CN1130923A

CN1130923A - Salmonella vaccines

Info

Publication number: CN1130923A
Application number: CN94193330A
Authority: CN
Inventors: 塞缪尔·I·米勒Iii; 约翰·J·梅卡兰诺斯
Original assignee: General Hospital Corp
Current assignee: General Hospital Corp
Priority date: 1993-07-09
Filing date: 1994-07-07
Publication date: 1996-09-11
Also published as: WO1995002048A1; ES2262134T3; DK0717777T3; EP0717777A4; DE69434680D1; ATE321860T1; AU7325994A; AU694948B2; TW493987B; EP0717777A1; US5695983A; CA2166787A1; PT717777E; DE69434680T2; EP0717777B1

Abstract

A bacterial cell the virulence of which is attenuated by a first mutation in a PhoP regulon and a second mutation in an aromatic amino acid synthetic gene and bacterial cells the virulence of which is attenuated by a mutation in one or more PhoP-activated genes or one or more PhoP-repressed genes.

Description

Salmonella vaccines

The present invention relates to vaccine.

The present invention finishes under government supports, is subsidized by the No.AI 30479 and the No.00917 fund of national health research institute (NationalInstitute of Health).Government has right to the present invention.

Enteric fever and diarrhoea are (for example, typhoid fever and cholera) be developing country's high incidence and high mortality disease main diseases because of, referring to people such as Hook, 1980, In Harrison ' sPrinciples of Internal Medicine, 9th Ed., 641-848, McGrawHill, New York.The classical pathway of the vaccine of development directed toward bacteria disease comprises the composition of purifying or the bacterium that kills is carried out non-enteron aisle injection.The vaccine of these parenterai administrations needs more advanced technology to be prepared, and quite expensive, because people are reluctant to carry out the pin injection, thereby often is subjected to patient's resistance.The oral vaccine of living is compared the advantage that several respects are arranged with non-enteron aisle vaccine: cost is low, convenient drug administration, and preparation is simple.

Owing to do not understand fully the pathogenesis of the disease that will tackle, thereby usually limited the development of living vaccine from molecular level.Candidate's live vaccine bacterial strain needs irreversible heredity to be changed, and this hereditary variation should influence this organic toxicity, but does not influence inducing of immunne response.Research based on the toxin mechanism of production toxin gene disappearance, that explain vibrio cholerae makes preparation live vaccine bacterial strain become possibility, referring to people such as Mekalanos, and 1983, Nature 306:551, people such as Levine, 1988, Infect.Immun.56:161.

Nearest research has begun to explain the molecular basis of existence of Salmonella typhimurium scavenger cell and virulence thereof, referring to people such as Miller, and 1989, Proc.Natl.Acad.Sci.USA86:5054 is incorporated herein by reference.The Salmonella typhimurtum bacterial strain that has sudden change in the regulon phoP of positive control is being weakened aspect the virulence of BALB/c mouse significantly.The phoP regulon is by two genomic constitutions that exist in the operon, is called phoP and phoQ.Other two kinds of composition transcriptional regulators of phoP and phoQ gene product and bacterium are quite similar, and they are replied the environment moderate stimulation and control many other expression of gene.The sudden change that takes place at one of the gene that regulated by phoP regulatory region pagC can make virulence be short of.Have pagC, the bacterial strain of phoP or phoQ sudden change can provide the part provide protection to the attack that is subjected to the wild-type salmonella typhi subsequently.

The clinical disease that Salmonellas causes comprises enteric fever and acute gastroenteritis, people such as Hook, and 1980, document is the same.The infection that is caused by Salmonellas in being subjected to immunosuppressant people is more general, people such as Celum, 1987, J.Infect.Dis.156:998.The salmonella typhi that causes typhoid fever only can infected person, referring to people such as Hook, and 1980, document is the same.Because the close limit host specificity of salmonella typhi, thereby the mouse that will infect mouse enteritis salmonella typhi (S.enteriditis typhimurium) is widely used as the laboratory model of typhoid fever, people such as Carter, 1984.J.Exp.Med.139:1189.Salmonella typhimurium infects the host in the relative broad range, can cause human acute gastroenteritis and cause the disease that is similar to typhoid fever in mouse and ox.

Salmonella infection is by the oral acquisition of ingesting.This organism breeds people such as Hornik, 1970, N.Eng.J.Med.283:686 in small intestine after passing stomach.Salmonellas can be invaded the intestinal mucosa cell, and salmonella typhi can propagate into proper mucous membrane and regional nodes by this mucous membrane obstacle and by peyer's patches.The reticuloendothelium cell that has occurred the host after microbemia takes place moves life then.Salmonella typhi can survive and duplicate for its pathological effect mechanism in people's reticuloendothelium system cells is people such as necessary, Hook, 1980, and document is the same, people such as Hornick, 1970, document is the same, and people such as Carter, and 1984, document is the same.

Immunizing power to salmonella typhi comprises body fluid and cell-mediated immunity, people such as Murphy, and 1987, J.Infect.Dis.156:1005, and can obtain this immunity, people such as Edelman, 1986, Rev.Inf.Dis.8:324 by immunization.Recently, the intravital evidence of people after carrying out the intramuscular immunization with partially purified Vi antigen, has the effect of tangible opposing typhoid fever Salmonella infection, people such as Lanata, 1983, Lancet 2:441.Proved that having occurred the T cell in the individuality of having accepted salmonella typhi vaccine alive strengthens with antibody the lethal effect of salmonella typhi, this phenomenon shows that it may be necessary that these antibody produce cell-mediated immune responses for the host, referring to people such as Levine, 1987, J.Clin.Invest.79:888.Cell-mediated immune responses is important for the typhoid fever immunity, because can not induce the killed vaccine of this immunne response that human body is not had protectiveness, and people such as Collins, 1972, Infect.Immun.41:742.

The invention provides and can not cause instantaneous bacteremic salmonella vaccines.Generally speaking, feature of the present invention is a kind of bacterial cell, preferably a kind of salmonella cell, for example, a kind of salmonella typhi, mouse enteritis salmonella typhi or Salmonella choleraesuls cell lower the virulence of this cell by carrying out first sudden change and carry out second sudden change in the phoP regulon in the die aromatischen Aminosaeuren synthetic gene.PhoP regulon as herein described is defined as a kind of DNA that contains a Salmonellas virulence gene expression unit, this ceneme has been characterised in that two regulatory gene, phoP and pohQ, with and express the structure gene regulated by phoP and phoQ, the gene (prg) or the phoP regulatory region activated gene (pag) that suppress of phoP regulatory region for example.A kind of bacterial cell like this can be used as vaccine.Be used for a kind of Mammals of immunization and make it to resist salmonellosis.

Salmonella cell can be any serotype, for example, and Salmonella typhimurium, Salmonella paratyphi A, moscow' paratyphi B, moscow' paratyphi C, S.pylorum, salmonella dublin, the Heidelberg Salmonellas, Newport Salmonellas, salmonella minnesota, salmonella infantis, Wei Erxiao Salmonellas or moscow' panama.

First sudden change can be a non-response null mutation in the phoP/phoQ site.This sudden change is at least 100 nucleotide deletions preferably; More preferably, at least 500 Nucleotide of this sudden change disappearance; Further preferably, this sudden change lacks 750 Nucleotide at least; Most preferably, the 376th to 1322 Nucleotide of this sudden change disappearance phoP/phoQ regulatory site.

Second sudden change can be non-response null mutation in the aroA site, or a non-response null mutation in the aroC/aroD site, or relating to the non-response null mutation in biosynthetic another site of die aromatischen Aminosaeuren.

In order further to reduce the virulence of bacterial cell of the present invention, this cell can also contain another sudden change (for example disappearance) in non-aromatic amino acid synthetic gene, for example, can make cell become auxotroph for non-aromatic amino acid (for example Histidine).In preferred embodiments, bacterial cell of the present invention is to have AroA ^-, His ^-, phoP/phoQ ^-Genotypic Salmonella typhimurium mycetocyte, for example, TyLH445.

The present invention can comprise also that its virulence is in the constitutive expression of the gene under two composition regulation systems controls and the salmonella cell that reduces.In preferred embodiments, this constitutive expression is the result that a kind of composition in two composition regulation systems is undergone mutation.In preferred embodiments, bacterial cell comprises second sudden change can lowering virulence.

In other embodiment preferred of this vaccine, this pair composition regulation system is the phoP regulatory region, and the gene that is under the control of this pair composition regulation system is the gene that the phoP regulatory region is regulated, for example, a kind of prg gene (prgA for example, prgB, prgC, prgE or prgH), or pag gene (for example pagC).In preferred embodiments, constitutive expression is to change in the promotor of regulated gene or in the promotor of phoP regulatory region or the result of suddenly change (for example disappearance (preferably a kind of can not reverse mutation)), the for example sudden change in phoQ or phoP gene, for example phoP ^cSudden change.

On the other hand, the invention is characterized in a kind of vaccine that comprises bacterial cell, the control of this bacterium by phoP regulatory region (for example, a kind of prg gene, as prgA, prgB, prgC, prgE or prgH) reduces the expression of virulent gene and is attenuated.

In the preferred embodiment of this vaccine, this salmonella cell comprises first sudden change (for example, a kind of disappearance) that weakens its virulence, and for example, a sudden change in phoP or the phoQ gene is as phoP ^c, or a sudden change in the gene that the phoP regulatory region is regulated and weaken second sudden change of its virulence, for example, a sudden change in die aromatischen Aminosaeuren synthetic gene (as the aro gene), a sudden change in the gene that the phoP regulatory region is regulated, for example, the prg gene (as, prgA, prgB, prgC, prgE, or prgH) in a sudden change, or the sudden change of pag site (as pagC).

Bacterial cell is included in the phoP regulatory region gene in other preferred embodiment first sudden change, in die aromatischen Aminosaeuren synthetic gene (for example aro gene) second sudden change is arranged.

On the other hand, the present invention is characterised in that a kind of vaccine, preferably a kind of live vaccine that comprises bacterial cell, and the virulence of this bacterium is weakened owing in the gene under being subjected to two composition regulation system controls sudden change (for example a kind of disappearance) having taken place.In preferred embodiments, this bacterial cell is included in the sudden change that its virulence has taken place to weaken in second gene (for example die aromatischen Aminosaeuren synthetic gene, as the aro gene).

In other preferred embodiments of this vaccine, this bacterial cell is a salmonella cell, and this pair composition regulation system is the phoP regulatory region, and the gene that is subjected to its control is the prg gene, prgA for example, prgB, prgC, prgE or prgH or pag gene be the pagC gene for example.

On the other hand, the present invention is characterised in that and comprises salmonella cell (salmonella typhi for example, mouse typhus Salmonella enteritidis or Salmonella choleraesuls cell) a kind of vaccine, preferably a kind of live vaccine, cell wherein has first sudden change that weakens virulence in its die aromatischen Aminosaeuren biosynthesis gene (for example aro gene), and second sudden change that weakens virulence (phoP is for example arranged in phoP regulatory region gene ^-Sudden change).

On the other hand, the present invention is characterised in that a kind of bacterial cell, or the preparation of purifying basically of this cell, preferably a kind of salmonella cell, salmonella typhi for example, mouse typhus Salmonella enteritidis or Salmonella choleraesuls cell, a kind of gene that is subjected to two composition regulation systems controls is expressed on this groups of cells moulding ground, this gene comprises a kind of sudden change (for example a kind of disappearance) that weakens virulence, and this sudden change can not cause being subjected to a kind of gene of two composition regulation system controls to carry out constitutive expression.In preferred scheme, this bacterial cell is included in a kind of composition of two composition regulation systems sudden change has taken place.

In preferred scheme, this bacterial cell is a salmonella cell, this cell constitutive expression is a kind of to be subjected to the gene that the phoP regulatory region regulates (this constitutive expression is preferably by a kind of sudden change in the phoP regulatory region (preferably a kind of can not reverse mutation as disappearance), for example a kind of sudden change phoPc for example in phoQ or phoP gene causes).And this cell comprises a kind of sudden change of lowering virulence, preferably a kind of can not reverse mutation (for example a kind of disappearance), this sudden change is preferably at the die aromatischen Aminosaeuren synthetic gene for example in the aro gene, perhaps at the gene that regulated by the phoP regulatory region, for example the prg gene (as prgA, prgB, prgC, prgE or prgH), perhaps in the pag gene (for example pagC), this sudden change can not cause being subjected to the gene of phoP regulatory region control to carry out constitutive expression.

On the other hand, the present invention is characterised in that a kind of bacterial cell or its preparation of purifying basically, for example a kind of salmonella cell, Salmonella typhimurium mycetocyte for example, with mouse enteritis salmonella typhi or Salmonella choleraesuls cell, this cell has the sudden change of lowering its virulence in the gene that regulated by two composition regulation systems.In preferred embodiments, the sudden change of this attenuating virulence is at the gene that regulated by the phoP regulatory region, prg gene (as prgA, prgB, prgC, prgE or prgH) for example, or in the pag gene (for example pagC).

In preferred embodiments, this bacterial cell is included in die aromatischen Aminosaeuren synthetic gene (as the aro gene), perhaps at phoP regulatory region gene (as phoP or phoQ gene), perhaps at the gene that regulated by the phoP regulatory region such as prg gene (as prgA, prgB, prgC, prgE or prgH) or pag gene (as pagC) in second sudden change arranged, virulence is lowered in this sudden change but the gene that do not cause being subjected to the phoP regulatory region to be regulated carries out constitutive expression.

Feature of the present invention also is a kind of salmonella cell of work, perhaps its preparation of purifying basically, for example a kind of salmonella typhi, mouse enteritis salmonella typhi or Salmonella choleraesuls cell, gene or its regulatory factor of a coding heterologous protein in the virulence gene of cell, have been inserted, described virulence gene for example is to be arranged in the gene of phoP regulatory region or the gene that a kind of phoP of being subjected to regulatory region is regulated, for example the prg gene is (as prgA, prgB, prgC, prgE, or prgH) or pag site (as pagC).

In preferred embodiments, the salmonella cell of living has carried second sudden change of lowering virulence, and for example a kind of aro sudden change is as the aroA sudden change, as aroA ^-Perhaps aroADEL407.

In preferred embodiments, the DNA of coding heterologous protein is in a kind of being subjected under the promotor control that environment regulates.In other preferred schemes, the salmonella cell of living comprises that further dna sequence dna and a T7 of being in the coding T7 polysaccharase under the promotor control that is subjected to the environment adjusting transcribe the susceptibility promotor, and this T7 transcribes the expression of susceptibility promotor control heterologous antigen.

Feature of the present invention also is a kind of carrier that can be incorporated in the Salmonellas karyomit(e), and this carrier comprises: first dna sequence dna of coding heterologous protein; For example second dna sequence dna of selected marker (can choose wantonly) of a kind of marker of encoding for example provides the gene of heavy metal tool resistance or the auxotrophic mutation complementary gene that carries with bacterial strain to be transformed; And the third dna sequence dna, for example a kind of gene of phoP regulon coding, as prg gene such as prgA, prgB, prgC, prgE or prgH or pag site such as pagC, the gene product that this sequence encoding is regulated by the phoP regulatory region, be that the tool virulence is necessary, sudden change owing to taken place and inactivation in the 3rd dna sequence dna.

In other preferred versions: first dna sequence dna is placed in this carrier, is in order to make the 3rd dna sequence dna sudden change inactivation; This carrier can not duplicate in the wild type salmonella bacterial strain; Heterologous protein is under the promotor control of environment adjusting; And this carrier comprises that further the dna sequence dna and the T7 that are in the coding T7 polysaccharase under the promotor control that is subjected to the environment adjusting transcribe the susceptibility promotor, and this T7 transcribes the expression of susceptibility promotor control heterologous antigen.

On the other hand, the present invention includes to a kind of animal such as a kind of Mammals as people's immunization, make it to resist by the bacterium method of salmonellal disease for example, this method comprises uses vaccine of the present invention.

The present invention also comprises a kind of carrier that contains the DNA of coding pagC gene product; A kind of by this carrier cell transformed; A kind of method for preparing the pagC gene product, this method comprise cultivates this transformant and purifying pagC gene product from cell or substratum; And the present invention also comprises a kind of pagC gene product preparation of purifying.

On the other hand, the present invention includes the method that Salmonellas exists in the sample that detects, this method comprises this sample is contacted with the pagC coding DNA, and detects the hybridization of this pagC coding DNA and sample amplifying nucleic acid.

The present invention also comprises a kind of carrier that contains the DNA of coding prgH gene product; This carrier cell transformed of a kind of usefulness; A kind of method of producing the prgH gene product, this method comprises the cultivation transformant, and from cell or substratum purifying prgH gene product; And the purifying preparation of prgH gene product.

On the other hand, the present invention includes the method that detects the Salmonellas that exists in the sample, this method comprises this sample is contacted with the prgH coding DNA, and the hybridization of detection prgH coding DNA and sample amplifying nucleic acid.

On the other hand, the present invention is characterised in that the method that bacterial virulence is lowered, and this bacterium contains two composition regulation systems, and described method comprises makes the gene that is in two one-tenth sub-systems carry out constitutive expression.In preferred embodiments, this bacterium is a Salmonellas, for example, salmonella typhi, mouse enteritis salmonella typhi, or Salmonella choleraesuls, and this pair one-tenth sub-system is the phoP regulatory region.

On the other hand, the present invention is characterised in that the DNA of purifying basically, and this DNA contains sequence or its fragment that provides among the SEQ ID NO:5.

The present invention also comprises a kind of DNA of purifying basically, this DNA contains the sequence of the pagD that encodes, for example the 91-354 position Nucleotide of SEQ ID NO:5 (pagD open reading frame (ORF)) and degeneracy varient thereof, a kind of product that has the aminoacid sequence that provides among the SEQ ID NO:6 basically of these degeneracy varient codings, also comprise pagD ORF with and 5 ' non-coding region (the 4-814 position Nucleotide of SEQ ID NO:15), this non-coding region contains the pagD promotor.Be positioned at the DNA in the zone between pagC ORF and the pagD ORF (the 4-814 position Nucleotide of SEQ ID NO:15), comprise the DNA of pagC promotor (Nucleotide of the 562-814 position of SEQ ID NO:15), and the DNA that only comprises pagD promotor (the 4-776 position Nucleotide of SEQ ID NO:15) is also in the scope that the present invention requires.

The present invention also comprises purifying basically, comprises the DNA of the sequence of a kind of envE of coding, for example 1114-1650 position Nucleotide (envE ORF) and the degeneracy varient thereof of SEQ ID NO:5, the product of their codings has the aminoacid sequence that provides among the SEQ ID NO:7 basically.

Another aspect of the present invention is characterised in that a kind of DNA of purifying basically, this DNA comprises the sequence of the msgA that encodes, for example 1825-2064 position Nucleotide (msgAORF) and the degeneracy varient thereof of SEQ ID NO:5, their a kind of products that has the aminoacid sequence that provides among the SEQ ID NO:8 basically of encoding, and the msgA ORF that has its 5 ' non-coding region, this non-coding region is the 1510-1824 position Nucleotide that contains the SEQ ID NO:5 of msgA promotor.Only contain msgA promotor (the 1510-1760 position Nucleotide of SEQ ID NO:5) purifying basically DNA also within the scope of the present invention.

On the other hand, the present invention is characterised in that a kind of DNA of purifying basically, this DNA comprises the sequence of the envF that encodes, 2554-3294 position Nucleotide (envF ORF) and the degeneracy varient thereof among the SEQ ID NO:5 for example, the product of this degeneracy varient coding has the aminoacid sequence that provides among the SEQ ID NO:9 basically, and the envFORF that has its 5 ' non-coding region, this non-coding region is the 2304-2553 position Nucleotide that contains the SEQ ID NO:5 of envF promotor.

The DNA that comprises the sequence that provides among the SEQ ID NO:10 or its segmental purifying basically also within the scope of the present invention.

The present invention also comprises the DNA of purifying basically, this DNA comprises the sequence of the prgH that encodes, for example the 688-1866 position Nucleotide (prgH ORF) of SEQ ID NO:10 with and the degeneracy varient, the product of this degeneracy varient coding has the aminoacid sequence that provides among the SEQ ID NO:11 basically, and the prgH ORF that has its promoter region (the 1-689 position Nucleotide of SEQ ID NO:10).

The present invention also comprises the DNA of purifying basically, this DNA comprises coding prgI sequence, for example 1891-2133 position Nucleotide (prgI ORF) and the degeneracy varient thereof of SEQ ID NO:10, the product of this degeneracy varient coding has the aminoacid sequence that provides among the SEQ ID NO:12 basically, and the prgI ORF that has its promoter region (the 1-689 position Nucleotide of SEQ ID NO:10).

On the other hand, the present invention is characterised in that the DNA of purifying basically, this DNA comprises the sequence of the prgJ that encodes, for example, the 2152-2457 position Nucleotide (prgJ ORF) of SEQ ID NO:10 with and the degeneracy varient, the product of this degeneracy varient coding has the aminoacid sequence that provides among the SEQ ID NO:13 in fact, and prgJ ORF and its promoter region (the 1-689 position Nucleotide of SEQ ID NO:10).

On the other hand, the present invention is characterised in that the DNA of purifying basically, this DNA comprises coding prgK sequence, for example the 2456-3212 position Nucleotide (prgKORF) of SEQ ID NO:10 with and the degeneracy varient, the product of this degeneracy varient coding has the aminoacid sequence that provides among the SEQID NO:14 in fact, and the prgK ORF that has its promoter region (SEQ ID NO:10 1-689 position Nucleotide).

The present invention also comprises a kind of bacterial cell, group under being selected from of this cell: pagD, pagE, pagF, pagG, pagH, pagI, pagJ, pagK, pagL, pagM, pagN, sudden change (for example disappearance) has taken place and has lowered the virulence of cell in pagP in one or more genes of envE and envF.The present invention also comprises a kind of bacterial cell.Group: pagC under being selected from of this cell, pagD, pagJ, a sudden change (for example lacking) takes place and has lowered the virulence of this cell in pagK in one or more genes of pagM and msgA.A kind of bacterial cell, at the prgH that is selected from of this cell, a kind of sudden change (for example disappearance) has taken place and has lowered its virulence in prgI, one or more genes of prgJ and prgK, also within the scope of the present invention.

