu Leu Thr Asn Leu Ser Asp Asp Leu Arg Met Thr Met

100 105 110

Asp Ala Tyr Ile Asn Gln Leu Ile Lys Leu Ala Glu Lys Leu Ser Glu

115 120 125

Leu Met Cys Glu Asn Leu Gly Leu Glu Lys Asp Tyr Ile Lys Glu Ala

130 135 140

Phe Ser Gly Ser Lys Gly Pro Ser Val Gly Thr Lys Val Ala Lys Tyr

145 150 155 160

Pro Gln Cys Pro His Pro Glu Leu Val Arg Gly Leu Arg Glu His Thr

165 170 175

Asp Ala Gly Gly Ile Ile Leu Leu Leu Gln Asp Asp Glu Val Pro Gly

180 185 190

Leu Gln Phe His Lys Asp Gly Lys Trp Val Glu Ile Pro Pro Ser Lys

195 200 205

Asn Asn Ser Ile Phe Ile Asn Thr Gly Asp Gln Val Glu Val Val Thr

210 215 220

Asn Gly Arg Tyr Lys Ser Thr Leu His Arg Val Ile Ala Asp Lys Asn

225 230 235 240

Gly Ser Arg Ile Ser Ile Ala Thr Phe Tyr Asn Pro Ala Gly Asp Ala

245 250 255

Val Ile Ser Pro Ala Pro Lys Leu Leu Tyr Pro Asn His Phe Arg Phe

260 265 270

Gln Asp Tyr Leu Asn Leu Tyr Gly Ser Thr Lys Phe Glu Asp Lys Gly

275 280 285

Pro Arg Phe Glu Ser Met Lys Lys Met Pro Asn Gly His Gln Ser Leu

290 295 300

Pro Val

305

<210> 7

<211> 384

<212> RNA

<213> blueberry (Vaccinium spp)

<400> 7

auggaggucc cuguuauaga cuuugauaag cuugauggug agaagagagg ugaaaccaug 60

gcacuucucc accaagcuug ugaaaagggg ggcuucuuuc agauugagaa ccauggaauu 120

gacacagagu ugauggacaa agucaaguac uuggugaauc agcauuauga ggagaauaug 180

aaaaaaagcu ucuacgaauc ggacauagcc aagggauugg aggagaaaag gauuaccucu 240

gauacagacu gggaaagcac cuucuucguu uggcaucguc cgaauuccaa caucaaugag 300

cucacaaacc ucucagauga ccuccgcaug acgauggaug cguauaucaa ucaacugauc 360

aagcuagcag agaaacuguc ggag 384

<210> 8

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggggacaagt ttgtacaaaa aagcaggctt catggaggtc cctgttatag a 51

<210> 9

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggggaccact ttgtacaaga aagctgggtc ctccgacagt ttctctgcta gctt 54

<210> 10

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aaaggtccat ctgtagg 17

<210> 11

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtaagagaat gatccca 17

Claims

1. A method for inhibiting the expression of endogenous genes of blueberry fruits, which comprises the following steps:

the depth of the punching is 4-5 mm;

the inner diameter of the punched hole is 1-2 mm;

the number of the holes punched in one blueberry fruit is 3-10;

the distance between different punched holes of a blueberry fruit is 5-15 mm;

s2: immersing the perforated blueberry fruits into agrobacterium infection suspension to obtain a blueberry fruit infection suspension mixture;

the agrobacterium infection liquid comprises the following components: 8-12mM MgCl ₂ 150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, aqueous solution, pH 5.0-6.0;

the RNAi vector target sequence aims at blueberry ACO1 gene; the protein sequence coded by the blueberry ACO1 gene is shown in SEQ ID NO. 6; the coding sequence of the blueberry ACO1 gene is shown in SEQ ID NO. 5; RNAi operation is carried out on the target sequence of the blueberry ACO1 gene as shown in SEQ ID NO. 7;

transforming said T-DNA donor vector and said Ti helper plasmid simultaneously or sequentially into said Agrobacterium tumefaciens host bacterium to form said recombinant Agrobacterium;

transforming said T-DNA donor vector into said Agrobacterium tumefaciens host bacterium containing said Ti helper plasmid to form said recombinant Agrobacterium;

recombining said RNAi vector target sequence into said T-DNA donor vector using the Gateway cloning method;

the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105;

in the T-DNA donor vector, a promoter of the RNAi vector target sequence is an NOS promoter, an MAS promoter or a CaMV 35S promoter;

in the T-DNA donor vector, a terminator of the RNAi vector target sequence is an NOS terminator;

the T-DNA donor vector is a binary expression vector pCAMBIA-1300 or a binary expression vector Gateway ™ 277 vector;

in step S2, the preparation of the agrobacterium infection suspension comprises the steps of:

re-suspending the second precipitate with the agrobacterium infection liquid to obtain the agrobacterium infection suspension;

the conditions for each centrifugation were: centrifuging at 4000-;

the agrobacterium infection solution is used after being activated, and the activating steps are as follows: culturing the recombinant agrobacterium with LB liquid culture medium to bacterial liquid OD ₆₀₀ =0.5-1.0；

S3: putting the blueberry fruit infection suspension mixture into a vacuum environment to obtain vacuum-treated blueberry fruits, wherein the pressure of the vacuum environment is 0.016-0.08MPa, and the treatment time is 5-10 min;

the above-mentionedThe composition of the cleaning solution was: 8-12mM MgCl ₂ 150-;

s4: culturing the vacuum-treated blueberry fruit in a dark environment at 20-28 deg.C; culturing for 1-10 days; the humidity of the culture is 65-80%;

the humidity is maintained in a solution environment of: 8-12mM MgCl ₂ 150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0;

the RNAi expression cassette is transient gene expression;

the blueberry fruit is selected from blueberry fruits in the green period.

2. The method of claim 1, wherein in step S1, the punching is performed using a sterile needle or a sterile rod.

3. The method according to claim 1, wherein the Agrobacterium-infected liquid is used after being sterilized by filtration through a filter of 0.02 μm in size at step S2.

4. The method of claim 1, wherein in step S2, the propagation medium of the recombinant agrobacterium is LB liquid medium containing antibiotics.

5. The method of claim 4, wherein, in step S2, the propagation medium of recombinant Agrobacterium is LB liquid medium containing 30-80mg/l rifampicin and 50-150mg/l kanamycin.

6. The method of claim 4, wherein the recombinant Agrobacterium is proliferated and cultured in step S2 to OD ₆₀₀ =0.5-1.0。

7. The method as claimed in claim 1, wherein the vacuum-treated blueberry fruit is washed clean in step S3.

8. The use as claimed in claim 1, wherein the blueberry variety is selected from JE, duke, jewelry, regex, mist, early blue, blue gold, blue tower, tao rou.