Used herein pair of composition regulation system is meant a kind of bacterium regulation system, this systems response ambient signal, the expression of control multiple proteins.The two compositions that relate in the term are a kind of susceptors, and it can perceive for example a kind of environmental parameter, and reply this parameter, by for example impelling second kind of composition, promptly activate the phosphorylation of son and promote activation.This activation influence is in the expression of gene under the control of two one-tenth sub-system.Two one-tenth sub-systems can comprise the regulon of replying of for example a kind of Protein histidine kinase and a kind of phosphorylation, as seeing in Gram-positive and gram negative bacterium.Intestinal bacteria, for example identified that 10 kinases and 11 reply regulon.They control chemotaxis, and nitrogen is regulated, and phosphoric acid is regulated, osmoregulation, and sporulation, and many other cell functions, referring to people such as Stock, 1989 Microbiol.Rev.53:450-490 are incorporated herein by reference.A kind of two one-tenth sub-system is also controlled the neoplastic virulence of Agrobacterium tumefaciens plant, people such as Leroux, and EMBO J 6:849-856 is incorporated herein for referencial use.Similarly the virulence regulon relates to the virulence of Whooping cough bordetella, people such as Arico, 1989, Proc.Natl.Acad.Sci.USA 86:6671-6675, be incorporated herein for referencial use, and the virulence that relates to shigella flexneri, referring to people such as Bernardini, 1990, J.Bact.172:6274-6281 is incorporated herein for referencial use.

" regulated by environment " used herein is meant a kind of phraseology, and wherein a kind of expression of gene depends on the level of some characteristic in the environment of cells survival or composition in the cell.Example is included in the promotor in the biosynthetic pathway, it is opened or closes according to the level of a kind of specific component or several specific components, for example, iron, temperature responsive promoter, or in the specific cells interval expression promoter more enthusiastically in scavenger cell or vacuole for example.

Vaccine used herein (vaccine) is a kind of preparation that comprises the material that can excite required biological response (for example a kind of immunne response) that combines with suitable carrier.This vaccine can contain bacterium alive, and this vaccine orally uses usually; Perhaps contain the bacterium that kills or or its composition, this vaccine is that non-enteron aisle is used usually.The cell that uses in the vaccine of the present invention is preferably lived, thereby can move and grow in by the intestines of inoculation animal.

Sudden change used herein is meant any variation (parental strain suitable with it relatively) in a kind of organic dna sequence dna.These sudden changes can perhaps be adopted chemical means by for example spontaneous generation, use for example X-ray of energy, or other forms induce generation, or adopt the genetic engineering means, or the result of mating or the exchange of other form genetic information.Sudden change comprises for example base exchange, and disappearance is inserted, and is inverted transposition or repetition.

If the sudden change result makes the virulence level of mutant cell compare reduction with the level of its parental strain cell, virulence has been lowered in then this sudden change, can measure the virulence of a) comparing mutant strain by following situation and significantly reduce (for example reducing by 50% at least) with parental strain, perhaps b) compare with parental strain, the amount that is confirmed as the polypeptide of virulence factor in the mutant strain significantly reduces (for example at least 50%).

Said herein non-response sudden change be meant a kind of can not regressive sudden change by the variation of single base pair, for example disappearance or insert sudden change, and the sudden change that refers to contain damage more than for example contains the sudden change of two independent point mutation.

PhoP regulatory region used herein is meant a kind of pair of composition regulation system, control pag of this system and prg expression of gene.PhoP site and phoQ site are contained in this zone.

The gene that the phoP of being subjected to regulatory region used herein is regulated is meant such as pag and the such gene of prg.

Pag used herein is meant and is subjected to the up-regulated a kind of gene of phoP regulatory region.

Prg used herein is meant and is subjected to the negative a kind of gene regulated of phoP regulatory region.

Die aromatischen Aminosaeuren synthetic gene used herein is meant a kind of gene, a step during the enzyme energy catalyze aromatic amino acid of this genes encoding is synthetic.AroA, aroC, and aroD is the example of this gene in the Salmonellas.Undergo mutation in these genes and can lower virulence and can the total loss immunogenicity.

Undesired expression used herein is meant the expression that is higher or lower than wild-type.

Heterologous protein used herein is meant a kind ofly can not express in wild-type or carry out expressed protein from different chromosomal focis, for example, is a kind of heterologous protein by the protein that inserts a genes encoding in second kind of gene.

Virulence gene used herein is a kind of gene, and its inactivation causes the virulence of salmonella cell to be lower than this gene not by the similar salmonella cell of inactivation.Such example comprises phoP, pagC, prgH gene.

The marker of Shi Yonging is meant gene product in this article, and the existence of this mark is very easy to be determined, and the gene product that allows or suppress to grow to the gene product of heavy metal tool resistance or under given condition for example is provided.

Purifying preparation used herein is meant a kind of (for example protein) preparation.It is from protein, and purifying comes out in lipid and other materials that combine with it.Purifying 2-10 times at least in preferred preparation.

Constitutive expression used herein is meant with the expression of homologous genes in the appropriate control bacterial strain (for example parent or wild type strain) and compares that degree modulated or that regulate is lower.For example, if a kind of gene under the first cover condition checked usually and under the second cover condition this expression of gene disappeared and checked, constitutive expression is the expression of carrying out with same level, is for example checking level, carry out on the level that checks or the by-level of disappearing, and no matter condition how.The part constitutive expression is contained in the defined constitutive expression, and when with appropriate control bacterial strain (for example a kind of wild-type or parent strain) when comparing, the difference between two kinds of expression levels reduces and the part constitutive expression just occurred.

A kind of bacterial cell preparation of purifying basically is a kind of cell preparation, does not wherein have the composition of the contamination of cells of required mutator gene type to be lower than 10% of total cellular score in the said preparation, preferably is lower than 1% and more preferably be lower than 0.1%.

The present invention weakens bacterial virulence and makes vaccine (especially making the vaccine that the contains bacterium alive) virulence attenuation of that contains bacterium by undergoing mutation in two composition regulation systems and/or at the gene that regulated by these systems.Vaccine virulence of the present invention is weakened widely but has been kept immunogenicity, thereby they are both safe and effective.Use carrier of the present invention to make up apace to contain the bacterial strain of the DNA of coding heterologous protein (for example antigen).The DNA of coding heterologous protein is integrated on the karyomit(e), thereby is stable.Different with pUC pUC, pUC pUC is to depend on antibiotics resistance or other selective pressure conditions keep its stability.Salmonellas viable cell of the present invention, wherein the expression of heterologous protein is that the promotor that replied by an environment is controlled, when not needing such expression, for example between incubation period, vaccine preparation or expressing heterologous protein not when storing, this helps the survival of cell.But when using to the human or animal, the heterologous protein that this cell expressing is a large amount of.This specific character is necessary, because the high expression level of many heterologous proteins is relevant with toxicity to this bacterium in Salmonellas.Only using single copy DNA that integrates of the heterologous protein of encoding also is owing to express to minimum degree the needs of heterologous protein when not needing to express.In embodiments, when virulence gene (for example pagC gene or prgH gene) contained the integration site of DNA of the heterologous protein of encoding, then the virulence of this bacterium was lowered greatly.

The DNA of purifying basically used herein is meant a kind of nucleotide sequence, fragment or section, it be under standard state with the adjoining sequence of this fragment purifying come out.For example in naturally occurring genome from the adjacent sequence of this fragment the excision under DNA.This term also is applicable to such DNA, and it is to follow under native state that purifying comes out other compositions of this DNA basically, for example the DNA that purifying comes out in the natural protein of following from cell.

During requiring, preferred embodiment that other features and advantages of the present invention will be described below and Accessory Right illustrated.

Accompanying drawing is described

Fig. 1: the survival of graphic representation Salmonellas bacterial strain in scavenger cell.

Fig. 2: the restriction endonuclease site collection of illustrative plates in pagC site.

Fig. 3: the dna sequence chromatogram in pagC district (SEQ ID NO:1).

Fig. 4: the localized collection of illustrative plates of prgH in the hil site.Arrow represents to be inserted into the orientation of the Tn5B50 Xin Meisu promotor in the hil site and the direction that prgH1 ∷ TnphoA fusion rotein is transcribed.The restriction endonuclease site is by B, BamHI; H, HindIII; X, XhoI; S, SacI; V, EcoRV represents.

Fig. 5: be a dna sequence dna (pIB01 plasmid) (SEQ ID NO:3) from the prgH gene.

Fig. 6: expression is with wild-type (ATCC 14028), and phoP-null mutant (CSO15) and pag ∷ TnphoA mutant strain are to the column diagram of the susceptibility comparative result of NP-1 defence.Y-axis is represented the defensin mortality-product, and (Defensin Killing Index, DKI), this DKI value representation contacts with NP-1 and the measure unit of the bacterium that kills.The definition of DKI is the contrast bacterium and logarithmic function [DKI=log (CFU the when CFU/ when not having NP-1 has NP-1) with the ratio of the bacterium that survives behind the NP-1 incubation.Each bar line is represented 5 mean value and the standard errors of experiment separately.X-axis is represented the allelotrope that suddenlyd change.For each the pag ∷ TnphoA bacterial strain that is detected, the average DKI value that measures does not have different with wild type salmonella.(P＜0.05)。In contrast, phoP mutant significantly different (P＜0.0001).

Fig. 7: the part physical map in the restriction endonuclease site of expression pagC chromosomal region.Marked for pagD on each gene, envE has inserted the mouse 50% lethal dose (LD of the bacterial strain of transposon among msgA and the pagC ₅₀).Horizontal arrow indicates transcriptional orientation.Vertical arrows represents that the trilateral of TnphoA insert division and hollow represents the MudJ insert division.The below of map is that the DNA in the pCAA9 plasmid is inserted in representative, this DNA inset TnphoA and MudJ mutagenesis.The implication of letter: A, AccI; C, ClaI; E, EcoRI; H, HpaI; P, PstI; And V, EcoRV.

Fig. 8 is the dna sequence dna in zone of pagC upstream and the dna sequence dna of each ORF of translating.HpaI and the ClaI site at initial and end that should the zone have been indicated among the figure.Draw bottom line arranged be the Shine-Delgarno district, on sequence with beneath expression stem-ring structure (potential does not rely on the terminator of Rho) that a line is all arranged.Arrow is represented is the position of the representational transposon that inserts in each gene.In pagD and msgA promoter region level to arrow indicate transcription initiation site, and asterisk is indicated-10 to-35 sequence.What comprise in bracket is total lipid adsorption site among the EnvF.PagD ORF starts from the 91st Nucleotide and ends at the 354th Nucleotide in SEQ ID NO:5; And envE ORF originates in the 1114th Nucleotide in SEQ IDNO:5, ends at the 1650th Nucleotide; MsgA ORF originates in the 1825th Nucleotide of SEQ ID NO:5, ends at the 2064th Nucleotide; EnvF ORF originates in the 2554th Nucleotide of SEQ ID NO:5 and ends at the 3294th Nucleotide.

Fig. 9: include prgH, prgI, the dna sequence dna of prgJ and prgK gene.Beneath line place is the initiator codon (ATG) of each gene, and asterisk indicates terminator codon.PrgH ORF originates in the 688th Nucleotide and finishes in the 1866th Nucleotide place in SEQID NO:10; PrgI ORF originates in the 1891st Nucleotide of SEQ ID NO:10 and ends at the 2133rd Nucleotide; PrgI ORF originates in the 2152nd Nucleotide of SEQ ID NO:10, ends at the 2457th Nucleotide; PrgK ORF originates in the 2454th Nucleotide of SEQ ID NO:10, finishes in the 3212nd Nucleotide place.

Figure 10 shows parental generation salmonella strain (AroA-) and vaccine bacterial strain (AroA-, the graphic representation of growth velocity phoP-).

Figure 11 is the histogram that shows the defensin susceptibility of mouse vaccine bacterial strain (Salmonella typhimurium).

Figure 12 shows with pagB:LacZ to write down the phoP activated histogram that constructs body measurement LacZ activity and measure.

Figure 13 is salmonella typhi vaccine bacterial strain TyLH445 and AroA ^-The histogram of the defensin susceptibility that parental strain is compared.

Figure 14 A is the relative expression's situation that shows that the constitutive expression (610 and 617) of AP fusion rotein and (pagC and pagD) that phoP regulates express.

Figure 14 B: be immunne response situation to lipopolysaccharides (LPS).

Figure 14 C: show immunne response situation to heterologous antigen model AP.

Figure 15: be the dna sequence dna that contains the pagC-pagD intergenic region.Beneath line place is pagC rotaring intertranslating start site (being positioned at the ATG on the relative DNA chain) (the 1-3 position Nucleotide of SEQ ID NO:15).Represent pagC transcription initiation place (the 562nd Nucleotide) with the arrow that points to left.PagD transcription initiation (ATG) locates that beneath line is also arranged in (the 815-817 position Nucleotide of SEQ ID NO:15).Represent pagD transcription initiation place (the 776th Nucleotide) with the arrow that points to the right.

According to the regulation of the microbial preservation budapest treaty that is used for patented procedure of international recognition, following biological substance has been preserved in American type culture collection (ATCC), and this is centered close to the Rockville of Maryland, USA.

Applicant's transferee, Massachusetts general hospital polyclinic think that ATCC is a preservation mechanism that can carry out permanent preservation, and if patent go through, the public can obtain these bacterial classifications.In case license obtains restricted can being cancelled of the material of these preservations like this to the public.In patent application course of the review; The decision of the council that anyone can authorize according to 37 CFR 1.14 and 35 U.S.C. § 122 obtains this material.After the nearest request of the plasmid sample that requires to provide this preservation at least 5 years, the material of carefully keeping this preservation is made it to keep survival and not contaminated, and under any circumstance, but after preserving day between the effective date of at least three ten years or this patent (during long, being as the criterion), keep this material to survive and not contaminated.Applicant's transferee admits that the transferee has a responsibility for replacing this preservation thing when the problem preservation mechanism owing to preservation condition can not provide this sample for the requesting party.

PhoPc bacterial strain CS022 (hereinafter will describe) be deposited at American type culture collection (Rockville, MD) and the ATCC preserving number that is given be 55130.

The pIB01 plasmid that contains the prgH gene is preserved in American type culture collection on July 9th, 1993, and (Rockville, MD), and the ATCC preserving number that is given is 75496.

The constitutive expression of phoP regulon has lowered virulence of Salmonellas and the viability in scavenger cell

PhoP composing type allelotrope (phoPc), pho-24 causes disappearing of pag site to be checked.With the diethyl sulfide hydrochlorate to Salmonella typhimurium LT-2, TA2367 pho-24 bacterial strain (all bacterial strains that in this section, relate to that Ames and co-worker are separated to, material and method will be described below) carry out mutagenesis, make bacterial strain contain a phoP site mutation, cause in rich medium acid phosphatase to carry out composing type and produce people such as Kier, 1979, J.Bacteriol.138:155 is incorporated herein for referencial use.The acid phosphatase that this phoP regulates is encoded by phoN gene (a pag site), people such as Kier, and 1979, document is the same, people such as Miller, 1989, document is the same.In order to analyze the expression whether this pho-24 allelotrope can improve other pag sites, determine the influence that pho-24 allelotrope is expressed other pag sites, pho-24 allelotrope to the influence in other pag site recently with needing transcribing (for example pagA and pagB) and translating (for example pagC) Expression of Fusion Protein and represent of phoP and phoQ, referring to people such as Miller, 1989, document is the same.Making up pag gene fusion bacterial strain, is isogenic except that pho-24 allelotrope, and the activity of analysis fusioning protein.The phoP of pagA ∷ MudJ and pagB ∷ Mu dJ bacterial strain in rich medium ^cDerivative produces the beta galactose thuja acid of 480U and 490U respectively, improves 9-10 doubly than the value of the fusant bacterial strain that has wild-type phoP site, referring to table 1.

PagC ∷ TnphoA gene fusion produces the AP of 350U, improves 3-4 doubly than the amount that produces in the CS119 bacterial strain, is isogenic except that the pho-24 sudden change in this syzygy, referring to people such as Miller, and 1989, document is the same.These results are equivalent to that activity of acid phosphatase improves 9 times in importing the allelic CS022 bacterial strain of pho-24.Therefore, these analytical resultss for pag genetic expression prove that the sudden change of pho-24 mutant causes the constitutive expression of pag site rather than phoN.

Table 1: bacterial isolates and characteristic strain gene type enzymic activity (U) ^aThe reference or 10428 wild-type 180 (A) ATcc that originate;

Miller?et

al.，1989，

TA2367 pho-24 1,925 (A) Kier et sees above

al.，1974，

CS003 Δ phoP Δ purB＜10 (A) Miller et sees above

al.，1989，

CS022 pho-24 1,750 (A) CS023 pho-24 of the present invention phoN2 25 (A) the present invention sees above

ZXX∷6251Tn10d-CamCS012 pagA1∷MU?dJ 45(B) Miller?et

al.，1989，

CS013 pagB1 ∷ MU dJ 120 (B) Miller et sees above

al.，1989，

CS119 pagC1 ∷ TnohoA phoN2 85 (C) Miller et sees above

al.，1989，

See above

Zxx ∷ 6251Tn10d-Camsc024 pagA1 ∷ Mu dJ pho-24 450 (B) sc025 pagB1 of the present invention ∷ Mu dJ pho-24 980 (B) sc026 pagC1 of the present invention ∷ TnphoApho-24phoN2 385 (B) the present invention

zxx∷6251Tn10d-CamCS015 phoP102∷Tn10d-Cam

＜10(A) Miller?et

al.，1989，

TT13208 phoP105 ∷ Tn10d＜10 (A)--b see above ^aA. acid phosphatase; B. beta-galactosidase enzymes; C. alkaline phosphatase (AP). ^bGive by Ning Zhu and John Roth

At phoP ^cThe evaluation of the kinds of protein that is checked in the mutant strain and be activated

Analyze the whole-cell protein matter of CS022 bacterial strain, be subjected to the number of the kinds of protein of phoP regulon adjusting with estimation potentially.Obviously, adopt unidirectional polyacrylamide gel electrophoresis analysis by phoP ^cThe proteinic result that the phenotype bacterial strain produces shows that the expression of some kinds of protein reduces, and many pag gene products of being inferred are induced fully by the pho-24 sudden change.At phoP ^cThe protein that reduces in the bacterial strain may be represented the gene product that checked by the phoP regulon.For the gene that checked by phoP, the proteinic gene that is reduced by pho-24 allelotrope of promptly encoding is named as the prg site.With wild-type, phoP-and phoP ^cThe protein of mutant strain compares, and the result shows that the condition of pag gene product is checked in the growth conditions representative in 37 ℃ of LB substratum, but is to disappear to check condition for the prg gene product.

In order to estimate the sum of the gene product that is subjected to the phoP adjusting potentially, the wild-type and the phoP that adopt the two dimensional gel electrophoresis methods analyst on LB, to grow ^cThe total cell protein matter of saltant.Have at least 40 kinds proteic be expressed in to reply in the pho-24 sudden change experienced huge fluctuation.

PhoP ^cThe virulence deletion of bacterial strain

It should be noted that of the virulence quilt obviously reduction (table 2) of the bacterial strain of single pho-24 sudden change for mouse.Adopt peritonaeum (i.p.) approach attack method to kill 50% BALB/C mouse (LD ₅₀) phoP that needs ^cThe number (2 * 10 of bacterium ⁵) approach to use phoP ^-The required number (6 * 10 of bacterium ⁵), people such as Miller, 1989, document is the same.On abundant and minimum medium, phoP ^cThe growing state of bacterial strain is equivalent to the growth of wild-type bacterium.Also detected phoP ^cThe change situation of lipopolysaccharides in the mutant, the soluble viewed virulence deletion of this change.According to polyacrylamide gel electrophoresis and dyeing process measurement result, the CS022 bacterial strain has normal susceptibility to phage P22, and at the antigenic antibody of O normal B order reaction taking place, and its lipopolysaccharides distribution situation is same as the distribution of parental strain.

Table 2

PhoP ^cAnd phoP ^-The toxicity of Salmonellas bacterial strain and the initial survival of protection efficient dosage of inoculation are attacked back survival number/sum with the wild-type of following dosage

Number/sum

5 * 10 ⁷5 * 10 ⁵5 * 10 ⁴5 * 10 ³PhoP ^cBacterium 15 13,/13 5/5 4/5 50 4/4 4/4 1.5 * 10 ²11,/11 4/4 3/3 5 * 10 ²16/16/4 1.5 * 10 ³5/5 3/3 2/2 5 * 10 ³4/4 4/4 1.5 * 10 ⁴5/5 3/3 2/2 5 * 10 ⁴19,/23 4/4 1.5 * 10 ⁵5/5 3/3 2/2 5 * 10 ⁵1/4 1/1 5 * 10 ⁶0/6 3 * 10 ⁹(*) 5/5 5/5 3 * 10 ¹⁰(*) 5/5 5/5 1.5 * 10 ¹¹(*) 5/5 5/5PhoP ^-Bacterium 6 * 10 ³36,/36 0,/12 0,/12 0,/12 6 * 10 ⁴36,/36 0,/12 0,/12 3,/12 6 * 10 ⁵19,/36 0/6 0/6 4/7 5 * 10 ¹⁰(*) 7/7 3/7 ^(*)Orally administered bacterium.In every other experiment, use microorganism by the i.p. attack.

Because available chemomorphosis method makes up TA2367 pho-24 bacterial strain, and have another linked sudden change and make its toxicity disappearance, thereby isolate phoP ^cRevertant measure pho-24 allelotrope and whether viewed virulence attenuation of worked.In the bacterium that from liver, is recovered to, separate with the mouse of CS022 strain infection can be according to rich medium in the phenotype phoP that identifies of acid phosphatase normal level ^cRevertant.Six independent phenotype revertants finding called after CS122-CS128 are complete toxicity to be arranged (for its LD of BALB/c mouse ₅₀Be lower than 20 bacteriums).By with phage P22 cotransduction, all six detected toxic revertants are made the collection of illustrative plates in its site that revert phenotype is worked, find to have the feature chain (with purB chain) greater than 90% with the phoP site.These data show that these revert mutant are not extragenic inhibitions, but intragenic inhibition, or the real revertant of pho-24 sudden change.Therefore, phoP ^cThe virulence deletion of mutant may be that but single reverse mutation causes in the phoP site, rather than resulting second uncorrelated sudden change causes during mutagenesis.

PhoP ^cThe regressive frequency of phenotype

The reply frequency of investigation phoP sudden change in the mouse body is to assess the LD whether reverse mutation has reduced this bacterial strain ₅₀By peritoneal injection, use 10 in eight animals each ⁶, 10 ¹, 10 ²Whether individual attack bacteria exists revertant to detect the CS022 bacterial strain.At the 7th day, accepted 10 ⁶Individual phoP ^cThree animal deads of bacterium.In that day, collect liver and the spleen of all animals, and in salt solution homogeneity.Through after the suitable dilution, 10% of this tissue placed on the LB flat board that contains the phosphatase substrate XP that adds lustre to cultivate.With phoP ^cBacterium is compared, and the bacterium colony of revertant is lighter blueness, and adopts quantitative acid phosphatase detection method to verify.From the animal of three different challenge doses, be recovered to about 10 respectively from each organ ⁷, 10 ⁵With 10 ³Individual microorganism.Only when maximum dose level, identify revertant, and each organ contains 0.5-1% or 10 when death ⁵Individual this bacterium.It seems that as if revertant can contain more effectively competitive growth in the organ of scavenger cell at these because in scavenger cell CS022 bacterial strain can not survive (seeing below).But, be lower than 10 if in challenge dose, use ⁵Bacterium then can not identify revertant, show that reply frequency may be about 10 ^-5When passing judgment on, for the CS022 bacterium phoP that on LB, grows with same bacterium colony phenotype ^cPhenotypic reply frequency is actually 6 * 10 ^-4Show from percentage ratio, for selecting phoP near the revertant that reclaims the dead animal ^cPhenotypic revertant has selective pressure in the body, and hint, for having non-response phoP ^cThe bacterial strain of sudden change, viewed virulence deletion may be higher from quantitative angle analysis.

PhoP in scavenger cell ^cBacterial strain can not be survived

Because existence is to the importance of the virulence of Salmonellas (referring to people such as Fields, 1986, Proc.Natl.Acad.Sci.USA 83:5189 is incorporated herein for referencial use) in scavenger cell, we have detected phoP ^cThis performance of bacterium.Compare with wild-type bacterium, the CS022 bacterial strain can not be grown in scavenger cell and be kept (Fig. 1).In Fig. 1, with CS022 (phoP in the scavenger cell of cultivating ^c) viability (representing with trilateral) of bacterial strain and the viability of wild-type mice salmonella typhi ATCC 10428 (representing with circle) compare.Shown experiment is a representative example.The difference of two bacterial strains in the time of 4 and 24 hours is significant (P＜0.05).From qualitative angle, phoP ^-As if bacterium have phoP ^cThe scavenger cell existence shortcoming situation that bacterium is similar, but find out its viability in the experiment of together finishing doubly than the strong 2-3 of the latter.In being rich in the mouse organ of scavenger cell, be returned to phoP ^cThe rate of recovery of phenotypic bacterium increases and phoP ^cThe macrophages in vitro survival rate of mutant reduces consistent.

With phoP ^cBacterial strain is as living vaccine

PhoP was once reported in the front ^-Bacterial strain can be used as the living vaccine of protection mouse opposing typhoid fever, people such as Miller, and 1989, document is the same.Will be as the phoP of attenuated live vaccine ^cImmunogenicity in mouse and phoP ^-Compare.To the mouse of two kinds of live vaccine bacterial strains having inoculated the dosage that is divided into grade in front, attack with wild-type ATCC 10428 bacterial strains of the challenge dose that is divided into grade, measure the existence situation simultaneously and finish above-mentioned comparison step.Two kinds of live vaccines are CS015 phoP ∷ Tn10d-Cam and CS022 pho-24, and with salt solution in contrast.The result's (table 2) who obtains shows following results: (i) phoP of low dose of peritoneal injection ^cBacterial strain (for example 15 bacteriums) can be protected mouse opposing roughly 5 * 10 effectively ⁵The challenge dose of individual bacterium (represents peritoneal injection greater than 10 ⁴The challenge dose of Lethal Dose 50), the (ii) phoP by Orally administered heavy dose ^cBacterium can protect the mouse opposing to contain 5 * 10 fully ⁷The oral challenge dose of wild-type bacterium (surpasses 200 oral wild-type LD ₅₀) and (iii) by comparison, heavy dose of phoP ^-Bacterium (5 * 10 ⁵) same provide protection can not be provided.PhoP ^cSudden change take place to be replied in vivo to make these bacterial strains is become complicated as the analysis of vaccine, because the revertant of CS022 bacterial strain (being wild-type cell) has increased immunogenicity.But, by to from having accepted 10 ⁴10% spleen and the liver organization that perhaps still less obtain in those mouse of bacterium check that we can not identify revertant.

Bacterial strain, material and method

Used following bacterial strain, material and method in the work of the research phoP regulon of Miao Shuing in the above.

Being stored in 14028 bacterial strains of American type culture collection (ATCC), is a kind of deleterious salmonella typhimurium strain of smooth type, and it is the parent strain of all Study on Virulence.TT13208 is given by Nang Zhu and John Roth.The TA2367 bacterial strain is the present that Gigi St-ortz and Bruce Ames generosity are given, people such as Kier, and 1979, document is the same.Bacteriophage P22HT int is used for transduction hybridization, is isogenic bacterial strain except that the phoP site mutation to make up, people such as Davis, and 1980, Advanced Bacterial Gen-etics, p.78,87.Cold Spring Harbor Laboratory, Cold Spr-ing Harbor, NY is incorporated herein by reference.As rich medium, and minimum medium is people such as M9, Davis with the Luria liquid nutrient medium, 1980, see above.The phosphatase substrate 5-bromo-4-chloro-3-indyl phosphoric acid (XP) that will add lustre to is used for estimating quantitatively the generation of solid medium acid and AP.

In the P22 that utilizes bacterial strain CS003 Δ phoP Δ purB to carry out transduction hybridization, make up the derivative of the Salmonella typhimurium ATCC 10428 that has the pho-24 sudden change with the TA2367 bacterial strain as the donor of purB gene, people such as Miller, 1989, document is the same.On minimum medium, select the bacterium colony that to grow then.Can be at transduttant (the phenotype phoP of the called after CS022 of the acid phosphatase (improving 9 times) of synthetic 1750U on the rich medium than wild-type turnout on rich medium ^c) be used for further research.

By phage P22 transduction hybrid method, and utilize TnphoA ^-Or the kalamycin resistance of Mu dJ-coding selects, and makes up the derivative of the acid phosphatase feminine gender of the CS022 bacterial strain that contains the pag gene fusion and CS023 pho-24 phoN2 ZXX ∷ 6251 Tn10d-Cam derivatives and CS022.The active suitable loss of fusion rotein is checked the complete pag gene fusion of bacterial strain when importing in phoP105 ∷ Tn10d or phoP102 ∷ Tn10d-Cam equipotential base position by checking.

As previously mentioned, to acid phosphatase, AP and beta-galactosidase enzymes are analyzed, referring to people such as Miller, 1989, see above, and the unit according to the Miller definition represents, 1972, Experiments in molecular genetics, P.352-355, Coldspring Harbor Laboratory, Cold Spring Harbor, NY is incorporated herein by reference.

In sodoku power and immunization research, will in the Luria liquid nutrient medium, wash and dilute by the bacterium of overnight growth with this salt solution with common salt solution.In all living vaccine Attack Research, all use the wild-type parental strain (ATCC 10428) of CS022.When with peritoneal injection (i.p.) when approach is used, for 50% lethal dose (LD of adult this bacterial strain of BALB/c mouse of doing experiment first ₅₀) be lower than 20 bacteriums, when being dissolved in NaHCO ₃50% lethal dose was 5 * 10 when middle oral route was used ⁴Mouse is from Charles River Breeding Labo-ratories, and (Wilmington Mass.) buys Inc., and grows to 5-6 mouse and begin to attack for the first time during age in week.All peritoneal injection inoculations are all finished according to the front described method, referring to people such as Miller, and 1989, see above.Oral challenge trial is with growing in also finishing through centrifugal and spissated bacterium of LB liquid nutrient medium.Bacterium is resuspended in 0.1M NaHCO ₃In so as in and hydrochloric acid in gastric juice, and animal fed to animal with the 0.5ml pill form after with etherization.Carry out enumeration to estimate the number of the bacterium of using exactly.All challenge trial are to inoculate back 1 month and oral attack back was carried out in 6 weeks at peritonaeum.Attack inoculation and can adopt the same approach of immunization that is similar to.Regulation according to the Massachus-etts central hospital and the care of animal council of medical courses in general school of Harvard is raised these animals.

Protein electrophorese is finished as follows: unidirectional gel electrophoresis of protein is by Laemm-li, 1970 method (Nature 227:680, be incorporated herein by reference), the whole-cell protein matter extract of the stationary phase cells of overnight growth in the Luria liquid nutrient medium is carried out.To dye with the coomassie brilliant blue R250 that is dissolved in 10% acetate-10% methyl alcohol after the gel sets.The gel electrophoresis of amphitropic protein matter is the method (J.Biol.Chem.250:4007 is incorporated herein by reference) that adopts O ' Farrell 1975, carries out with same full cell extract.With 1.5%pH is that (Md.) electrophoresis 9 for LKB Instruments, Balti-more, and 600Vh (700V carried out 13 hours 45 minutes) finishes isoelectrofocusing for the ampholine of 3.5-10.According to a surface p H electrode (BioRad Laboratories; Richmond; Calif.) measure and the acetylizad cytopigment pI marker (Calbio-chem-Behring of electrophoretic band look in adjacent tubes; La Jolla Calif.) can measure final pipe pH of latex gel gradient and extend to pH8.1 from pH4.1.According to people such as Merril, 1984, the method for Methods Enzymol.104:441 (being incorporated herein by reference) is carried out silver to gel method and is dyed.

In the scavenger cell viability detects, test is to describe by the front, people such as Miller, 1989, see above, according to from people such as Lissner, 1983, J.Immunol.131:3006 (being incorporated herein by reference) method is revised, people such as Buchmeier, 1989, the method for Infect.Immun.57:1 (being incorporated herein by reference) is carried out.With stationary phase cell in common mouse serum, nursed one's health 30 minutes, contact with the scavenger cell culture of the bone marrow derived of collecting from BALB/c mouse then.After infecting one hour, add gentamicin sulphate (8 μ g/ml) so that cell killing bacterium outward.At all time points three repetitions are arranged all, and will test triplicate.

PhoP ^cMutants which had is more efficiently living vaccine

When being used as the living vaccine of opposing mouse typhus, Salmonella typhimurium phoP ^cMutant is highly effective and is better than phoP ^-Bacterium.Adopt the intraperitoneal route of administration as long as few to 15 phoP ^cBacterium just can be protected mouse opposing 10 ⁵LD ₅₀The wild-type bacterium (table 3) of (50% lethal dose).This shows that the pag gene product is important antigen for the protection immunization of opposing mouse typhus.The preliminary experiment result is verified, can be discerned the gene product that regulated by phoP of salmonella typhi by the antigen of chronic typhoid fever carrier serum identification.If only express protective antigen in the host, the killed vaccine that so only grows in rich medium can not these proteinic immunne responses of reactance.

Service condition for the different Salmonella typhimurium killed vaccine preparation that contains different sudden changes in the phoP regulon is assessed.In at table 3, see, do not have a kind of dead cell preparation as vaccine (even contain phoP ^-And phoP ^cThe preparation of the mixture of bacterium) can be effective as bacterium alive.This shows that living vaccine has other characteristics, and promptly immunogenicity improves or important is subjected to antigen that non-phoP regulates not in these preparations.What be studied is only just using phoP when minimum challenge dose in animal ^cObserve provide protection in the animal of bacterial immune.This shows that further being subjected to phoP activated gene is important protective antigen.

Table 3

Have the challenge dose of the Salmonellas of phoP regulon sudden change as killed vaccine inoculating strain phenotype wild-type bacterium

6 * 10 ³6 * 10 ⁵Do not inoculate (3) (5) ATCC10428 wild-types (8) (9) CS015 phoP ^-(10) (13) CS022 phoP ^c2/7 ( ^*) (14) CS022/CS015 phoP ^-/ phoP ^c(8) (13)

CS0l5＝phoP102∷Tn10d-Cam CS022＝pho-24

With 5 * 10 ⁸The bacterium that individual formalin kills is given BALB/c mouse inoculation twice, 7 days at interval.In three weeks after inoculation for the second time, attack mouse by two kinds of dosage indicating with wild-type bacterium.Bracket inner digital show after attacking, do not have the survivor and till death in average fate.

( ^*) survivor and the ratio of under fire counting.

PhoP ^cShow the constitutive expression of being regulated by phoP activated gene, and the gene that phoP checks is not expressed.

PhoP ^-Show the expression of gene of not expressing and checked by phoP that is subjected to phoP activated gene.

The dual mutant strain of aroA phoP regulon

Stocker, Levine with and the nearest goal in research of colleagues concentrated on the bacterial strain of the auxotrophic mutation in die aromatischen Aminosaeuren and the purine approach as living vaccine, people such as Hoseith, 1981, Nature 291:238 is incorporated herein by reference, Sto-cker, 1988, Vaccine 6:141 is incorporated herein by reference, and people such as Levine, 1987, J.Clin.Invest.79:888 is incorporated herein by reference.Having found that purine sudden change can lower immunogenicity greatly, may be because bacterium can not obtain people such as purine, Sigwart in the mammalian hosts, 1989, and Infect.Immun.57:1858 is incorporated herein by reference.Because by carrying out the homology reorganization or pass through in the host, to obtain required metabolite with the wild-type copy that comes from bacterium in the environment, nutrient defect mutation can be remedied, therefore, the second kind of attenuation sudden change (promptly not being only second sudden change in identical pathways metabolism) that contains for living vaccine in different toxicity mechanisms is seemingly desirable.In addition, the aroA mutant has some remaining virulence in mouse.The different strains that has aroA sudden change and the sudden change of phoP regulon is investigated, observed weakening and immunogenicity of its virulence.Table 4 proof, phoP ^-Or phoP ^cSudden change further makes the virulence of Salmonella typhimurium aroA mutant lower 100 times at least, and keeps immunogenicity at least when high-level inoculated bacteria.Has pagC ^-And phoP ^cPhenotypic bacterial strain all further lowers its virulence than independent any sudden change.Therefore, the phoP regulon sudden change security that can improve aroA living vaccine preparation.

Table 4A

The extra attenuation of the aroA mutant being brought by phoP regulon sudden change

The survivor of the mutant salmonella bacterium of different numbers ( ^*) strains expressed type 10 ⁶10 ⁷10 ⁸10 ⁹10 ¹⁰( ^*) CS004 aroA ^-6/6 1/6 0/6 0/6 6/6SL3261 aroAdel His ^-6/6 1/6 0/6 0/6 6/6CS322 aroA-PhoP ^c6/6 6/6 6/6 1/6 6/6CS323 Sl3261 PhoP ^c6/6 6/6 6/6 2/6 6/6CS315 aroA-PhoP ^-6/6 6/6 6/6 2/6 6/6CS316 SL3261 PhoP ^-6/6 6/6 6/6 1/6 6/6CS026 pagC ^-Phop ^c6/6 4/6 0/6 0/6 6/6

Table 4B

The protection efficient that has the Salmonellas of aroA/phoP regulon sudden change

The survivor of the challenge dose of wild-type bacterium ( ^*) strains expressed type inoculum 5 * 10 ⁵5 * 10 ⁷

CS004 aroA

^-10 ⁶4/4 5/5SL3261 aroAdel His ^-10 ⁶4/4 4/5CS322 aroA ^-PhoP ^c10 ⁶5/5CS323 SL3261 PhoP ^c10 ⁶5/5CS322 aroA ^-PhoP ^c10 ⁷5/5CS323 SL3261 PhoP ^c10 ⁷5/5CS322 aroA ^-PhoP ^c10 ⁸5/5CS323 SL3261 PhoP ^c10 ⁸5/5CS315 aroA ^-PhoP ^-5/5CS316 SI3261 PhoP ^-10 ⁸5/5 ( ^*) survivor with by the ratio of the mouse number attacked.( ^*) represent that this experiment is oral vaccination, every other experiment is the peritonaeum inoculation.CS004＝aroA554∷rn10.SL3261＝aroADEL407?hisG46.CS322＝aroA554∷Tn10?pho-24.CS323＝aroADEL407?pho-24.CS315＝aroA554∷Tn10?phoP102∷Tn10d-Cam.CS316＝aroADEL407?hisG46?phoP102∷Tn10d-Cam.CS026＝pagC1∷TnphoA?pho-24?phoN2?zxx∷6251TN10d-Cam.

The sudden change of salmonella typhi phoP regulon

The phoP regulon is that part is conservative at least in salmonella typhi DNA hybridization research, the hybridization of P22 phage transduction is proof also, and between salmonella typhi and Salmonella typhimurium, phoP, phoQ and pagC gene be high conservative seemingly.These genes in the salmonella typhi are undergone mutation.

Living salmonella vaccine is as the release system of heterologous antigen

The carrier that uses in the vaccine release system is by people such as Miller, 1988, and the derivative (being incorporated herein for referencial use) of the pJM703.1 that J.Bact.170:2575 describes.This carrier is a kind of R6K derivative that has disappearance in the pir gene.This R6K derivative needs the protein of pir gene just reproducible.The intestinal bacteria that contain the pir gene that exists with lambda particles phage prophage form can be supported duplicating of this carrier.The cell that does not contain the pir gene can not support this carrier to duplicate with the plasmid form.This carrier also contains the mob zone of RP4, and it can make from the coli strain of for example SM10 λ pir and transfer to other gram negative bacteriums by mating, and it can provide trans forwarding function.

The pagC district is shown in Fig. 2 and 3.Fig. 2 shows the restriction endonuclease sites at pagC seat.Thick lines are represented the pagC encoding sequence.Inverted trilateral represents that TnphoA inserts.Arrow is represented transcriptional orientation, is from left to right.The numbering expression, is numbered positive number and represents the initiator codon downstream position with the expression of base pair numbering with respect to the position in the endonuclease site of the pagC translation initiation codon of inferring, and is numbered negative number representation upstream from start codon position.A is AccI, and B is BglI, and C is ClaI, and D is DraI, and E is EcoRI, and H is HpaI, and N is NruI, and P is PstI, and S is SspI, and T is StuI, and U is PvuII, and V is EcoRV, and II is BglII.Fig. 3 represents the dna sequence dna (Sequence I.D.No.1) of pagC ∷ TnphoA and translates.Beneath sequence of drawing thick line is represented a kind of potential ribosome bind site.Under draw wall scroll or two bar fine rule to indicate this sequence be to be used for making up and these Nucleotide complementary primer mutually, be used for the primer extension of RNA analytical procedure.The transcripting start point estimated represented in asterisk.Arrow is represented transcriptional orientation.The sequence table of drawing frame is shown with the zone of polysaccharase combination and recognition reaction.Inverted trilateral is represented to insert connection site through the TnphoA of order-checking.Arrow is represented the potential site of unique sequence cutting.

The 3Kb DNA that will contain the pagC gene is (from the PstI restriction endonuclease sites, promptly from 1500 Nucleotide of pagC rotaring intertranslating start site 5 ' direction, to EcoRI restriction endonuclease site, i.e. 1585 Nucleotide places, downstream, pagC Transcription Termination site) be inserted in the pJM703.1 derivative discussed above.Lacked (490 Nucleotide) and substitute with a synthetic oligonucleotide polylinker (polylink-er) from the pagC sequence in ClaI restriction endonuclease site, this polylinker has been created unique restriction endonuclease site.The DNA of the one or more heterologous proteins of coding (for example antigen) can be inserted this site.Made a kind of carrier like this, this carrier can allow a plurality of foreign genes to be inserted among the pagC DNA on every side.

Adopt mating or any other release system (for example heat-shocked, phage transduction or electroporation method) this carrier can be moved in Salmonellas.Because this carrier reproducible not, therefore have only homologous dna with pagC gene both sides to carry out the locus specificity reorganization and this carrier is inserted in the Salmonellas.This will destroy natural pagC seat and make it inactivation, and substitute with the pagC DNA of the fragmentation of carrying on this carrier.

According to marker exchange, and if to be inserted into foreign DNA in the pagC seat be to have supplied growth vigor to cultivate on selective medium and identify the generation of this reorganization.The insertion of the antibiotics resistance gene that is used to select seldom is gratifying, and antibiotics resistance increases in the natural bacteria colony because this can make.Can be with gene to the material except that microbiotic (for example heavy metal or arsenic) tool resistance (for mercury resistance, referring to people such as Nucifora, 1989, J.Bact.171:4241-4247 is incorporated herein for referencial use) identification transformant is provided.Another kind can be selected method for use, and available Salmonellas F-strain (this bacterial strain has carried the auxotrophic mutation in the pathways metabolism) and a kind of carrier that carries the DNA that is complementary to auxotrophic mutation are selected.Many Salmonellas live vaccine prototypes contain sudden change in Histidine or purine approach, thereby the complementarity of available these metabolic nutrition defect bodies is selected intasome.(the purine sudden change has demonstrated toxicity when using in human body low excessively).According to the forfeiture of amicillin resistance (being carried on the plasmid main chain) or can further confirm the exchange of marker by the blot hybridization analysis.

By with the complementarity of metabolic nutrition defective type vaccine bacterial strain, the gene that is used to select can be cloned.Concrete example comprises the DNA of clones coding purB and phoP, and it is by carrying out with the bacterial strain that has lacked these gene functions is complementary.According to the method known in the art, in pLAFR cosmid vector (people such as Frindberg, 1984, Anal.Biochem.137:266-267 is incorporated herein for referencial use), make up the salmonella gene library.The pLAFR clay is the wide spectrum host range plasmid, and this plasmid can be transferred to Salmonellas from intestinal bacteria.The whole storehouse of such bacterial strain can be moved on in the salmonella vaccines bacterial strain, and select (for example growth of the purB in not having the substratum of VITAMIN B4) by auxotrophic complementation.Identify then can with this defect body complementary DNA, and it is cloned in the antigen release vehicle.

As discussed above, heterologous gene can be inserted in the polylinker (polylinker), this polylinker is inserted in the pagC sequence of carrier.This heterologous gene can be under any control of the many promoter systems that are subjected to the environment adjusting, and this promoter systems can be expressed in the host and be closed in the laboratory.Because expression of exogenous gene, especially membranin (it is most important antigen) is usually poisonous to bacterium, thereby the promotor that use is regulated by environment is very gratifying, these promotors can be expressed in mammalian tissues high-levelly, the expressing heterologous antigen not but it can be grown in the laboratory.In addition, convert the synthetic heterologous protein to by the metabolism fuel with bacterium, high level ground antigen expressed can cause the attenuation of this bacterium to increase in host tissue.If exotic antigen is expressed in the phagocytic cell host specifically, then can increase these proteinic immunne responses, because be that these cells carry out antigen processing.

The promoter systems that comes in handy comprises when those are worked as a kind of specific nutritive ingredient and can not be obtained by the bacterium in the mammalian hosts and the promoter systems that regulated by nutritional status.For example purine and iron can not obtain people such as Sigwart, 1989, Infect.Immun., people such as 57:1858 and Finklestein, 1983, Rev.Infect.Dis.5:S759 in the host.Thereby the promotor that regulated by iron, aerobactin gene promoter for example, and the promotor of biosynthesis gene all is outstanding candidate in the purine approach, with detect its can as when growth in these nutrition of high density can pent promotor.The Salmonellas promotor that other available are regulated by environment comprises and is controlled to be specifically expressed protein in scavenger cell (for example Dnak and GroEL protein, their expression improves when at high temperature growing), and some are subjected to phoP activated gene product and the promotor of the gene of encoding, referring to people such as Buchmeier, 1990, Science 248:730 is incorporated herein by reference.Therefore, for example such promotor of pagC 5 ' control sequence, and the promotor of the control heat shock gene that is described in detail, for example GroEL and DnaK are desirably in the scavenger cell and are activated specifically.Scavenger cell is the place of antigen processing, heat shock gene in scavenger cell expression and heat shock gene occurring in nature widely conservative property can explain these proteinic immunodominances.A kind of total heat-shocked promoter sequence is known, and can be used in the carrier (people such as Cowling, 1985, Proc.Natl.Acad.Sci.USA 82:2679 is incorporated herein by reference).

Carrier can comprise and is used for the proteic T7 polymeric enzymatic amplification system that regulated by environment of expressing heterologous.For example, being in the promotor control T7 pol gene down that iron regulates (is cloned by StanTabor and Charles Richardson, referring to people such as Current Protocols inMolecular Biology ed.Ausubel, 1989 (waiting the 3.5.1.2 page or leaf) JohnWiley and Sons, be incorporated herein for referencial use), can be contained in the carrier of above-mentioned discussion.We are with colibacillary aerobactin gene promoter, sequence is CATTTCTCATTGATAATGAGAATCATTATTGACATAATTGTTATTATTTTACG (SEQ ID NO:2) (people such as Delorenzo, J.Bact.169:2624, be incorporated herein for referencial use) be inserted into the front of T7 pol gene, and prove that its gene product is regulated by iron.This carrier will also comprise the one or more heterologous antigens that are subjected to the control of T7 polymerase promoter.Is known from the T7 of synthetic oligonucleotide T7 promotor and purifying at the external RNA that can synthesize.When bacterium ran into low iron hoop border, the T7 polysaccharase was synthesized, and this helps gene of T7 promotor control to carry out high-caliber expression.

PagC fusion rotein in the Salmonella typhimurium

The expression that is in the heterologous antigen under the promotor control that phoP regulates in scavenger cell can be used as the effective ways that make the Salmonellas attenuation and strengthen the immunity of exogenous antigen.As discussed above, be the expression that has induced pagC in the scavenger cell at the cell of process antigen.Therefore, in scavenger cell, also may induce the expression that is in the heterologous antigen under the control of pagC promotor.

Control the immunne response of the heterologous antigen of expressing down for assessment to being in induction type pag promotor, regulate the microbionation mouse of expressing antigen A P under the sequence control with pagC or pagD.Single copy chromogene from coding AP in these bacteriums has produced the pag-AP fusion rotein.This bacterium can produce with two kinds of methods: TnphoA mutagenesis, and the gene engineering that utilizes suicide vector, two kinds of methods are above all having description.

In contrast, express the microbionation mouse of AP fusion rotein down with being in constitutive promoter control.This constitutive promoter does not rely on the regulating effect of gene in the phoP regulon fully.Such two strain bacteriums, bacterial strain 610 and bacterial strain 617 have been made up with above-described method.The AP expression amount is medium in 610 bacterial strains, and the expression amount of AP is high (referring to Figure 14 C) in 617 bacterial strains.

With these bacterial strains from peritoneal injection to the BABL/c mouse.Obtain serum sample after three week of inoculation.With normal mouse serum with comparing.Utilize the elisa assay method of standard to detect in the serum whether have the AP specific antibody.Also utilize the LPS-specific antibody in the Salmonella typhimurium LPS detection serum.In the mouse serum of all tests, all detected antibody, but only from the individual chromosome gene copy, expressed the immunne response (referring to Figure 14 A and Figure 14 B) that has produced in those bacterial strains of AP at pattern heterologous antigen (AP) with pag fusion rotein form therein at LPS.

Although the constitutive expression of AP fusion rotein exceeds more than 10 times approximately in 617 bacterial strains, this antibody is only produced after with 617 inoculation the immunne response of minimum.On the contrary, in the mouse of inoculation that can express the pag-AP fusion rotein, observe by force and reply.These data show that the phoP regulating effect that causes in vivo inducing protein expression in the scavenger cell has improved the immunity that is in the heterologous antigen of expressing under the control of pag promotor.In scavenger cell or other provide in the antigenic cell, instruct a kind of protein to carry out any promotor that cell-specific, inducibility are expressed, pag for example described herein can be used for improving the immunogenicity of antigens of expressing in the Salmonellas.

PagC gene and pagC gene product

Bacterial strain, material and method

In the analytical procedure of pagC clone and this gene and gene product, used bacterial strain described below, material and method.

Rich medium is Luria liquid nutrient medium (LB), minimum medium is M9, people such as Davis, 1980, document is the same, and the method that makes up Salmonella typhimurium strain CS119 pagC1 ∷ TnphoA phoN2 2XX ∷ 6251 Tn10d-Cam is described at preamble, referring to people such as Miller, 1989, document is the same.It is isogenic CS018 that the salmonella typhimurium strain 10428 of American type culture collection (ATCC) comprises except that phoP105 ∷ Tn10d with CS119, referring to people such as Miller, and 1989, document is the same, also comprise people such as CS022pho-24, Miller, 1990, J.Bacteriol.172:2485-2490, be incorporated herein for referencial use, and CS015 phoP102 ∷ Tn10d-cam, people such as Miller, 1989, document is the same.Other wild type strains that are used to prepare chromosomal DNA comprise Salmonella typhimurium LT2 (ATCC 15277), Salmonella typhimurium Q1 and S.drypool (Dr.J.Peterson U.Texas Medical Branch, Galveston), and salmonella typhi Ty2 (Dr.Caroline Hardegree, Food and Drug Administrati-on).The intestinal bacteria MM294 that utilization contains pRK 2013 transfers to Salmonella typhimurium with the pLAFR clay from intestinal bacteria, people such as Friedman, and 1982, Gene 18:289-296 is incorporated herein for referencial use.The phosphatase substrate 5-bromo-4-chloro-3-indoles phosphoric acid salt (XP) that utilization adds lustre to screens the AP actives on solid medium.The detection of AP is carried out according to previously described method, people such as Brickman, and 1975, J.Mol.Biol.96:307-316 is incorporated herein for referencial usely, and reports with the unit of Miller definition, Miller, 1972, document is the same, pp.352-355.

Finish unidirectional gel electrophoresis of protein according to the method for Laemmli, referring to Laemmli, 1970, Nature, 227:680-685, be incorporated herein for referencial usely,, utilize antibody to carry out the blot hybridization test at AP according to describing the front, people such as Peterson, 1988, Inf-ect.Immun.56:2822-2829 is incorporated herein for referencial use.By in the SDS-pagE sample buffer, cell being boiled, and from 37 ℃, preparation whole-cell protein matter extract in the saturated culture of aerated culture among the LB, Laemmli, 1970, document is the same.Method according to O ' Fa-rrell is carried out two dimensional gel electrophoresis, O ' Farrell, and 1975, J.Biol.Chem.250:4007 is incorporated herein for referencial use.Dye the protein of observing on the 10% polyacrylamide gel plate by silver, people such as Merril, 1984, Methods in Enzymology, 104:441 is incorporated herein for referencial use.

Method according to Mekalanos prepares chromosomal DNA, referring to Mekalanos, and 1983, Cell, 35:253-263 is incorporated herein for referencial use.According to Southern, 1975, the method for J.Mol.Biol.98:503-517 (being incorporated herein for referencial use) will be transferred on the nitrocellulose filter carrying out the size fractionation separated DNA on the sepharose.According to the random primer method, people such as Frinberg, 1984, document is the same, and the dna probe that will be used for the Southern hybridization analysis carries out radio-labeling.Adopt CaCl ₂With the heat-shocked method, Mekalanos, 1983, document is the same, or utilizes gene pulse (Genepuls-er) equipment (Biorad by manufacturer recommendation, Richmond, Ca.) carry out electrical breakdown (people such as Dower, 1988, Nucl.Acids Res.16:6127-6145, be incorporated herein for referencial use), plasmid DNA is transferred in intestinal bacteria and the Salmonellas.Adopt people such as Sanger, 1977, Proc.Natl.Acad.Sci.USA, the dideoxy-chain terminating method of 74:5463-5467 (being incorporated herein by reference), and according to SEQUENASE ^R(modification method Ohio) is finished the order-checking to DNA for U.S.Biochemical, Cleveland.With Applied BiosystemsMachine synthetic oligonucleotide, and it is used as the primer of the primer extension reaction of sequencing reaction and RNA.At the specific primer of two ends of TnphoA, one of them primer is consistent with the AP encoding sequence with specifically, and another is consistent with the right IS 50 sequences, is used for that transposon is inserted the junction and checks order.

In pLAFR3, make up Salmonella typhimurium clay gene pool as follows, and screening contains the clone of wild-type pagC DNA.Utilize restriction endonuclease Sau3A that the DNA of Salmonella typhimurium ATCC 10428 bacterial strains is carried out part digestion, on the 10-40% sucrose density gradient, select then.Utilize the T4 dna ligase that the chromosomal DNA of size for 20-30 Kb is connected on the cosmid vector pLAFR3, pLAFR3 is the derivative of pLAFR1, people such as Friedman, 1982, Gene 18:289-296, be incorporated herein by reference, it is to digest with restriction endonuclease BamHI.Utilization is from Stratagene, La.Jolla, the extract that Ca. buys cosmid DNA is packed and transfection in bacillus coli DH 5-α bacterial strain.Adopt blot hybridization method screening bacterium colony.

The protein that produces from clone's DNA detecting by in-vitro transcription/translate is analyzed as follows.These detections finish with cell-free extract that (Illinois), and the condition of using manufacturers to describe is finished for Amersham, Arlington Heights.The radiolabeled protein who generates adopts SDS-pagE to analyze at last.

Adopt hot phenol processes purifying RNA from the Salmonellas culture of morning logarithmic phase and stationary phase, people such as Case, 1988, Gene 72:219-236, be incorporated herein for referencial use, and on agarose-formaldehyde gel electrophoresis to carry out the blot hybridization analysis, Thomas, 1980, Proc.Natl.Acad.Sci.USA 77:5201 is incorporated herein for referencial use.By previously described method, people such as Miller, 1986, Nuc.Acids.Res.14:7341-7360, be incorporated herein for referencial use, utilize the AMV reversed transcriptive enzyme (Promega, Madison, Wisconsin) and the primer extension analysis that carries out RNA with the 335-350 position Nucleotide and the 550-565 position Nucleotide complementary synthetic Oligonucleolide primers at pagC seat.

The proteinic evaluation of 18KDa that in Salmonella typhimurium pagC mutant, lacks

Adopt amphitropic protein matter electrophoretic analysis pagC mutant strain CS119, cause the kinds of protein that lacks with detection owing to TnphoA inserts.When carrying out this analysis, except that the transposon that inserts, be the single disappearance protein of only observing about 18KD and pI-8.0 in the isogenic bacterial strain.When carrying out similar analysis, also find the disappearance of this 18KDa kind with the Salmonellas that has phoP and phoQ sudden change.Although amphitropic protein matter gel analysis can not detect the slight change of expressed protein in the CS119 bacterial strain, this means because pagC::TnphoA inserts, caused the disappearance of a main protein kind.

Other inspections that two-way gel analysis method is carried out have shown that a kind of may be the new protein kind of about 45KDa of pagC-AP fusion rotein.Adopt Western engram analysis method and also this pagC-AP fusion rotein is analyzed, and find that its size is similar to natural A P (45KDa) and can not be at phoP at the antiserum(antisera) of AP ^-Express in the Salmonella typhimurium.

PagC ∷ TnphoA inserts segmental clone

From Salmonella typhimurium CS119, prepare chromosomal DNA, and utilize the TnphoADNA fragment, adopt the rough physical map of restriction endonuclease in the blot hybridization assay pagC ∷ TnphoA integration region as probe.This working result shows, digests producing the unique DNA fragment with restriction endonuclease EcoRV, and this fragment also comprises the pagC ∷ TnphoA of insertion except that the side DNA that comprises several Kb.With the chromosomal DNA (concordant end) of EcoRV digestion CS119 bacterial strain, and be connected on the bacterial plasmid vector pUC19 (New England Biolabs), this pUC19 carrier is with restriction endonuclease SmaI digestion (concordant end).With this DNA electric shock bacillus coli DH 5-α bacterial strain (BRL) of boring a hole, and with bacterium colony in the LB agar upper flat plate cultivation that contains kantlex antibiotic (TnphoA coding) and penbritin (by the pUC19 coding).Select one penbritin and the kalamycin resistance clone who contains called after pSM100 plasmid and do further research.

Make up radiolabeled dna probe from pSM100, and use it in the Southern hybridization analysis of CS119 bacterial strain and its wild-type parent ATCC 10428, to confirm that pagC ∷ TnphoA syzygy has been cloned.This probe contains in the tight adjacent sequence of AP gene opposing ends and transposon, includes 186 bases of the right IS50 of transposon and 1278 bases (Fig. 2) of Salmonellas DNA with the dna fragmentation that produces after the enzymic digestion of HpaI endonuclease.Just as expected, hybridize mutually with the dna fragmentation that from contain the CS119 bacterial strain that inserts transposon, obtains by pSM100 deutero-probe with the 11-12Kb of AccI endonuclease enzymic digestion.This probe is approximately than the big 7.7Kb of 3.9KBAccI fragment (size of TnphoA) that exists in the wild type strain of hybridizing with it.In addition, with the derivative of plasmid pSM100, pSM101 (it can not make the pagC-phoA genetic fusant be separated from the lac promotor and express) is transformed into phoP ^-In (CS015 bacterial strain) and phoN-(CS019 bacterial strain) the Salmonellas bacterial strain, and find that the AP activity cloned depends on phoP and expresses.Therefore, we may safely draw the conclusion: the DNA that is cloned contains pagC ∷ TnphoA syzygy.

Also proof has the pagC gene in other bacterial strains of Salmonella typhimurium and salmonella typhi and S.dryp-ool.All checked Salmonellas bacterial strains demonstrate has similar strong hybridization to 8.0Kb EcoRV with 3.9Kb AccI restriction endonuclease fragment, this means that pagC is the virulence gene that salmonella strain generally has.

From the pagC gene probe of the-46 Nucleotide (with 1 first base) to 802 (the PstI site is to the BglII sites) as methionine(Met) can not with from labor Di Shi lemon bacillus not, shigella flexneri, bacillus ceylonensis A, shigella dysenteriae, intestinal bacteria, vibrio cholerae, Vibrio vulnificus, the DNA of yersinia entero-colitica and klebsiella pneumoniae carries out cross hybridization.

The clone of wild-type pagC seat DNA and to the complementary action of Salmonella typhimurium pagC mutant virulence deletion

The clay gene pool that above-described same restriction endonuclease fragment is used to screen wild-type ATCC 10428 bacterial strains.The single clone of a called after pWP061 contains the 18Kb DNA of Salmonella typhimurium, and can hybridize by force with the pagC dna probe.When adopting restriction endonuclease analytical method and southern blotting technique hybrid method to analyze, find that pWP061 contains the Salmonellas DNA identical with pSM100.Also will carry out the blot hybridization analysis with DNA from the probe of pWP061 from wild-type and CS119 Salmonella typhimurium.Viewed corssing form is with observed identical with pSM100.Also pWP061 is transferred to the CS119 bacterial strain, in a kind of pagC mutant strain.The bacterial strain that obtains has wild type strain virulence (its LD when using with the IP injecting pathway to BALB/c mouse ₅₀Be lower than 20 bacteriums).Therefore, by the DNA complementation of being cloned the virulence of pagC mutant strain forfeiture.

Since find to contain pagC seat DNA the complementation of wild-type clay the virulence of pagC mutant Salmonella typhimurium strain disappearance; thereby can reach a conclusion: pagC protein; film (seeing below) albumen of one 188 amino acid (18KDa), be Salmonella typhimurium in scavenger cell, survive and virulence necessary.

The physical map in restriction endonuclease site, dna sequencing, and the mensuration of pagC gene product

PSM100 and pWP061 plasmid are carried out the restriction endonuclease analysis, obtaining the physical map at pagC seat, and also measure its transcriptional orientation (Fig. 2) for pSM100.Preparation DNA subclone, and to TnphoA syzygy contact and from the HpaI site, be the 828th Nucleotide that phoA merges joint 5 ' side, to the RcoRI site, i.e. the Salmonellas DNA of the 1032nd of the TnphoA 3 ' side of Cha Ruing the Nucleotide check order (Fig. 2 and 3).The DNA of a synthetic active A P gene fusion can derive the proper reading frame of this dna sequence dna as required.The protein of a kind of 188 amino acid whose expectation pI+8.2 of the amino acid sequence encode that obtains through deduction of this open reading frame.These data are consistent with the two-dimensional polyacrylamide gel electrophoresis analytical results of CS119 bacterial strain, lacked the 18KDa protein of a kind of about pI+8.0 in electrophoretic analysis.Do not find to estimate to encode greater than other open reading frame of 30 amino acid whose peptides.

The aminoacid sequence of 188 amino acid whose open reading frame being inferred contains from pagC and AP syzygy counts the 33rd methionine(Met) initiator codon (Fig. 3).These 33 pagC amino acid that belong to fusion rotein are consistent with observed size in the Western engram analysis, and according to people such as Kyle, 1982, the method of J.Mol.Biol.157:105-132 (being incorporated herein by reference) identifies and contains a hydrophobic N-end region, and this zone is typical bacterium signal sequence, Von Heinje, 1985, J.Mol.Biol.184:99-105 is incorporated herein by reference.Particularly the 2nd amino acids is the Methionin of a positively charged, followed a hydrophobic region, and the 24th amino acids is electronegative asparagicacid residue.Through inferring, the total cleavage site of this leading peptide is the alanine residue in the 23rd amino acids, Von Heinje, and 1984, J.Mol.Biol.173:243-251 is incorporated herein for referencial use.This dna sequence dna has also disclosed a typical ribosome bind site, and this site is at rotaring intertranslating start point 5 ' side 6-2 Nucleotide place (Fig. 3,717-723 position Nucleotide) of prediction, people such as Shine, 1974, Proc.Natl.Acad.Sci.USA 71:1342-1346 is incorporated herein for referencial use.This means that in fact open reading frame has been translated, and further supported following hypothesis: it is inserted by TnphoA and the proteinic aminoacid sequence (Fig. 3) through deriving of pagC that interrupts just.

By the outer synthetic protein of the pagC seating body of being cloned

In order to detect whether encode other protein and in order to measure the rough size of pagC gene product of pagC, the outer transcription/translation coupling of perfect aspect is analyzed.The 5.3KbEcoRI fragment of pWP061 is inserted among the pUC19, so that the pagC gene can not be from the lac promoter expression.In analyzing, in-vitro transcription-translate coupling uses this plasmid.This cell free system has synthesized the single protein of about 22KD.This size is consistent with the proteinic precursor size of the pagC that contains leading peptide.These data have further been supported following results: single pagC gene product is identified.

The discriminating of the RNA of pagC coding

By the encode RNA of about 1100 Nucleotide of pagC.With wild-type with compared by pag activated phoP composing type phenotype, with wild-type and phoP ^-Bacterium is compared, and has the phenotypic cell of pag activated phoP composing type and can express the pagC gene expeditiously.In these blot hybridization tests, can detect pagC in the wild-type cell that is in static growth phase of only in rich medium, growing.The research of this result and front (people such as Miller, 1989, see above, Miller, 1990, see above) result combines, and confirmed that pagC is the transcriptional regulatory that is subjected to the phoP gene product, and that only in rich medium, grow, that be in logarithmic phase early, have in the phenotypic cell of phoP composing type and express.

The pagC transcription product is than big approximately 500 Nucleotide of the coding necessary size of these 188 aminoacid proteins.The Oligonucleolide primers that utilization is specific to the pagC sequence carries out the primer extension analysis of Salmonellas RNA, so that measure about initiation site of transcribing, and whether 5 ' side or the 3 ' side Nucleotide of measuring these 188 amino acid whose pagC gene products are transcribed.With infer with 550-565 the Nucleotide (the 150th Nucleotide of 5 ' side of the initiator codon of supposition) of pagC mutually the complementary oligonucleotide carry out primer extension analysis and test, the result produces the primer extension product of about 300 Nucleotide.Therefore, made up a more primer of upstream, it is complementary mutually with the 335-350 position Nucleotide of pagC, and uses it in the same analysis.The primer extension product of observing 180 Nucleotide is a primer specificity.This with at transcribing of the 170th beginning consistent (Fig. 3).In the upstream at the transcription initiation place of inferring (being positioned at 153-160 position Nucleotide part), observe a typical R NA polymerase binding site point, the sequence of this site at the-12 Nucleotide places is TATAAT, the sequence at the-10 Nucleotide places is TAATAT.The Nucleotide place, 15-21 position that is being positioned at-10 regional upstreams does not observe the total RNA polymerase recognition site (TTGACA) of coupling fully.(TTGGAA) locate at the-39 Nucleotide (126-131), locate in-38 (127-132) position Nucleotide (TTGTGG), and the-25 (135-140) position Nucleotide (TTGATT) locate be with this sequence in the sequence that is complementary of the most normal conservative Nucleotide.

Based on The above results, it is that (the 1295th Nucleotide finishes near Fig. 3) for rotaring inter-transtating terminating cipher at 188 aminoacid proteins that prediction is transcribed.Really, found stem ring configuration at Nucleotide place, 1309-1330 position, it has the effect of transcription terminator.There is not the evidence of open reading frame in this result with 188 aminoacid protein downstreams and utilizes clone's pagC DNA not have transcribing of other and translate synthetic consistent.This hints that further the insertion of pagC ∷ TnphoA only makes a kind of proteic synthetic inactivation.

The similarity of pagC and Ail and Lom

Utilize National Biomedical Research Foundation/ProteinIdentification Resource, people such as George, 1986, Nucleic AcidsRes.14:11-15, be incorporated herein for referencial usely, proteinic similarity is carried out Computer Analysis.Protein sequence database is handled,, attempted to find out the clue of this protein molecule function so that identify other protein that have similarity with pagC.It should be noted that, find that pagC and phage protein Lom have similarity, in minicell is analyzed, Lom has been positioned on the outer membrane, people such as Court, 1983, Lambda II, Hendrix, R.w. wait people ed.Cold Spring Harbor Laboratory (Cold Spring HarborNY), pp.251-277 is incorporated herein for referencial usely, and confirms to be expressed by colibacillary λ lysogen, people such as Barondess, 1990, Nature 346:871-874 is incorporated herein for referencial use.Recently, determined the aminoacid sequence of the ail gene product that the quilt of yersinia entero-colitica is by inference cloned, and find also similar to Lom, people such as Miller, 1990b, J.Bacteriol.172:1062-1069.Therefore, utilize the computer algorithm of setting up protein sequence family and consensus sequence that the sequence of a protein families is carried out spread correction, people such as Smith, 1990, Proc.Natl.Acad.Sci.87:118-122 is incorporated herein by reference.Internal database value (internal data base values) with similarity between these protein: pagC and Lom (107.8), pagC and Ail (104.7), and Ail and Lom (89.8) represent the structure of this family.In database, seek these identical protein with respect to 314 control sequence, and mean value and scope be 39.3 (7.3-52.9) pagC, 37.4 (7.3-52.9) Ail, and 42.1 (7.0-61.9) Lom.The similarity of this protein families all beguine according to big 3.5 standard deviations of top score that obtain with the similarity of 314 stochastic sequences.In this database, do not find member in other similaritys or other families.The similarity zone not only is positioned leading peptide changes the film district but also runs through whole protein.

The virulence of pag mutant strain has been lowered

The virulence that has the Salmonella typhimurium of pagC sudden change of the present invention is lowered 1000 times at least.

Except that pagC, other pag genes of describing among the present invention can be used for developing salmonella vaccines alive.In phoP activated gene, undergo mutation and can be used for making up the salmonella vaccines alive of attenuation.When making up the vaccine of polyvalent salmonella-mediating, by being assigned to, exogenous gene expression provides in the antigenic scavenger cell, and be subjected to phoP activated promotor can improve immunogenicity.

The new discriminating that is subjected to phoP activated gene

In order further to analyze the effect that is subjected to phoP activated gene pairs bacterial virulence, adopt the preparation of TnphoA mutagenesis to have the strain storehouse of activation phoA gene fusion.The CS019 bacterial strain is the parent strain as TnphoA mutagenesis, because it has the virulence of wild-type bacterium and has carried phoN2 allelotrope, thereby makes the background phosphorous phytase activity drop to minimum value.According to identifying the bacterial strain that has active phoA gene fusion containing the blue colonies phenotype of growing on the agar of XP.These bacterial strains of examination are owing to the fusion rotein activity that has obtained to cause the invalid phenotypic phoP12 allelotrope of phoP to reduce then.

Being separated to 2064 expresses the bacterial strain of AP and independently is purified into bacterium colony the mating from 240 times.Isolating the frequency with the active bacterial strain of AP in kalamycin resistance (containing TnphoA) the bacterium total group is 0.8%.From the strain storehouse of expressing AP, isolate the pag ∷ TnphoA inset material standed for that is total up to 54.49 active reductions of its AP when not having functional phoP/phoQ in these material standed fors, have been measured greater than more than 6 times.Therefore, 2% in the bacterium colony of expression AP differentiated and is the pag-phoA gene fusion.

The evaluation at the pag seat of 13 uniquenesses

Whether utilize three kinds of methods to measure 49 TnphoA insets is defined in the independent pag seat.At first, determine that TnphoA inserts the EcoRI and the HindIII restriction endonuclease site physical map of site 5 ' side.The second, to carrying out the linksystem analysis with the chain transposon inset of known pag seat height.The 3rd, examination by aforesaid method measure be unique bacterial strain with known chromosomal foci on the linksystem of some bacterial strains of transposon insertion is arranged.

The blot hybridization analysis confirms have 13 5 ' sides of inserting at TnphoA that unique restriction endonuclease site is arranged in 49 bacterial strains.In TnphoA insertion 5 ' side the bacterial strain number of similar physical map being arranged is 1-7.In 13 physical maps, have one to be expected at pagC in have the physical map of inset similar, and can in isolated conduct contains 7 bacterium of pag ∷ TnphoA inset material standed for, see.These 7 bacterial strains are analyzed, the result shows, only has three to be that pagC ∷ TnphoA inserts, because carry out the blot hybridization analysis and carry out the linksystem analysis to inserting with the highly chain transposon of pagC as the pagC fragment of probe, the result shows there are 4 in these insets not in pagC.Another pag ∷ phoA syzygy is named as pagP, and 5 ' restriction endonuclease physical map that it has just in time is to be contemplated to phoN to have.But, measure this inset by linksystem analysis and blot hybridization method and be not in phoN.Wild-type bacterium and contain pagP ∷ TnphoA and the CS1247 bacterial strain of ZXX ∷ 6215 Tn10d-Cam between the hybridization of transduction property.Select transduttant according to kalamycin resistance, entail filial generation with the pagP ∷ TnphoA that guarantees the coding kalamycin resistance.The chlorampenicol resistant of these bacterium colonies of examination then, the existence of this resistance shows that ZXX:6215 Tn10d-Cam and pagP are chain.Do not find that linksystem shows that then pagP is not linked with phoN.Also finished with the part of phoN with CS1247 and tested as the blot hybridization of probe, the result shows that this bacterial strain contains a wild-type phoN seat.13 pag seats and called after pagD-P have been defined.

In order further to limit the phoP regulating effect of 13 kinds of pag ∷ TnphoA fusion roteins, be to detect the AP activity in the isogenic bacterial strain except that the phoP seat.To the Bacteria Detection AP activity (table 13) that is in logarithmic phase and stationary growth phase of on rich medium, growing.A complete phoP seat remains unchanged at different growth phases for the dependency that gives full expression to; But the relative quantity that the AP that improves along with growth expresses is limited.When will have wild-type and invalid phoP seat etc. gene bacterial strain when comparing, the difference of pag gene fusion expression changes in 6-48 times of scope.

In 5 pag seats differentiating previously, phoN only, the chromosomal localization of pagC and pagA is known.Utilization contains the bacterial strain of the transposon inset chain with pagC (AK3233 and AK3140) and the bacterial strain that contains with the chain transposon inset (AK3255) of pagA carries out the linksystem analysis to 13 new pag seats of differentiating.Discovery has three pag ∷ TnphoA insets and AK3140 linked, and they are on karyomit(e) in the zone near the 24-25 karyomit(e) small pieces (minute) of pagC.With them called after pagD, pagE and pagF.As the description of front to pagC, pagD ∷ TnphoA transposon inset same and AK3233 (83%) and AK3140 (33%) is linked.The TnphoA inset of this bacterial strain has been done further qualification, it carries out inequality transcribing fully from pagC.PagE and pagF and AK3233 and AK3140 chain demonstrates inequality with pagC and pagD, means to have significantly different chromosomal localization.This pagE ∷ TnphoA inset and AK3233 transposon inset have 39% linksystem, and has 99.1% linksystem with AK3140 transposon inset, but the linksystem of pagF ∷ TnphoA and AK3140 inset is 31%, and does not have linksystem with AK3233.The physical map of the linkage relationship that these are different and TnphoA inset 5 ' side restriction endonuclease sites shows that they are new pag seats.Therefore, find three new pag seats in 25 karyomit(e) small regions, one of them is highly chain with previously defined pagC.

Be defined as Tn10 at random with one group then _Δ16 _Δ17 inset carries out the linksystem analysis in 10 bacterial strains of the TnphoA inset that has position the unknown.In these 10 pag ∷ TnphoA allelotrope, only two are proved with Tn10 Δ 16 Δs 17 inset storehouses linked.Confirm that pagG ∷ TnphoA inset has 97% linksystem with the AK3258 transposon inset that is positioned about 30 karyomit(e) small pieces places.The pag ∷ TnphoA inset of this called after pagH demonstrates 23% linksystem with the AK3091 inset.Be similar to the linksystem to prgE (26%) that confirms previously with the linksystem of AK3091 transposon inset.Therefore, this chromosomal region had not only contained and is subjected to phoP activated gene but also contains the gene that checked by phoP.Utilization is carried out the pulsed gradient electrophoresis from the chromosomal DNA that the AK3091 with restriction endonuclease XbaI and BlnI digestion obtains, to this Tn10 _Δ16 _Δ17 insets are analyzed.These data show that the transposon inset of AK3091 is positioned in the 20-25 karyomit(e) small region, and pagH and prgE be positioned chromosomal should the zone in.

The bacterial strain that has a pag ∷ TnphoA inset has the wild-type susceptibility to rabbit NP-1 defensin

In the phoP operon, have of the susceptibility enhancing of the Salmonella typhimurium of null mutation to various cationic antibacterial peptides (comprising defensin, Xenopus laevis antibiotic, and protamine).Defensin is the gang's mammalian-derived peptides that exists in the paneth of neutrophilic granulocyte, pulmonary macrophage and intestines (Paneth) cell.The resistance of these peptides is given bacterium toxicity and migrated ability in mucomembranous surface.The bacterial strain that has pag ∷ TnphoA inset is detected, observe its susceptibility highly active rabbit defensin NP-1.The susceptibility that the bacterial strain none bacterial strain that has a single pag ∷ TnphoA inset demonstrates the NP-1 defensin strengthens (referring to Fig. 6).Therefore, be responsive although the phoP null mutation demonstrates rabbit defensin NP-1, it is unqualified that to go out in the pag seat which sudden change relevant with defensin susceptibility.

Four bacterial strains that have pag ∷ TnphoA inset demonstrate sodoku power are obviously lowered

In order to explain further whether these new pag seats work to sodoku power, and examination has 13 bacterial strains of pag transposon inset in vivo.With about 100 bacterium peritoneal injections in mouse.At pagD, pagJ, four bacterial strains that have the transposon inset among pagK and the pagM demonstrate virulence and lower.Mouse with these bacterial strain injections all survives, and does not show the sign of systemic infection, for example hepatosplenomegaly and nape illness (because fever causes perpendicular hair).In these four kinds of bacterial strain peritoneal injections of multiple dosage 10 mouse altogether in twice test, further detect its virulence.Measure its average LD ₅₀Value is listed in the table 14.Bacterial strain that contains pagD ∷ TnphoA inset in these bacterial strains has the LD bigger 10,000 times than wild-type mice salmonella typhi ₅₀Other three bacterial strains also significantly reduce its LD to the virulence of mouse ₅₀Value than the big 1000-10000 of wild type strain doubly.These data show, when the seat that regulated by phoP, when pagD, pagJ, pagK and pagM undergo mutation, cause bacterial virulence to reduce.

The pag ∷ TnphoA bacterial strain that sodoku power is lowered has reduced the viability in the left scavenger cell

Because phoP sudden change Salmonellas can not survive in scavenger cell, and the bacterial strain that contains the pag transgenation that sodoku power is lowered is detected, observe its viability in scavenger cell and reduce situation.As shown in table 14, have the viability that all bacterial strains of pag sudden change demonstrate in scavenger cell and obviously reduce.The active reduction of born of the same parents' internal memory of pag mutant obtains just observing when express on maximum ground until the pag that estimates.

Discovery has sudden change in pagC, pagD, pagK, pagJ and pagM seat four bacterial strains are lowered virulence of mouse and the viability in scavenger cell.The virulence that has the bacterial strain of sudden change in these 5 pag all has reduction in various degree.Virulence and the observed situation in the pagC mutant of its forfeiture of bacterial strain that has sudden change in pagJ is quite (than the LD of wild-type bacterium ₅₀Big 1000 times).The insertion of pagD ∷ TnphoA makes virulence obtain maximum the attenuating, and is suitable with the phoP null mutation (than the LD of wild-type bacterium ₅₀Big 10000 times).The degree that pagK and pagM mutant virulence lower occupy in the middle of pagJ and the pagD mutant.If addition, and to have the TnphoA inset after observed attenuation similar, pagC then, pagD, pagJ, the observed effect of the comparable independent disappearance phoP of accumulative effect of pagK and pagM disappearance is much bigger.Have in these genes and manyly express in stationary phase when having phoP, this phenomenon shows, functional pag protein can produce in body under the phoP situation not having.A virulent gene pagM does not express when having phoP in large quantities, although for still needing phoP/phoQ to induce in the macrophage phagocytic body.These data mean that the disappearance of pag gene product can cause producing than regulating the bigger attenuation of protein delation.

The Salmonellas envelope protein is as virulence factor: defensin susceptibility

Based on the method for differentiating pag seat (promptly with phoA merges translate gene), and the pagC gene fusion produces this phenomenon of AP, found many pag coding bacterium envelope proteins now.Also do not find to have the bacterial strain that to give the single pag sudden change of defensin or other cationic peptide susceptibility.This data mean by phoP/phoQ mediation, in the complete aggregate of envelope protein is synthetic, change and the variation of the bacterium coating that causes may be vital to the Salmonella typhimurium virulence.

Defensin is that length is about 30-35 amino acid whose amphiphilic cationic peptide, and its anti-microbial effect comprises and penetrates and smash film, can be by formed the chosen anion passage on film.Although defensin finds in neutrophilic granulocyte and Paneth cell that mainly these or other associated molecule may work to non-oxidizable the killing of engulfing bacterium that scavenger cell has.Although still may exist a kind of a kind of protein of single U/I pag coding to be responsible for, as if more may be that the expression cumulative function of the envelope protein of several pag codings causes it to defensin tool resistance to the defensin resistance.The collective of various bacteria envelope protein changes may change membrane charge, electromotive force or lipid levels, thus may change the interaction of defensin and bacterial film.

Discriminating with the chain transcription unit of pagC

In order to differentiate the gene of pagC upstream, carry out mutagenesis with transposon MudJ and TnphoA to carrying the intestinal bacteria (table 15 and Fig. 7) that contain the pWPL17 plasmid that is positioned at pagC 5 ' side 2.8Kb DNA, and differentiate the bacterial strain that has AP or betagalactosidase activity with chromogenic substrate.In addition, as differentiating that other are subjected to the part of the experiment of phoP activated gene, Salmonellas karyomit(e) is carried out random mutagenesis, and examination has the active bacterial strain of AP, the Tn10 of observation TnphoA inset and AK 3233 bacterial strains with TnphoA _Δ16 _Δ17 chain, the linksystem of it and pagC is 75%.Identified several bacterial strains, they contain plasmid, and these plasmids have active MudJ of generation or TnphoA gene Fusion.In addition, identified two bacterial strains, they contain the inset with the closely linked active coloring body of pagC TnphoA.Making has the physical map in the restriction endonuclease site around the transposon inset in the bacterial strain of active plasmid or karyomit(e) LacZ and phoA gene fusion, so that measure the mutual relationship of transposon inset and pagC.This test-results shows that several districts of this DNA are transcribed (Fig. 7) with the direction opposite with respect to pagC.Identified the TnphoA inset of several active phoA genetic fusants.These data show, genes encoding film or the secretory protein chain with pagC.

Genes encoding four kind new protein chain with pagC

In order further to analyze the gene that limits by the transposon inset, measure this regional dna sequence dna (Fig. 8).To contain this regional DNA clones; And the 4Kb DNA between the ClaI site of the HpaI site of pagC upstream from start codon 737bp to upstream more checked order.Also measured the dna sequence dna of the fusion joint of all TnphoA and MudJ gene fusion.Based on these data, determined the proper reading frame of each gene.Based on the data that is obtained from TnphoA and MudJ inset, this dna sequence dna data has shown four ORF that transcribed and translate that infer.All ORF demonstrate apart from the typical ribosome bind site of 6-11 the base in rotaring intertranslating start site of inferring.Be right after the translating and show of ORF of pagC, pagD upstream, its one 87 amino acid whose short envelope protein (undressed) of having encoded with pagC, opposite the transcribing of pagD direction.Follow hard on second ORF (envE), its one 178 amino acid whose envelope protein (undressed) of encoding thereafter.A structure is followed in this ORF back, and this structure has the effect (referring to Fig. 8) of the transcription terminator that does not rely on Rho.The 3rd ORF, size of msgA (scavenger cell survival genes) coding is similar to the small protein of first gene product (79 amino acid), and also follow a structure thereafter, this structure also has the function (referring to Fig. 8) of the transcription terminator that does not rely on Rho.This dna sequence dna indication, this protein is made up of several charged residues, and has many electronegative amino acid at C-terminal.The protein of this prediction does not contain the structure that is similar to signal sequence in its N-terminal or any hydrophobic extending arm; Therefore, the 3rd ORF can not the encoded packets membranin.Last ORF (envF) 278 amino acid whose envelope proteins (undressed) of encoding.Known protein matter primitive is carried out the computer search result show that EnvF contains a total prokaryotic cell prokaryocyte film lipoid adsorption site, and therefore may be a kind of lipoprotein (referring to the position in the total site of Fig. 8).

The protein of inferring that is produced by pagD, envE and envF contains a typical bacterium signal sequence structure.In addition, hydrophobic situation confirms these proteinic N-terminal tool hydrophobic propertys.EnvE and EnvF albumen also contain hydrophobic extending arm, and it has the function of film area.At the G+C of this regional gene content be: pagC, 43.4%; PagD, 42.1%; EnvE, 45.9%; MsgA, 46.8%; And envF, 40.5%, its content is significantly less than the average G+C content (52%) of Salmonella typhimurium.Predetermined protein sequence to these four ORF is retrieved in database comprehensively, and the result shows there is not remarkable similarity.Select the bacterial strain that contains three different TnphoA insets and a MudJ inset and make further CHARACTERISTICS IDENTIFICATION, wherein these insets respectively are positioned on one of four genes.

The pagD gene of transcribing with the pagC reverse direction is subjected to the just adjusting of phoP/phoQ

Whether inspection has the typical strain of transposon inset, exist following the synthetic of gene of transcribing with the pagC reverse direction to increase to be evaluated at phoP.Regulated by phoP in order accurately to measure these genes, in the Salmonellas karyomit(e) of the plasmid inset must being recombinated.After will containing the gene substitution wild type gene of transposon inset, will transduceing into from the P22HTint lysate of these bacterial strain preparations, phoP lacks (phoP ^-) bacterial strain in, and monitoring AP or beta-galactosidase enzymes level.One of gene fusion that transposon produces has shown at phoP ^-And activity significantly improves between the wild-type background, and other insets show the adjusting (table 16) that is not subjected to phoP.This pagD seat and pagC are adjacent, and carry out different types of transcribing from pagC.

Typical transposon inset in envF can not be recombinated in the karyomit(e), and this may be because the amount of the homologous dna in this transposon downstream is sufficient inadequately.For the possibility of checking that the envF gene is regulated by phoP, with regional cloning of phoA gene that passes and comprise the TnphoA transposon of this upstream region of gene, it is as the EcoRV-SalI site of a 3-Kb PvuI (concordant end)-XhoI fragment cloning to suicide vector pGP704.Should clone mating in Salmonellas CS019 bacterial strain, and the recombinant chou (forming a called after envF ∷ pGPP2 bacterial strain) of screening tool amicillin resistance.Transduce phoP105 ∷ Tnlod-Tet sudden change in this bacterial strain and formed one and only producing genosomes such as different aspect the functional phoP protein ability.Shown in table 16, the importing of phoP105 ∷ Tnlod-Tet does not influence the AP level of these two bacterial strains, confirms that envF is subjected to phoP activated gene.

Inserting transposon in the chain gene of pagC has lowered virulence and has caused the viability in scavenger cell to descend

Improved the LD of Salmonella typhimurium significantly owing in pagC, insert transposon to BALB/c mouse ₅₀, thereby assess containing with the bacterial strain of the linked transposon inset of pagC, detect its attenuating situation to sodoku power.As shown in Figure 7, the transposon inset among the envE is to the not influence of bacterial strain virulence, and with wild-type bacterium (LD ₅₀＜20 bacteriums) compare, the MudJ insertion that the TnphoA in pagD inserts and downstream 1.8Kb is among the msgA makes the virulence of Salmonella typhimurium lower big 300 times.These data mean that these two seats are necessary for virulence.

For the viability of the bacterial strain of checking the virulence defective, the Salmonella typhimurium that will contain inset in pagD or msgA is used to infect the scavenger cell that obtains from marrow.Result displayed confirms in the table 15, and this two bacterial strain viability in scavenger cell reduces.(MSI=0.01) compares with the msgA inset, and the viability of pagD inset (MSI=0.002) is lower, and the reduction situation of two kinds of bacterial strains is equal to or greater than phoP ^-Bacterial strain (MSI=0.01).

Transposon in this gene inserts in the karyomit(e) of can not recombinating.Therefore, be necessary to confirm the virulence of msgA and in scavenger cell viability to reduce be not because MudJ inserts the polarity effect that envF is transcribed causes.Therefore, pGPP2 is recombinated in the msgA ∷ MudJ bacterial strain, and compare with the AP activity of the CS019 that contains the pGPP2 that recombinates the AP of this bacterial strain is active.This data (being shown in table 16) proves, the influence that the envF gene transcription is not inserted by msgA ∷ MudJ, and from himself promoter transcription.But under the varying environment condition, other promotors may be activated, and msgA and envF are placed same transcript.

The mensuration of msgA and pagD transcription initiation site

Check 5 ' zone of these genes, to limit the transcription initiation site of msgA and pagD.In primer extension analysis, use and 5 ' end of each ORF or upstream region complementary oligonucleotide mutually.This analytical results shows, the pagD transcript is that 39 bases from the transcripting start point upstream begin.Find that-10 (TTCCAT) and-35 (TTGAAT) zone inferred are similar with the known consensus sequence of escherichia coli promoter.Only at phoP ^cDetect the pagD transcript among the Salmonellas RNA, and at phoP ^-Do not detect among the Salmonellas RNA.The transcripting start point of finding msgA starts from 58 base places of upstream, rotaring intertranslating start place, and contains-10 (CAAAAC) and-35 (TTACGT) sequence of supposition.These zones are not quite identical with total-10 and-35 sequences; But, at phoP ^cAnd phoP ^-In the test of the primer extension of RNA, use various primers to be easy to detect the cDNA of this transcript, and it may produce a high abundance RNA.

The distribution of pagD and msgA gene in enterobacteriaceae and two kinds of G+C content bacteriums

The G+C content of pagC chromosomal region is more much lower than the average G+C content of Salmonellas.The gene (phoN) of the acid phosphatase that is subjected to the phoP adjusting of coding Salmonella typhimurium also has low G+C content (39%), and only finds to exist and phoN homologous DNA in two kinds low G+C bacteriums in the several genus that detected.By blot hybridization test, check several members of enterobacteriaceae and the DNA in two kinds low G+C bacteriums, observe the similarity of itself and pagD and msgA.The highly narrow spectrum PCR fragment of each ORF is carried out mark, and as probe.This analysis has confirmed to hybridize with the Salmonellas of all inspections and the height preciseness of bacillus ceylonensis A, shigella flexneri, klebsiella pneumoniae and Fu Lao Di Shi lemon bacillus.Do not see hybridization for rub Gen Shi morganella morganii or Si Tushi Providence of low G+C bacterium.See identical corssing form with the specific probe of two kinds of genes, show that these genes also are chain in the bacterium except that the sramana Salmonella.

In scavenger cell, survive a necessary virulence gene bunch of Salmonella typhimurium

PagC upstream region of gene that is in Salmonella typhimurium and four genes of transcribing have in the opposite direction been identified at present.Have exemplary signal sequence according to the active TnphoA inset that is separated at these places, seat and at each protein amino end, infer that three genes (pagD, envE and envF) are envelope proteins.There is not the remarkable homology of any protein tool in a kind of and the database in these four kinds of protein.

Only measuring the gene (pagD) that is right after and transcribes in the opposite direction in the pagC upstream regulated by phoP.Transposon inserts and has lowered virulence and the survival ability of this bacterium in mouse macrophage widely in this gene.Verifiedly when being positioned at the macrophage phagocytic body, Salmonellas induces transcribing of several pag (comprising pagC).In addition, after scavenger cell deutero-infection of cell line, the protein that is produced by Salmonellas is analyzed, shown that the pag product is induced generation, and pagC is in the high abundance gene product of inductive because scavenger cell infects.Because therefore living necessities pagD in scavenger cell may this gene transcription also will be induced in the macrophage phagocytic body.PagD protein is little (87 amino acid, undressed), and does not have the strong-hydrophobicity zone; Therefore, possible it be a kind of periplasm or secretory protein.

Having found in the msgA gene to insert transposon survives to sodoku power with in scavenger cell and exerts an influence.This may be that this gene also is an inductive in the macrophage phagocytic body of acidification, as other necessary genes of surviving in scavenger cell.If this gene is subjected to the scavenger cell environmental induction, its expression (and for necessary other genes of existence in scavenger cell) may be the regulation system control that is independent of the phoP/phoQ system.

The chain gene of these and pagC does not demonstrate and can form an operon.Because as if the gene none in pagD downstream is regulated by phoP, thereby they are not from the pagD promoter transcription.At the terminal potential transcription terminator that exists of envE gene msgA can not be recorded with the envE corotation.These data hint, msgA ∷ MudJ inset is not polar in envF, this shows that envF has its oneself promotor.In addition, behind msgA, there are a potential transcription terminator and territory, a 493bp intron to make these genes not recorded by corotation.The primer extension analysis of these genes confirms, all four kinds of genes all are from its oneself promoter transcription.

At other two genes that this zone is differentiated, envE and envF may produce membranin, and this membranin contains characteristic film area.According to the existence of total lipoid adsorption site, this envF gene product may be a lipoprotein, and may work to the Salmonellas virulence.

In the pagC zone, there is the gene of low G+C content, hints that they may be obtained by the level transmission.The Sou-thern engram analysis result who as probe low G+C bacterium is carried out with msgA or pagD gene shows there is not homology, but this can not eliminate such possibility, and promptly they obtain from another low G+C content bacterium.Also have such possibility, promptly these genes are present on the movability genetic constitution of other source acquisitions.MsgA and pagD probe in the same manner with enterobacteriaceae in other members except that the sramana Salmonella hybridize.But, shown that the pagC gene is exclusive in the salmonella strain.This shows that the product of pagC upstream gene and pagC do not form the effect that mixture or their function do not need pagC.Perhaps, owing to the protein with pagC tool homology is present in other enterobacteriaceaes (without any dna homology), thereby the pagC homologue may be linked with msgA and pagD in other kinds, and this situation is not detected by the DNA cross experiment.

PagC/pagD promoter region: the expression of heterologous protein

PagC and pagD are different that transcribe and be to be subjected to the phoP activated.Other difference gene that transcribe, that regulated is (people such as Beck known in the art, 1988, Microbid.Rev.52:318-326), klebsiella pneumoniae pulA-malX zone (people such as Chapon for example, 1985, J.Bacteriol.164:639-645).Great majority gene transcription so also need accessory protein, for example CAP except that needs are used to activate the regulon of transcribing.These two kinds of genes are that difference is transcribed, and the arrangement of their promotor is back-to-back.Between these gene transcription initiation sites, have a 134bp zone, this zone be to pagC and pagD between intergenic region similar.By inference, the pulA-malK promoter region contains two MalT (the adjusting albumen of this system) binding site, corresponds respectively to each gene.Other are subjected to MalT activated gene to need CAP albumen to express, but pulA and malX gene do not need, may be because MalT regulon partial concn height.Because the zone between the transcription initiation site (-35 sequences of supposition) of pagC and pagD only is 137bp (the 562-776 position Nucleotide of SEQID No:15), thereby may have only the phoP binding site to be present in intergenic region, and the combination of one or more phosphorylation phoP molecules is just regulated two genes.The available carrier that contains two heterologous proteins of pagC/pagD intergenic region construction expression of different promoters respectively is in a direction.

The prg gene

Just as discussed above, phoP/phoQ constitutive mutation (phoP ^cPhenotype) about 20 kinds of proteinic synthesizing of having improved the expression of pag and having checked gene (prg) coding that checked by phoP.PhoP ^cBacterium is to the reduction of sodoku power, and hint prg is a virulence gene.

By using the TnphoA transposon, 5 not chain prg seats have been identified.Usually, can activate the expression that culture condition (starvation) that pag expresses checks prg.Confirm a prg seat by oral and the test of intravenous injection approach, prgH works to sodoku power.Discovery is prgH and phoP when inducing epithelial endocytosis ^cThe sudden change Salmonella typhimurium is invalid.These virulence genes are differentiated and suddenly change in the vaccine development to be useful.

PrgH, prgI, the nucleotide sequence of prgJ and prgK gene

SEQ ID No:10 describes a segmental nucleotide sequence of 5100-bp Hind III, and this fragment contains high infectivity hil seat.Four ORF of four prg genes of coding are positioned in this DNA (referring to Fig. 9).Beneath line part is the ATG initiator codon, and prgH represented in asterisk, prgI, the position of prgJ and prgK terminator codon.These prg sites are bacterial invasion epithelial cells, keep complete sodoku power and transepithelial neutrophil migration necessary.To can be used for inoculation individual for the bacteriums of lowering virulence owing to these sites one or more undergo mutation, and makes it to resist the infection of wild-type pathogenic agent.

Bacterial strain, material and method

All bacterial isolateses that use in the prg gene is qualitative are listed in the table 5.

Table 5

14028s14028s ATCCCS002 phoP12 CS003ΔphoPΔpurB CS012 pagA1∷Mu dJ CS013 pagB1∷Mu dJ CS119 pagC1∷TnphoA phoN2 zxx∷6251 Tn10d-Cm CS015 phoP-102∷Tn10 d-Cm CS019 phoN2 zxx∷6251Tn10d-Cm CS022 pho-24 CS023 pho-24 phoN2 zxx∷6251Tn10d-Cm CS030 phoN2 zxx∷6251Tn10d-Cm phoP12 AD154 phoP12 purB1744∷Tn10 E.EisenstadtCS031 pho-24 purB1744∷Tn10 IB001 phoN2 zxx∷6251Tn10d-CmΔphoPΔpurB IB002prgA1∷TnphoACS030 IB003pho-24 purB1744∷Tn10IB002 IB004phoP12 purB1744∷Tn10IB002 IB005prgA1∷TnphoACS019 IB006prgA1∷TnphoACS015 IB007prgB1∷TnphoACS030 IB008pho-24 purB1744∷Tn10IB007 IP009phoP12 purB1744∷Tn10IB007 IB010prgB1∷TnphoACS019 IB011prgB1∷TnphoACS015 IB012prgB2∷TnphoACS030 IB013pho-24 purB1744∷Tn10IB012 IB014phoP12 purB1744∷Tn10IB012 IB015prgB2∷TnphoACS019 IB016prgB2∷TnphoACS015 IB017prgC1∷TnphoACS030 IB018pho-24 purB1744∷Tn10IB017 IB019phoP12 purB1744∷Tn10IB017 IB020prgC1∷TnphoACS019 IB021prgC1∷TnphoACS015 IB022prgE1∷TnphoACS030 IB023pho-24 purB1744∷Tn10IB022 IB024phoP12 purB1744∷Tn10IB022 IB025prgE1∷TnphoACS019 IB026prgE1∷TnphoACS015 IB027prgE2∷TnphoACS030 IB028pho-24 purB1744∷Tn10IB027 IB029phoP12 purB1744∷Tn10IB027 IB030prgE2∷TnphoACS019 IB031prgE2∷TnphoACS015 IB032prgE3∷TnphoACS030 IB033pho-24 purB1744∷Tn10IB032 IB034phoP12 purB1744∷Tn10IB032 IB035prgE3∷TnphoACS019 IB036prgE3∷TnphoACS015 IB037prgH1∷TnphoAIB001 IB038pho-24 purB1744∷Tn10IB037 IB039phoP12 purB1744∷Tn10IB037 IB040prgH1∷TnphoACS019 IB041prgH1∷TnphoACS015 IB042 Tn5B50-380 in IB040 IB043 pWKSH5 in IB040 IB044 pWKSH5 in CS022 CS032 oxiA1049∷Mu d1-8 supD10 CS033 oxiC1048∷Mu d1-8 supD10 CS034 oxiE4∷Mu d1ΔnadA100

Preserved material is contained the plasmid pRT291 (TnphoA) that stems from pRK290 by present JF897 oxiA1049 ∷ Mu dl-8 supD10 (2) JF896 oxiC1048 ∷ Mu dl-8 supD10 (2) JF739 oxiE4 ∷ Mu dl Δ hadA100 (2) the clinical wild type separated strain of Bacterium enteritidis CDC5 (45) SM7 Strr smb (45) the Escherichia coli SM10 (pRT291) of AK3011-AK3314 (19) TT520 srl-202 ∷ Tn10 (41) TT2979 srl-211 ∷ Tn5 (41) TN3061 zcf-845 ∷ Tn10 dcp-l zhg-1635 ∷ Tn10dCm (41) SH7782 ompD ∷ Tn5 (41) x4115 invA ∷ cat (13) EE517 Δ hil-517 (Tn5B50-380) C.Lee that Tn10 Δ 16 Δs 17 insert random separations are opened, by selecting Tc^rAnd Km ^r(49) MM294 (pPH1JI) contains Gm ^rPlasmid pPH1JI, its incompatible (49) W42 with pRK290 (pWKSH5) contains plasmid pWKSH5, the derivative of a kind of pSC101 (51), it contains hil V, and Bajaj and DNA comprise the 5.1Kb HindIII fragment C.Lee of prgH

Bacterium is cultivated by following condition: be used as rich medium with Luria-Bertani (LB) liquid nutrient medium.In growth medium or agar, use the antibiotic of following concentration: penbritin 100 μ g/ml (AP), paraxin 25 μ g/ml (Cm), gentamicin 30 μ g/ml (Gm), kantlex 45 μ g/ml (Km) and tsiklomitsin 25 μ g/ml (Tc).Utilizing final concentration on agar is that the chromogenic substrate 5-bromo-4-chloro-3-indoles phosphoric acid salt (right-the toluene amine salt) of 40 μ g/ml (XP) detects phosphatase activity.Be used as the active substrate of detection by quantitative AP with right-nitrophenyl phosphate (p-NPP).With the 1M Trisodium Citrate substratum is adjusted to various pH scopes.According to people such as Davis, 1980, Advanced Bacterial Genet-ics:A Manual for Genetic Engineering.Cold Spring HarborLaboratory, Cold Spring Harbor, the description of N.Y. prepares E substratum (Vog-el-Bonner minimum medium).According to people such as Kier, 1977, the no nitrogen of description preparation of J.Bacteriol.130:399 (being incorporated herein by reference), carbon-free and no phosphoric acid salt substratum (N ^-C ^-P ^-).In this hungry substratum, replenish 0.04% (weight/volume) glucose as carbon source, 10mM NH ₄Cl is as nitrogenous source, and 1mM NaH ₂PO ₄H ₂O) originate as phosphoric acid.Low 1 logarithmic value of concentration that carbon concentration is described than people such as Kier (seeing above).

With to pressing at different oxygen, the culture that obtains from single colony inoculation thing growth under 37 ℃ of vibrations or the nonoscillatory condition detects, and measures to be the AP activity of isogenic bacterial strain undergoing mutation in the phoP seat.At 37 ℃, has 80%N ₂, 10%O ₂And 10%CO ₂The anaerobic room of gaseous mixture (Coy Laboratories Products cultivates the anaerobism culture in Inc.).Regulate for acid, take out the logarithmic growth culture sample in mid-term, measure initial pH and AP activity.1M Trisodium Citrate (pH＞6.0) or 1M citric acid (pH4.7) are added in the culture of equivalent to final concentration be the 50mM citric acid.Culture at aerobic conditions, was grown 2 hours, and carried out pH pH-value determination pH and AP pH-value determination pH then for 37 ℃.Describe by the front and to measure AP activity (people such as Michaelis, 1983, J.Bacteriol.154:366-374 is incorporated herein for referencial use).Calculate AP unit according to following general formula: according to Miller to the definition of beta-galactosidase enzymes (people such as Miller, 1972, Experiments in Moleculargenetics, P.352-355.Cold spring Harbor Laboratory, ColdSpring Harbor, NY.) 1 unit={ OD ₄₂₀/ [time (minute) * volume * OD ₆₀₀] * 1000.

With standard bacterium genetic technique research prg seat.Finish phage P22HTint mediated by protein transduction according to method known in the art.Carry out TnphoA mutagenesis with dispensing TnphoA (people such as Taylor, 1989, J.Bacteriol.171:1870 is incorporated herein by reference) with wide spectrum host range plasmid (pRT291).Can discern the TnphoA among the Salmonellas DNA that transduces by using incompatible pPH1JI plasmid (people such as Tay-lor sees above).Utilize CS031, the allelic F+strain of pho-24 is finished being subjected to the examination of the gene that phoP checks.Can make up CS031 by carry out the hybridization of P22 phage transduction between AD154 and CS022 bacterial strain, AD154 and CS022 contain purB ∷ Tn10 allelotrope and pho-24 allelotrope respectively.The linksystem of pho-24 and purB ∷ Tn10 is 70%, and is similar to the allelic linksystem of other phoP to purB.Therefore, when at CS031 with contain and carry out P22 phage transduction when hybridization between the active bacterial strain of phoA gene fusion, can be according to the acquisition of tetracyclin resistance and examination to the active bacterial strain of forfeiture fusion rotein.Initial examination step is included in the bacterium colony of about 70% acquisition tetracyclin resistance and detects the active forfeiture of AP, because it is contained pho-24 allelotrope by hypothesis.In addition, utilize the AD154 bacterial strain in contrast, this bacterial strain contains the identical purB ∷ Tn10 allelotrope linked with phoP amorphs phoP12.Adopt CaCl ₂With the heat-shocked method (people such as Maclachlan, 1985, J.Bacteriol.161:442) plasmid DNA is transformed in the Salmonella typhimurium LB5010 bacterial strain.

In the gene that checked by phoP, have the separation of the bacterial strain of TnphoA insertion

Constitutive mutation (the phoP that the expression that causes pag that takes place on the phoP seat is increased not to be subjected to regulative mode ^cPhenotype) virulence of Salmonella typhimurium and the viability in scavenger cell have also significantly been weakened.PhoP ^cThe disappearance of bacterial strain virulence can be explained by the reduction that about 20 peptide species of the gene that checked by phoP (prg) coding are expressed.

Construct a phoP by between CS019 and CS003, carrying out P22 transduction hybridization ^-PhoN ^-Bacterial strain (IB001).Then with TnphoA to IB001 carry out mutagenesis (so that by the background acid phosphatase of phoN coding can not disturb since the change at phoP seat to the active mensuration of fusion rotein) and isolate 1800 on the LB agar plate of XP and have the active single blue colonies of phoA fusion rotein containing.These bacterium colonies are to carry out 18 independent mating with about 220 storehouses with independent form to obtain.Detect these bacterial strains owing to obtaining the fusion rotein activity (CS031) that pho-24 allelotrope reduces, such bacterial strain produces phoP ^cPhenotype.Then to except that the phoP site, analyzing for the AP of isogenic bacterial strain.

By preparing whole-cell protein matter extract and carrying out SDS-PAGE and analyze, verify the phoP of these bacterial strains ^cPhenotype.All have phoP ^cPhenotypic strains expressed goes out the phoP of expection ^cThe protein expression of bacterial strain particular form, promptly specific big or small kinds of protein checks.

Genetic fusant with the gene that checked by phoP identifies 8 bacterial strains.As shown in table 6, most of prg ∷ TnphoA fusion roteins synthetic is subjected to fully that pho-24 is allelic to be checked.The fusion rotein activity at two seats is checked fully, and other seats are only checked the display part.At phoP ^cThe observed expression after bacterium is by macrophage phagocytic of the expression ratio of pag is hanged down 5-10 doubly in the bacterial strain, and this is hinting that it is bigger that some prg seat is checked degree when pag is farthest activated in acid macrophage phagocytic body.

With phoP ^-The value that bacterial strain (table 7) is compared prgB-phoA syzygy in the bacterial strain that has wild-type phoP seat (table 7B) is lower, and expression phoP has checking of some degree when existing.

Table 6 allelotrope PhoP ^-Phop ^cChecked multiple prgA1 ∷ TnphoA 29 7 4prgB1 ∷ TnphoA 137 27 5prgB2 ∷ TnphoA 77 19 4prgC1 ∷ TnphoA 14 1 14prgE1 ∷ TnphoA 21 5 4prgE2 ∷ TnphoA 34 6 6prgE3 ∷ TnphoA 25 6 4prgH1 ∷ TnphoA 92 2 46 in table 6, the impact of phoP seat sudden change to prg-pho fusion activity compared. PhoP^-Represent that detected bacterial strain contains phoP12 allelotrope (CS030) and phop ^cShow that the bacterial strain of analyzing contains pho-24 allelotrope (CS031).This value is from culture calculating stationary phase.These numeric representations be the typical value under three different situations, tested and representative AP activity unit as hereinbefore defined.

The aerobic little aerobic-anaerobic IB010 prgB1 ∷ TnphoA 33 777 1521IB040 prgH1 ∷ TnphoA 142 85 41CS119 pagC1 ∷ TnphoA 431 173 81 table 7C bacterial strain allele pH4.5 pH7.0IB010 prgB1 ∷ TnphoA 332 26IB040 prgH1 ∷ TnphoA 8 18CS119 pagC1 ∷ TnphoA 145 27 of the hungry culture medium rich medium of table 7A bacterial strain allele IB010 prgB1 ∷ TnphoA 21 26IB040 prgB1 ∷ TnpnoA 7 181CS119 pagC1 ∷ TnpnoA 1,263 102 table 7B bacterial strain allele

Table 7 display environment condition is to the outer influence of regulating of prg seating body.Table 7A shows hungry influence to prg and pag expression.Hungry substratum (N ^-C ^-P ^-) (17) contain 0.04% glucose, 10mM NH ₄Cl, and 1mM NaH ₂PO ₄H ₂O.Measure the fusion rotein activity (OD of hungry cultivation after 48 hours in growth ₆₀₀)=0.5) and the fusion rotein activity that rich medium (LB) go up to be cultivated is measured (OD in the logarithmic growth later stage ₆₀₀=1.0) ^*All cultures are all in good oxygen condition growth.

Table 7B shows that oxygen presses being subjected to phoP to activate and be subjected to the influence of the genetic expression that phoP checks.After growth 24 hours, the expression (OD the during stationary phase that will on the aerobic condition rich medium, cultivate ₆₀₀＞1.4), littlely have a liking for oxygen condition (OD ₆₀₀=0.8) and contain 80%N ₂, 10%O ₂, and 10%CO ₂The strictly anaerobic condition under expression compare.

Table 7C shows the influence of pH value to the fusion rotein activity expression at prg and pag seat.To on the LB substratum that is buffered to different pH values with Trisodium Citrate, growing to contrast (OD in vegetative period ₆₀₀=0.5) culture detects its expression.All numerical value are represented AP defined above activity unit.

The chromosomal localization at prg ∷ TnphoA seat

Whether not chain prg ∷ TnphoA analyzed with the linksystem with bacterial strain that Tn10 Δ 16 Δs 17 that random interval opens insert so that measure its chromosomal localization and measure prg ∷ TnphoA allelotrope seat.Prg ∷ TnphoA inset is arranged in 5 different linkage groups.Three allelotrope, prgE1-3 ∷ TnphoA, has identical linksystem (26%) with Tn10 Δ 16 Δs 17 insets of AK3091, and other two allelotrope, prgB1-2 ∷ TnphoA, with AK3190 (94%), Tn10 Δ 16 Δs 17 insets of AK3249 (89%) and AK3186 (50%) chain similar.It is 37% chain that Tn10 Δ 16 Δs 17 insets of finding another allelotrope prgH1 ∷ TnphoA and AK3304 bacterial strain have.Two other Prg allelotrope and institute's test strain do not have linksystem.A part of utilizing TnphoA adopts Southern hybridization analysis method that the chromosomal DNA of these two bacterial strains is analyzed, and determines the rough physical map in the site that is close to the TnphoA inset as probe.These allelotrope, prgA and prgC have different restriction endonuclease sites around the TnphoA inset.In addition, in having the bacterial strain of pho-24 sudden change prgA and prgC fusion rotein activity to be checked degree also inequality; PrgC is checked fully, and prgA is only partly checked, and shows that these seats are different.Therefore, identified at phoP ^cFive not chain sites of the encoded packets membranin that is checked in the phenotype.

Although identified three the prg seats linked with the transposon inset, none has known figure spectral position in Tn10 Δ 16 Δs 17 insets.With XbaI restriction endonuclease digestion and pulsed-field gel electrophoresis (PFGE) to two in these transposon insets, AK3249 and AK3304, the physical map position analyze.Because Tn10 Δ 16 Δs 17 contain list-XbaI site, these Tn10 Δ 16 Δs 17 insets can be assigned in the specific XbaI fragment of known figure spectral position (people such as Liu, 1992, J.Bacteriol.174:16622).AK3249 is assigned to 28-32 karyomit(e) small pieces place, and AK3304 is assigned to the segmental arbitrary end of 58-78 karyomit(e) small pieces.Known mark thing in those zones is carried out further P22 transduction.Find Tn10 Δ 16 Δs, 17 insets of AK3249 bacterial strain and prgB1 ∷ Tn-phoA not linked with the Tn10 inset of TN3061 bacterial strain (with the chain of dcp be 10%), this TN3061 bacterial strain has the transposon inset at 28 karyomit(e) small pieces places, and is perhaps not chain at the ompD ∷ Tn5 at 32 karyomit(e) small pieces places inset with the SH7782 bacterial strain.Find the sr1202 ∷ Tn10 inset chain very faint (＜0.1%) at prgH1 ∷ TnphoA and TT520 bacterial strain 59 karyomit(e) small pieces places.These data show that prg is not chain on Salmonellas karyomit(e), and this is consistent with the function that phoP/phoQ has all regulon.

The strain storehouse of apparatus Tn10 Δ 16 Δs 17 insets (people such as Kukral, 1987, J.Ba-cteriol.169:1787 is incorporated herein by reference) carry out linkage analysis and be determined at the chromosomal localization that is subjected to TnphoA inset (prg ∷ TnphoA) in the gene that phoP-checks.The cell that will have the TnphoA inset is coated on the LB agar plate that contains 10 μ g/ml tsiklomitsins and 40 μ g/ml XP.The P22 lysate that to grow in the bacterial strain with Tn10 Δ 16 Δs 17 insets prints on the flat board with bull inoculator point then.After inoculation is spent the night, seek pearl opal and mix bacterium colony so that this dull and stereotyped linksystem to be discussed.By carrying out single transduction hybridization between the TnphoA inset bacterial strain and confirm chain existence and quantitative containing Tn10 Δ 16 Δs, 17 bacterial strains and contain to it.After the tetracyclin resistance of Tn10 Δ 16 Δs 17 codings is selected, the loss of bacterial strain blueness and the kalamycin resistance of TnhoA coding are classified.Find some TnphoA bacterial strain and to have localized Tn10 Δ 16 Δs of unknown collection of illustrative plates 17 bacterial strains linked.The physical map that carries out PFGE to analyze after utilizing the XbaI restriction endonuclease to digest and make two kinds of Tn10 Δs, 16 Δs, 17 insets.Based on this physical map, if desired, can adopt P22 phagocytosis strain transduction to measure the linksystem of other transposon insets.

According to Mekalanos, 1983, Cell 35:253 (being incorporated herein for referencial use) utilizes Proteinase K to substitute PRONASE A and prepares chromosomal DNA.Adopt the standard method plasmid DNA purification.Finish restriction endonuclease digestion according to manufacturer recommendation method (New England Biolabs).Adopt Southern method known in the art to transfer to that (New England Nucl-ear/Dupont, Boston MA) is used for blot hybridization on the Genescreen Plus film having carried out electrophoretic DNA on the sepharose.Adopt freezing-squeezing (freeze-squeeze) method (people such as Tautz, 1983, Anal.Biochem.132:14) from the sepharose the purify DNA probe and adopt the random primer method (people such as Feinberg, 1983, Anal.Biochem.132:6) with [ ³²P] dCTP carries out radio-labeling to it.

From TnphoA syzygy clone gene

Utilize the to encode gene of prgH of the method for hereinafter describing to clone.The pIB01 plasmid that contains the prgH gene is preserved in American type culture collection on July 9th, 1993, and (Rockville MD), and has received that the ATCC preserving number is ATCC 75496.Fig. 5 has shown the partial dna sequence (SEQ ID No:3) of prgH.Fig. 9 shows the location and the sequence of whole prgH gene.

Available method known in the art (people such as Beattie, 1990, that J.Bacteriol.172:6997) will describe herein is cloned by the gene of TnphoA inset identification.With Restriction Enzyme for example BamH1 the chromosomal DNA of each bacterial strain of containing prg ∷ TnphoA genetic fusant is digested, BamHI is in the single site cutting of TnphoA, keep merging connect, phoA sequence and neo gene.Equally, with same enzyme plasmid pUC19 is digested.To spend the night with plasmid DNA and be connected through the karyomit(e) of digestion at 15 ℃.And be transformed in the competence intestinal bacteria.Transformant is placed on the LB flat board that contains penbritin and kantlex, so that select the bla gene of pUC19 and the neo gene of TnphoA.Utilize the standard method of above describing, for example SEQUENASE then ^R(Unitid States Biochemical) test kit checks order to the chromosomal DNA that contains prg ∷ TnphoA genetic fusant.Will corresponding to the universal primer (United States Biochemical) of plasmid dna sequence or corresponding to the TnphoA primer of the 71-86 bit base of TnphoA (5 '-AATATCGCCCTGAGCA-3 ') (SEQ ID No:4) as primer.

In order to clone this wild type gene, can use the chromosomal dna fragment of TnphoA sequence both sides, and above-described method, the clay gene pool of examination wild type salmonella strains A TCC10428 is used to carry out the clone of wild-type pagC.

The environment at prq seat is regulated

Because phoP/phoQ is the regulon that environment is replied, detect the influence that different growth conditionss are expressed prg ∷ TnphoA.The growth velocity that has the bacterial strain of prg ∷ TnphoA inset under all conditions is equivalent to wild-type bacterium.When bacterium on abundant (LB) substratum during growth all prg seats be expressed in logarithmic growth late period for maximum.An example like this is in table 7A (rich medium and static growth) and table 7C (pH7.0 logarithmic phase) prgH ∷ TnphoA to be expressed the comparison of carrying out.Owing to (only reach maximum value OD one time at starvation ₆₀₀=0.5) expression at pag seat is a maximum value and during stationary growth phase, this express with pag and the mutual relationship of prg between expressing consistent.The expression at prg seat under the starvation further analyzed confirmed this mutual relationship (table 7A).(table 7A) checked in the expression of prgH under starvation, and other prg are subjected to the influence of minimum level, and this situation can induce pag to express just in time opposite (table 7A) in starvation with bacterium.

Because it has the effect of mediation bacterium endocytosis (BME), oxygen is pressed on the rich medium the influence of pag and prg expression also detected (table 7B).The adjusting of finding pag and prg seat when different oxygen are pressed growth is different but is not mutual adjusting.Although different oxygen depress when growth pagA and the pagB seat be subjected to influence minimum, when bacterium under oxygen free condition, grow with aerobic conditions under compare when growing, 5 times (showing 7B) are checked in the expression at pagC virulence seat approximately.Be also noted that the prg seat expresses the variation that takes place when replying the anaerobic growth conditions.The prgH seat is checked 3 times when no oxide growth, and another seat prgB is induced 50 times (table 7B) nearly under oxygen free condition.Make the variation minimum of other prg seats in expressing fusion protein in oxygen pressures different on the growth medium.

Low pH condition is expressed prg also has Different Effects (table 7C).Known, induce the active expression of pagC fusion rotein under the acidic conditions as the front.When bacterial growth to logarithmic growth during mid-term, in the substratum of low pH value, does not observe to induce significantly and check (showing 7C) relatively, and when bacterial exposure during in low pH condition, the expression of prgB is induced what prgH expressed.Therefore, the site of at utmost expressing under the varying environment condition can be by phoP ^cPhenotype checks.

According to people such as Foster, 1990, the method detection of acidic susceptibility of J.Bacteriol.172:771 (being incorporated herein by reference).In 37 ℃, grow aerobically is to OD in E substratum and 0.4% glucose with bacterium ₆₀₀Be 0.5.Nearly by adding 1M hydrochloric acid the pH value of bacterial cultures reduced to 3.3.Get a duplicate samples (t immediately ₀), remaining culture is further cultivated at 37 ℃, and at 40 minutes (t ₄₀) and 80 minutes (t ₈₀) time point carries out sampling afterwards.The pH value of culture remains on nearly 3.3.,, make serial dilutions then and carry out flat board and cultivate and observe colony-forming unit with the ordinary salt water washing and be suspended from wherein diluted sample 1: 10 with cold PBS.

PrgH is the virulence seat of Salmonella typhimurium

Because phoP ^cPhenotype cause virulence to lower and nearly suppressed 20 kinds proteinic synthetic, thereby the virulence of the bacterial strain of the single sudden change at prg seat detected (table 8).By with about 150 bacterium peritoneal injections in BALB/c mouse and the loss of the virulence of examination prg ∷ TnphoA inset bacterial strain.Also in contrast with wild-type bacterium.Compare with wild-type bacterium, the time course of observing the clinical disease progress with the prg mutant strain obviously prolongs.About 10-14 days the time, produced the clinical symptom of typhoid fever with the mouse of the bacterial strain peritoneal injection that contains prgH1 ∷ TnphoA inset, for example " nape " phenotype (fever and piloerection) and hepatosplenomegaly, and wild-type bacterium is about 24 hours., disease prolongs all mouse death at last although developing time course.The differentiation demonstration disease progression process similar with the disease of the mouse of other bacterial strains injection that contains prg ∷ TnphoA inset to wild-type bacterium.

Table 8 peritoneal injection LD50

14028s wild-type＜10

IB040 prg81 5.6×10 ¹

CS015 phoP-102 6.7×10 ⁵

IB041 prgH pnoP-102 1.2 * 10 ¹Oral vaccination

14028s wild-type 6.5 * 10 ⁴

IB040 prgBI 6.5×10 ⁵

Table 8 shows the influence of prgH1 ∷ TnphoA sudden change to Salmonellas sodoku power.Bacterial strain is isogenic and bacterial strain is administered to the BALB/c mouse in 35 day age by peritoneal injection and oral vaccination.In bracket, listed for each allelotrope near LD ₅₀Dilution of bacteria the time number of animals used.Replication LD under three different situations ₅₀

Further detect the LD of the bacterial strain that contains the prgH sudden change ₅₀Value.Measure the LD that the prgH mutant has ₅₀Be about 60 bacteriums, and the value of wild type strain＜10.Owing to when low dose, mouse is accurately used bacterium and have any problem, thereby be structured in the bacterial strain that prgH and phoP undergo mutation.With a kind of isogenic pho ^-Bacterial strain CS015 compares, prgH ^-PhoP ^-The LD of bacterial strain ₅₀Increased more than 10 times (table 8).The combined effect of two kinds of sudden changes has confirmed that further prgH1 ∷ TnphoA sudden change lowered the virulence of Salmonella typhimurium, and shows, is addition to two influential sudden changes of stage being subjected to the genetic expression that phoP/phoQ regulates to the influence of virulence.When using with oral route, also the virulence to bacterial strain with prgH1 ∷ TnphoA inset detects.Observe virulence and reduced by 10 times of (LD ₅₀Increase) (table 8).

With the test of being at war with property of wild-type bacterium, the efficient of bacterial strain when passing through the mucous membrane barrier layer with prgH1 ∷ TnphoA inset is done further to analyze.During 72 hours of carrying out with mutant bacterial that oral vaccination begins, compare with corresponding controlled trial, from the blood of mouse, be not recovered to prgH1 ∷ TnphoA mutant, in described controlled trial, from the blood of the mouse of wild-type bacterium inoculation as being separated to bacterium usually.Also the virulence deletion to the bacterial strain with prg sudden change of administered by oral route detects, and does not have significant change but observe virulence.

As described below sodoku power is studied.Under aerobic conditions, 37 ℃ grow to stationary phase with bacterium, wash with LB, and are diluted in the common salt solution.From CharlesRiver Breeding Laboratories, (Wilmington MA) buys the female BALB/c mouse (16-18 gram) in 35 day age to Inc..With the inoculum size of 0.1-0.15ml with the bacteria samples peritoneal injection that dilutes in the salt solution.With one 2 inches long, the oral entry needle of feeding (the Harvard Apparatus of 18 bore stainless steel animals, Inc., South Natick, MA) bacterium is given fasting 2 hours and uses 2-bromo-2-chloro-1 so that 0.5ml group ball form is Orally administered, 1, the mouse of the gentle anesthesia of 1-Halothane (Halothane).Quantitatively measure the bacterial count of using by placing calculating cfu/ml number on the LB agar plate.Adopt standard method (Reed and Muench, 1938, Amer.J.Hygiene 27:493) to measure the 50% lethal quantity (LD of mouse ₅₀) value.Repeat to survey LD ₅₀Be worth three times.By as mentioned above that bacterium is Orally administered to being at war with property detection after the mouse.Get from tail in the time of 1-4 days that the 50 μ l blood that puncture in blood or the heart are dull and stereotyped immediately to be cultivated and estimate microbemia after 37 ℃ of overnight growth of LB liquid nutrient medium.Took out spleen and intestines at 1-6 days, and with these organs homogenization in the 0.9%NaCl of 3ml.Sample is carried out serial dilution and dull and stereotyped the cultivation.The characteristic growth of carrying out according on Hektoen-enteric agar (Difco Laboratories) (black bacterium colony) and organize (antigen 4 with Salmonellas rabbit anteserum B, 5,12) (Fisher Scientific) carries out the visual slide agglutination test of naked eyes and Salmonella typhimurium verified.

In oxygen inductive gene, undergo mutation and do not influence sodoku power

Proved that prgH and pagC seat are not had that oxide growth checks and are that enough virulence are needed, hinted that therefore the change from the anaerobic to the aerobic conditions has as the effect of inducing the resultant signal of virulence gene.Be structured in the bacterial strain of undergoing mutation at oxygen inducibility seat (people such as Aliaba-di, 1986, J.Bacteriol.165:780).Prepared ATCC14028s derivative (being called as CS032, CS033, CS034 respectively) with oxiA, oxiC and oxiE sudden change.The virulence of these bacterial strains is identical with wild-type bacterium.Although these fusion genes still have the feature of the operon that contains virulence gene, these sites of these data suggest are not essential for complete virulence, always and the oxygen inducing action be not associated with the virulence function.

The prgH mutant has normal existence power in scavenger cell

Because phoP ^cPhenotype causes bacterial viability shortcoming in the scavenger cell, and influence detects to prgH encoded protein matter synthetic to this sudden change.To bacterial strain with prgH1 ∷ TnphoA inset in the scavenger cell that obtains by BALB/c mouse marrow and in a kind of scavenger cell deutero-clone J774.2 cell viability measure.Do not observe the disappearance of viability in the born of the same parents.Also the bacterial strain with prgB1 ∷ TnphoA inset is detected and does not find that viability is impaired in scavenger cell.

According to Buchmeier al., 1989, the description of Infect.Immun.57:1 (being incorporated herein for referencial use) detects bacterium viability in scavenger cell.The bacterium that will grow to stationary phase in common mouse serum was nursed one's health 30 minutes, placed the medullary cell deutero-scavenger cell culture of collecting from BALB/c mouse then.After infecting one hour, add gentamicin 10 μ g/ml so that kill the extracellular bacterium.All detect three times at all time points (1,4 and 24 hour), and repeat three experiments.

Collect the bone marrow macrophage culture from the BALB/c mouse that Charles River Breeding Laboratories buys.The J774.2 scavenger cell is incubated in the Dulbecco ' s MEM (DMEM/10%FBS) that has added 10% foetal calf serum.

Prg ∷ TnphoA inset does not suppress the phenotype of phoP mutant

After adding prg ∷ TnphoA sudden change,, comprise that the inhibition that defensin and sensitivity to acid and sodoku power weaken measures to several phenotypes of phoP mutant.In order to detect the phoP sudden change to suppressing prg product synthetic ability, making up except that prg ∷ TnphoA sudden change is isogenic phoP mutant strain, and detects sodoku power, and this inhibition comprises virulence attenuation of, or acid and defensin susceptibility are reduced.Prg ∷ TnphoA inset is to phoP ^-Bacterial poison sex expression type is influence not.These results show that the prg ∷ TnphoA sudden change that is detected does not have restraining effect to the invalid phenotype of phoP as single sudden change.

PrgH and phoP ^cMutant has lacked the epithelial endocytosis of the cultivation of bacteria mediated

To prg ∷ TnphoA and phoP ^cThe BME of salmonella typhimurium strain detects.Following result (this paper description) hint prg gene may participate in the eukaryotic picked-up by bacteria mediated: prove that prgH1 ∷ TnphoA is positioned 59 of bacterial chromosome ' locate, at this site necessary other genes of intrusion of having trooped; Begin after oral 72 hours, the prgH sudden change did not just arrive the ability that is at war with in the mouse blood with wild-type bacterium; And under the anaerobic growth conditions, a Prg site, the expression of prgB is induced consumingly.Have prgH and compare with wild-type bacterium with the bacterial strain of pho-24 sudden change, it is induced by the ability of the epithelial picked-up of Madin-Darby canine tooth kidney (MDCK) polar and significantly reduces (p-value＜0.01).Other prg bacterial strains with TnphoA inset are not presented at damaged significantly (table 9) that epithelial BME aspect has statistical significance.According to using in the past relevant with the cell cfu/ml (table 9) of gentamicin and adopting fractographic mensuration, the adsorptivity of the bacterial strain of disappearance BME is not subjected to the influence of prgH ∷ TnphoA inset.

For the picked-up effect to bacterium of the adhesivity of analyzing bacterium and epithelial cell, at 37 ℃, not growing to final concentration under vibration (little aerobic) condition is about 2 * 10 with bacterial isolates ⁸Individual colony-forming unit (cfu/ml).With 10 ⁵The amount in mdck cell/hole is incubated on the 24-porous organization culture plate and analyzes.There is not the DMEM/10%FBS of antibiotic; 5%CO ₂Under/95% air ambient, 37C spends the night cell cultures, merges until＞80%.Scheme (1990, Proc.Natl.Acad.Sci.USA 87:4304 is incorporated herein by reference) according to Lee and Falkow detects invading property of adhesivity suction.

Table 9 strain gene type adhesivity is invaded 14028s wild-type 4.2% 3.8%SM7 Str ^rsmb --- 0.6％*CS119 pagC1∷TnphoA --- 1.9％IB005 prgA1∷TnphoA --- 7.6％IB010 prgB1∷TnphoA --- 2.9％IB020 prgC1∷TnphoA --- 1.5％IB025 prgE1∷TnphoA --- 1.9％IB040 prgH1∷TnphoA 5.7％ 0.1％*CS022 pho-24 1.9％ 0.06％*IB043 pWKSH5 in IB040 --- 17.5％*IB044 pWKSH5 in CS022 --- 0.09％*

Table 9 has shown the influence of prg ∷ TnphoA inset to the epithelial endocytosis of MDCK of salmonella-mediating.Assess its adhesivity of bacterial isolates and the invasive variation of little oxide growth.The adhesivity of measuring be centrifugal after and stick to bacterial count on the cell/the join percentage ratio of total plate count in each hole after 30 minutes 4 ℃ of insulations.The invasion of measuring is for cultivating the bacterium of invading after 2 hours/the join percentage ratio of total plate count in each hole with gentamicin.With regard to adsorptivity and intrusion frequency, wild-type mice salmonella typhi and wild-type Salmonella enteritidis CDC5 bacterial strain do not have difference.Asterisk ( ^*) representative compares with wild-type when carrying out variance analysis three invasive data that repeat to obtain, and said significance (p-value＜0.01) from statistics.

With PBS the MDCK individual layer that converges is washed three times, the cold DMEM/10%FBS with 0.9ml is added in each hole then.Washing bacterium and being resuspended among isopyknic DMEM/10%FBS in LB.Every Kong Zhongyue adds 5 * 10 ⁷Individual bacterium.Flat board was rotated 10 minutes with 500rpm at 4 ℃, cultivated 30 minutes at 4 ℃ then.By with phosphate buffered (PBS) with flat board washing three times, with epithelial cell cracking and place to cultivate on the LB agar plate to calculate cfu/ml and be recovered to and adhere to bacterium in the 1%Triton-X-100/PBS of 0.5ml.To on cover glass, being dyeed with 1 μ g/ml, 4 ' 6-diamidino-2-phenylindone (DAPI) of grow overnight also assess in 7 minutes the morphology of adsorptivity by the epithelial cell individual layer of infectation of bacteria.Use Leitz Laborlux 12 microscopes that the painted cover glass of these DAPI is carried out fluorescence and the inspection of phase microscope art.

Describe as mentioned, after bacterium absorption, the endocytosis (BME) of intrusion or bacteria mediated is assessed.To contain bacterium and epithelial flat board in 37 ℃, cultivate 2 hours in the 5%CO2/95% air ambient.Given a baby a bath on the third day after its birth in each hole inferior with PBS to remove not and cell bonded bacterium.Add the DMEM/10%FBS that has replenished 10 μ g/ml gentamicins then, to kill the outer bacterium of born of the same parents.After cultivating 90 minutes, with PBS washed cell individual layer three times and add 0.5ml 1%TritonX-100/PBS and pressure-vaccum makes survival consumingly intracellular bacteria release.Be used as the contrast of BME with the clinical wild-type strain isolated of the invasive that lacks invasive Salmonella enteritidis mutant and Salmonella enteritidis.Calculate cfu/ml and the survival bacterium is carried out detection by quantitative by placing on the LB agar plate to cultivate.All detections are provided with three and repeat also triplicate at least.

Be used to make bacterium adsorptivity and invasion property to reach maximum value the MDCK epithelial cell that has gone down to posterity between 40-58 time.Epithelial cell is lain in DMEM/10%FBS and 1% penicillin/streptomycin solution, 37 ℃, 5%CO ₂Cultivate in the gas.

In order to analyze bacterium defensin susceptibility, according to means known in the art (people such as Selsted, 1985, J.Biol.Chem.260:4579; People such as Selsted, 1984, Infect.Immun.45:655) purifying NP-1 defensin from rabbit peritonaeum neutrophilic granulocyte.Usually, be dissolved in 10 in 0.5% Tryptones of 100 μ l volumes ⁵ Individual bacterium contacts 2 hours in 37 ℃ with 50-100 μ g defensin/ml.To be reflected among the 0.9%NaCl dilution and with reaction terminating.Suitable diluent is carried out flat board cultivate, so that measure the cfu/ml of survival bacterium.At least analyze twice for each bacterial strain, two repetitions are set at every turn.With susceptibility (phoP ^-) and resistance (wild-type) bacterial strain detect in contrast.

The prqH atlas analysis

Utilize the linksystem analysis that prgH is measured with respect to the position at other invasion seat at 59 karyomit(e) small pieces places.P22 transduction linkage analysis shows that Tn10 Δ 16 Δs 17 of AK3304 bacterial strain have similar linksystem to invA (40%) with prgH (37%); But invA does not link to each other with Sorbitol Powder.The transposon inset (99.6%) of finding prgH1 ∷ TnphoA inset and EE517 is chain, and the EE517 bacterial strain has the 8.5Kb fragment deletion adjacent with the Tn5B50-378 inset of hil.

Make the physical map (Fig. 4) in the restriction endonuclease site around the TnphoA inset of IB037 bacterial strain, the result shows, do not have similarity with the restriction endonuclease map in known invA-E zone.Then with the plasmid of the inv that contains the clone and hil DNA as probe, wild-type ATCC10428s and the chromosomal DNA that contains the IB040 bacterium of prgH1 ∷ TnphoA inset are carried out the Southern hybridization analysis.When containing plasmids with highly chain other of invA-E invasion seats (invH, invF and part invG) as probe, find that the corssing form between wild-type bacterium and the IB040 bacterial strain does not have difference, show the indefinite inv of being positioned at of prgH zone.But, when during as probe, proving that prgH1 ∷ TnphoA inset is positioned this zone with the plasmid in the 5 Kb zones of containing Tn5B50-380 inset downstream of hil.Known limitation collection of illustrative plates by adopting the Hil seat (people such as Lee, 1992, Proc.Natl.Acad.Sci.USA 89:1847) and the known limitation endonuclease site of TnphoA, further limit the mutual relationship (Fig. 4) of prgH1 ∷ TnphoA in this regional physical map and this zone.The orientation of prgH1 ∷ TnphoA inset makes the transcriptional orientation of phoA fusion rotein opposite with the direction of Tn5B50 inset, the Tn5B50 inset provides hil phenotype, and contain composing type Xin Meisu promotor, this promotor is transcribed (Fig. 4) outside transposon.Be positioned in the hil seat though find prgH, this gene is unique, transcribe in the opposite direction and with this hil seat in any other gene of identifying inequality, prgH is regulated by the phoP regulon.

Owing to express the expression that can may be changed prgH, make up and contain the bacterial strain of two kinds of insets and under the varying environment condition, compare prgH-phoA fusion rotein activity by a kind of protein that the Tn5B50-380 inset changes.When bacterium is in starvation or does not have oxide growth, observe the fusion rotein activity by derepression.Table 11 shows the influence of Tn5B50-380 inset to prgH fusion rotein activity expression.

Hungry LB (aerobic) LB (anaerobic) IB040 of table 11 bacterial strain allelotrope prgH1 ∷ TnphoA 5 142 41IB042 Tn5B50-380 46 248 227

prgH1∷TnphoA

These data confirm that opposite with the Xin Meisu promotor direction of Tn5B50-380 coding even prgH transcribes, the Tn5B50-380 inset has improved the prgH expression.Starvation (condition that checks of prg) is illustrated in and contains 0.04% glucose, 10mM NH ₄Cl and 1mMNaH ₃PO ₄H ₂Hungry substratum (the N of O ^-C ^-P ^-) went up the bacterium grow aerobically 48 hours.LB (aerobic) expression bacterium grows to logarithmic growth late period (the non-condition that checks) (OD on Luria-Bertani liquid nutrient medium (rich medium) ₆₀₀＞1.0).LB (anaerobic) the expression bacterium 24 hours (OD that under strict oxygen free condition, grow ₆₀₀=0.6).All numerical value are represented aforesaid AP activity unit.

In order to get rid of such possibility, promptly the BME of prgH mutant is damaged is the illusion that the phoA fusion rotein that produced causes, and carries out complementarity analysis with containing the segmental plasmid of 5.1KbHindIII (pWKSH5) that comprises hil and prgH seat.This plasmid and prgH (IB040) and phoP ^c(CS022) mutant bacterial is hybridized mutually, has produced IB043 and IB044 bacterial strain respectively.The BME phenotype of prgH mutant is similar with the wild-type with same plasmid inset.This plasmid can not complementary phoP ^cThe BME phenotype of mutant.These results show, because a kind of gene product that prgH ∷ TnphoA inset causes changing in synthetic is necessary to BME.

Utilization has can stimulate bacterial strain (the phenotype phoP of the environment activatory phoP/phoQ seat sudden change of pag in composing type ground ^c), define the site that checked by phoP of the uniqueness of five encoded packets membranins.The gene (prg) that discovery is checked by phoP is separated on karyomit(e) out and away, and the expression at prg seat is checked under starvation conditions, and at this moment (table 10) induced at the pag seat.

The hungry substratum rich medium of table 10 environment pag prg substratum O ₂Aerobic-pagC aerobic-prgH

Anaerobic-prgBpH 3.3-5.5 3.3-5.5-prgB

＞6.0-prgH mammalian cell scavenger cell epithelial cell

Proof prgH is providing between phenotypic two the Tn5B50 insets of hil.Owing to confirm that this regional deletion mutantion also has damaged BME; and the damaged available plasmid complementation that contains this seat of the BME of prgH mutant, thereby may, prgH1 ∷ Tn-phoA not cause a kind of protein of synthetic to promote BME (Fig. 4) owing to inserting.

With will be induced the expection of (similar) opposite to the necessary gene of hil phenotype under little oxygen condition to prgB, prgH reaches maximum value and causes the phenotypic Tn5B50-380 inset of hil to make prgH express derepression during grow aerobically.In addition, by the transcriptional orientation of prgH1 ∷ TnphoA inset indication and the transcriptional orientation opposite of the Xin Meisu promotor (relevant) of Tn5B50-380 coding with the hil phenotype, this means block by the Tn5B50-380 inset or transcribe thus a kind ofly regulate the expression that albumen has influenced prgH.

Based on following this phenomenon, a kind of plasmid pWKSH5 that promptly contains prgH (hil) does not remedy phoP ^cThe BME of bacterium, thereby may regulate by phoP/phoQ by other invasion gene.If prgH expresses from pWKSH5,, this means as phoP although have the pho-24 sudden change ^cOther gene pairss BME that the quilt of a phenotype part checks is essential.

To evaluation and qualitative the showing that prgH carries out, phop/phoQ regulates in the opposite direction that bacterium enters or the necessary factor in mammalian cell of surviving, and also shows the importance of generegulation to bacterial virulence.The regulating effect that the discriminating at prg seat be can be used for studying bacterial gene after mammalian cell-infecting.To the understanding of the regulating effect of virulence gene, for example prgH also can be used for lowering the virulence of pathogenetic bacteria, is used to develop new typhoid fever living vaccine.

The effect of prg gene pairs virulence

When using Salmonella typhimurium with oral and abdominal channels, find this prg seat, prgH works to sodoku power.Further find prgH and phoP ^cSudden change lacked bacteria mediated by the ability of epithelial picked-up, this means that lacking the ability pass through the epithelial cell barrier layer can have effect to the reduction of viewed virulence.Mouse after the oral absorption bacterium Journal of Sex Research that is at war with has been supported that further the prgH mutant lacks the transcytosis that passes the intestinal epithelial cells barrier layer.Therefore, defined necessary at least two protein expression stages that regulated by phoP/phoQ of bacterial virulence.In a stage, the expression of prg has promoted the epithelial endocytosis (table 10) of bacteria mediated, and in another stage, pag expresses the viability that has promoted in scavenger cell.

The general pathogenic bacteria, Salmonellas for example, the environment that runs into is more complicated and have more variability than mucous membrane pathogenic bacteria ran into.It is essential to the virulence in a certain stage of infectious cycle that pag and prg reach intermediateness.Corresponding to this notion be different oxygen press and the pH condition under during growth observed pag and prg expression do not have homogeneity.These data show that also the adjusting of not all pag and prg is mediated by phoP and phoQ directly.If phoP has the function as transcriptional regulatory, checking of prg seat may appear in the transcriptional level.

Employing has been found at least one virulence seat to the method that the gene that is subjected to pho-24 sudden change and checks limits, prgH, and this seat has been reduced the virulence of the bacterium that is used to make vaccine by mutagenesis.

The constitutive expression of two kinds of composition regulation systems weakens bacterial virulence

By inducing a kind of sudden change, this sudden change causes gene to carry out constitutive expression under two composition regulation system controls, and perhaps by inducing a kind of sudden change, this sudden change makes the gene inactivation that is under two composition regulation system controls, can lower bacterial virulence.Be between two genetic expressions that become sub-systems control, for example between pag and the prg genetic expression, and being subjected to two to become to reach between gene that sub-systems regulate and other genes balance be essential to virulence completely.Break this equilibrated and suddenly change, for example, cause that the gene that is under the control of two one-tenth sub-systems carries out the sudden change of constitutive expression, perhaps make the gene that is under the control of two one-tenth sub-system, for example the sudden change of pag gene inactivation has reduced virulence.

Contain a reporter gene by use and can differentiate constitutive mutation in pair composition regulon with being subjected to two bacterial strains that become the gene Fusion body that sub-system regulates.The most typical situation of such genetic fusant comprise coding lacZ gene or be subjected to two DNA that become the AP of a kind of gene fusion that sub-system controls.The color increase that produces according to the chromogenic substrate of enzyme can detect the bacterial strain that contains a kind of syzygy, and this syzygy is that the composing type ground level is expressed (comparing with wild-type or parent strain) in the mode of not regulated.In order to detect constitutive mutation, the virulence regulon of cloning is carried out mutagenesis, for example can be by in the coli strain that lacks the DNA repair ability, going down to posterity once or adopting chemical mutagenesis.Then the mutant DNA regulon is transferred in the bacterial strain of the constitutive mutation (being fused to blueness) that contains this fusion gene and identify for the lacz that on containing X-gal medium, grows according to the high expression level effect of fusion gene.Cause after the phenotypic a kind of specific amino acids of composing type changes other constitutive mutations being checked order and identify, also can adopt the constitutive mutation of a composition in the two composition regulation systems of external evoked method preparation.Arrange several phenotypic amino acid of phoP composing type that all produce to change the reverse mutation frequency reduction that can make by spontaneous base mutation.Accept the N-terminal part disappearance of regulon by the phosphorus that contains the phosphorus reception zone, it for example in the phoP gene sequence deletion of N-terminal to 119 amino acids coding, perhaps similar phosphorus receiving sequence disappearance in the gene in other pair composition regulation system also can make up constitutive mutation.This may cause being similar to phosphorylation inductive conformational change, and causes DNA combination and transcription activating to improve.

Virulence lowers: lack at the phoP/phoQ regulon

As discussed above, the phoP regulon is necessary to the complete virulence of Salmonellas.This regulon is by two the gene phoP and the phoQ that are positioned in the operon, and more than 40 genomic constitution being regulated (being respectively pag and prg) by their positive and negatives.

Study in typhoid fever BALB/c mouse model, the virulence that has confirmed the invalid Salmonella typhimurium mutant of phoP is significantly reduced and they also are effective vaccine bacterial strains.This phenotype may be a plurality of by the generation of phoP activatory virulence gene, can reduce the Salmonella typhimurium virulence because proved respectively in a plurality of different insertions that are subjected to transposon in the phoP activated gene.In mouse model, the virulence that has lacked the Salmonella typhimurium mutant (the invalid or aroC/aroD null mutant of aroA) to the necessary gene of die aromatischen Aminosaeuren is also obviously reduced.But, in human body, detect the aroC/aroD mutant and show, though these bacterial strains have immunogenicity, will be low to moderate 10 ⁵-10 ⁷Still found microbemia and side effect when the dosage of bacterium is used as the single oral amount, for example had a fever, (J.Clin.Invest.90:412-420).

Have been found that the all-round regulon of Salmonellas virulence now, for example big disappearance takes place and can significantly reduce the virulence of bacterium in the phoP/phoQ operon.In Salmonella typhimurium, at first prepare the sudden change of the DNA disappearance of 1Kb in the phoP/phoQ seat, be transferred in the salmonella typhi by homologous recombination subsequently.In order when making up this vaccine, to make it have bigger security, disappearance has taken place and carry in the bacterial strain of Histidine G46 sudden change and make a kind of sudden change at the gene essential to die aromatischen Aminosaeuren, this Histidine G46 sudden change makes the bacterium become histidine defect type bacterium.The bacterial strain salmonella typhi TyLH445 that obtains has several advantages than existing vaccine material standed for, and the most significant is not have instantaneous bacteremic immunogenicity.

Use

Salmonella cell of the present invention can be used as animal Mammals for example among the people for example, and resist the disease is the immunogenic of typhoid fever and relative disease for example, especially as can be in the intestines of inoculation animal breeding and excite the source of strong immunoreactive viable cell vaccine.A kind of so suitable application dosage and condition of vaccine of attenuation of work are known in the art, for example people's such as Hol-em description, Acute Enteric Infections in Children, NewProspeets for Treatment and Prevention (1981) Elsevier/Nor-th-Hlland biomedical Press, Ch.26, PP.443 et seq. (people such as Levine) is incorporated herein for referencial usely, and embodiment further describes below.

Advantage

An advantage of the invention is because the direct sudden change that influences the virulence pathways metabolism taken place, i.e. phoP/phoQ operon, the bacterial cell virulence is lowered.Another advantage be bacterial cell at two diverse attenuation genes, i.e. die aromatischen Aminosaeuren route of synthesis (Aro) and in the operon important (phoP/Q), sudden change has taken place to the Salmonellas virulence.As a result, bacterial virulence has been lowered widely; High to 1 * 10 ⁹The dosage of cfu is still fool proof.Other vaccines in development, for example CVD908 is being low to moderate 1 * 10 ⁷Cause many general symptoms during cfu dosage, for example fever or microbemia.

Except phoP/phoQ disappearance and AroA sudden change, bacterium of the present invention also contains the Histidine sudden change of further its virulence of change, though there is not the Histidine sudden change can improve immunogenicity.Bacterial cell of the present invention is up to the present the most promising candidate's vaccine, because the strong and safety of their immunity, promptly virulence reduces greatly.

Embodiment 1: the structure of vaccine bacterial strain

Bacterial cell of the present invention prepares by the about 1Kb DNA of disappearance in the phoP/phoQ regulon.

Utilize method known in the art to make up the suicide vector of phoP/phoQ disappearance.Utilize wild-type mice salmonella typhi chromosomal DNA as template, obtain to contain the dna fragmentation at phoP/phoQ seat by PCR.The PCR primer that is positioned at both sides, phoP/phoQ seat is carried out genetic engineering handle, make it to contain the end limit enzyme recognition site, the recognition site of EcoRI for example is with the clone of convenient back.After increasing, with EcoRI the PCR product is digested, and be cloned in the EcoRI site of high copy vector polylinker.To contain the segmental plasmid called after of phoP/phoQDNA pLH356.

The phoP/phoQ seat is carried out sequential analysis and restriction map analysis, and the result is presented at 4 HpaI sites in this seat; In this carrier, do not find the HpaI site.In order in the phoP/phoQ seat, to make inner disappearance, with HpaI pLH356 DNA to be cut fully, and reconnect, inner disappearance (pLH418) takes place from 376-1322 position Nucleotide in the product of generation.By this plasmid being carried out this disappearance of restrictive diges-tion susceptible of proof.

The SacI/SphI restriction site that utilization is arranged in the polylinker district of this carrier contains the dna fragmentation that inside lacks the phoP/phoQ seat from the pLH418 excision.With the corresponding site of this fragment cloning in the plasmid CVD442, this plasmid carries the sacB gene and selects so that the positive is carried out in reciprocity gene swapping.The suicide vector that obtains is called as pLH423.

PLH423 is transformed into intestinal bacteria λ pir SY327, and subsequent transformation is to intestinal bacteria λ pir SM10 (LH425 bacterial strain).Intestinal bacteria LH425 bacterial strain and Salmonella typhimurium CS019 bacterial strain are carried out mating.Choose the single reorganization part (LH428 bacterial strain) that carries the plasmid sequence that is incorporated into Salmonella typhimurium karyomit(e) by placing the agar upper flat plate that contains penbritin and paraxin to cultivate.Prove conclusively these bacterial strains and be the tool amicillin resistance and to the sucrose sensitivity, promptly mortality ratio is 20% when cultivating for 30 ℃ not containing on the 20% sucrose flat board of NaCl, these data acknowledgements plasmid sequence be incorporated on the karyomit(e) of Salmonellas.

Prepare P22 phage splitting liquid from bacterial strain LH428; By high speed centrifugation phage particle is concentrated 20 times, and the salmonella typhi 522Ty2 bacterial strain of transduceing (in the aroA gene, have disappearance, and the bacterial strain that has the G646 sudden change that makes bacterium become the histidine defect type).Replenished die aromatischen Aminosaeuren by placing, Gelucystine is cultivated on the LB flat board of Histidine and ammonia virtue penicillin and is selected single recombined bacterium typhosum bacterial strain (LH435 bacterial strain).

At die aromatischen Aminosaeuren, Gelucystine and Histidine exist and grow to logarithmic growth mid-term under (but not having penbritin) with the LH453 bacterial strain.Serial dilutions placed not to be had NaCl and has the LB of 20% sucrose dull and stereotyped and do not have to cultivate on the LB flat board of NaCl.At the bacterial count that does not have to grow on the flat board of sucrose than having replenished big three logarithmic value of the number of growing on the flat board of sucrose.These data mean that many bacterium colonies have lost the plasmid sequence that contains the sacB gene.

Select dull and stereotypedly to go up a plurality of bacterium colonies of picking from sucrose, and prove that it is to amp-S and to sucrose tool resistance.From about 10 bacterium colonies, be purified into chromosomal DNA, and utilize the 2.3Kb fragment of wild-type phoP/phoQ to carry out the Southern engram analysis as probe.

Southern engram analysis result shows, has lacked two HpaI sites and XmnI site of the 1Kb deletion fragment of the known phoP/phoQ of being positioned in several bacterial strains.One of these bacterial strains are named as TyLH445.

The external assessment of embodiment 2:TyLH445

External, utilize the clinical microbiology detection method of standard TyLH445 to be carried out fully qualitative.Nutritional need to TyLH445 is assessed.TyLH445 can not grow on the M-9 flat board, unless replenish the die aromatischen Aminosaeuren mixture, Gelucystine (the Salmonella typhimurium bacteria growing was better when Gelucystine was arranged) and Histidine.These data confirm that TyLH445 is AroA ^-, His ^-

Find the polyclonal serum and the antigenic polyclonal serum generation of the anti-salmonella typhi Vi agglutination reaction of TyLH445 and anti-salmonella.Finding that the D group agglutination is Protean, may be because the Vi antigen excess.Find that also TyLH445 is indoles feminine gender (as all Salmonellas), and produce very low hydrogen sulfide (as many salmonella typhis).Utilize VI-TEK system and BBL Crystal Enteric bacterium identification system to carry out biochemistry detection.These data show that the TyLH445 bacterial strain is a salmonella typhi.

Also the growth characteristics of TyLH445 are assessed.The speed of growth of finding TyLH445 is the same fast with its parental generation 522Ty2 (the phop/phoQ seat is complete).The detection of growth in vitro is to carry out in the Luia liquid nutrient medium of having replenished die aromatischen Aminosaeuren/Histidine/Gelucystine at 37 ℃.The growth curve of finding parent and vaccine bacterial strain comes down to identical (referring to Figure 10).

Utilize the clinical detection method of standard to measure antibiotics sensitivity.Find TyLH445 and parental strain 522Ty2 to penbritin, trimethoprim-sulfamethoxazole, Ciprofloxacin, glucosaminide, and third generation head saitomycin is responsive.Detected inhibition zone size (zone size) does not have difference between parental strain and vaccine bacterial strain, hinting other antibiotic resistance mechanism, the for example modification of antibiotic haulage system, perhaps the modification of bacteria cell wall is not subjected to import in the salmonella typhi influence at sudden change phoP/phoQ seat.

Detect phoP/pnoQ HpaI deletion mutant to defensin susceptibility, this is a kind of phoP null mutant phenotype.The defensin sensitivity Detection is carried out as follows.

Liquid culture grow overnight with bacterial strain to be detected.Then culture is carried out dilution in 1: 200, and grow to the close value of light (OD600) and be about 0.2, after this, cell dilution is about 1 * 10 to every 0.05ml ⁵The concentration of individual bacterium.

Carry out two reactions for each bacterial strain: (1) only has carrier (being dissolved in 0.01% acetate in the sterilized water) and (2) defensin NP-1 solution (being dissolved in 70 μ g/ml in 0.01% acetate).Add isopyknic be suspended from the Tryptones bacterium and with test tubes in shaking table 37 ℃ cultivated 2 hours.Each reaction tubes final volume is 0.1ml, makes the ultimate density of defensin reach 35 μ g/ml.

In bacterial growth media, LB liquid nutrient medium for example, the high salt and the high protein concentration of middle existence can make the defensin inactivation.Therefore, can stop the defensin activity by the Lur-ia liquid nutrient medium that in each pipe, adds 900 μ l.Serial dilutions in each test tube is carried out flat board cultivate, and measure control tube and each and handle cfu/ml in the pipe of bacterial strain.The result is with the log value representation of the bacterium that kills with respect to each bacterial strain.Usually, the wild-type bacterium of 1.0-1.5log is killed.The phoP null mutation generally shows 2-4.log and is killed.Because it is not too responsive to the defensin lethal effect to have the bacterial strain demonstration of slow growth velocity, detect the growth velocity of each bacterial strain that in the defensin sensitivity analysis, uses.The bacterial strain that will have similar growth velocity carries out defensin susceptibility relatively.

The disappearance of assessment HpaI in Salmonella typhimurium background and salmonella typhi background.In two kinds of backgrounds, deletion mutantion causes the rabbit defensin NP-1 tool susceptibility to 35 μ g/ml concentration.Referring to Figure 11 and Figure 13.In salmonella typhi at phoP ⁺And the difference between the phoP null mutant of HpaI disappearance is not too obvious.This effect has reflected the poor slightly slower growth velocity of comparing with the Salmonella typhimurium that lacks other auxotrophy of salmonella typhi of patience.

Utilize the LacZ that merges mutually with phoP activatory B gene (pagB) to write down gene (record-er gene), the phoP active state with bacterium that HpaI phoP/phoQ lacks is detected.Because with the transduction efficiency of P22 in salmonella typhi is low, thereby these researchs are carried out in Salmonella typhimurium rather than salmonella typhi.Discovery is in the presence of complete phoP/phoQ seat, the phoP activation is the (people such as Mi-ller of 40-60 Miller unit, 1972, Experiments in Molecular Genetics, ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y., PP.352-355), and in bacterial strain almost detect less than (3cfu is referring to Figure 12) with HpaI disappearance.

Assessment in the body of the Salmonella typhimurium of embodiment 3:HpaI disappearance

Because salmonella typhi is not the pathogenic bacteria of mouse, thereby at wild-type and aroA ^-In the Salmonella typhimurium to HpaI phoP/phoQ deletion mutantion assess.With mouse typhus door Salmonella LH430, a kind of wild-type mice salmonella typhi of carrying HpaI disappearance, various diluent peritoneal injections in female BALB/c mouse.Measure the LD of this bacterial strain ₅₀Be 8.2 * 10 ⁵With 8.2 * 10 ⁶Between.(all have received 8.2 * 10 ⁵The mouse of cfu all survives, and all receive 8.2 * 10 ⁶The mouse of cfu is all dead).These data and the LD that is used in the bacterial strain acquisition of having carried the transposon inset in the phoP/phoQ seat ₅₀Be worth consistent.

In a kind of Salmonella typhimurium aroA of the people's of being equivalent to vaccine bacterial strain ∷ tet (LH481), the immunogenicity of HpaI phoP/phoQ disappearance is assessed.With 2.3 * 10 of LH481 ⁵With 2.3 * 10 ⁶Cfu inoculates mouse (4 mouse of each vaccine dosage) from peritonaeum, and after 30 days with 30 times wild-type bacterium LD ₅₀Attack.Except that a mouse, all mouse all survive.The mouse that dies is in the group of having accepted low vaccine dosage.Accept the not morbidity of animal of higher vaccine dosage.

Embodiment 4: study with the I stage that human body carries out

It is 1 * 10 that single port is obeyed dosage ⁵To 1 * 10 ¹⁰The dosage of cfu is administered to people volunteer with the vaccine bacterial strain.Two volunteers respectively accept a kind of dosage; The dosage of 3 volunteers received is 1 * 10 ⁸Cfu/ml.Different time points is assessed the former person of will after using vaccine.

Security

In patient's blood, whether there to be the vaccine bacterium in order detecting, after taking

vaccine

4,6,8,10, to carry out the bacterioscopy blood cultivation in 12 days, a repetition is set.In arbitrary volunteer, all do not detect microbemia.

13 grownup's volunteers received the Typhoid Vaccine of this new attenuation that progressively increases of single oral dose.The none volunteer has produced the side reaction of any kind of.Particularly, fever does not have the stomach symptom, does not have the general symptom.After having accepted oral vaccine,, implement serial blood cultivation, after receiving vaccine 4 days to the volunteer according to the preset time table, 6 days, 8 days, carried out two groups of bacterioscopy blood cultivation in 10 days and 12 days, the result does not observe the positive blood cultivation of result.The volunteer paid a return visit visual examination in 2 months after receiving vaccine, not reporting does not have the later stage symptom.

Move and give birth to (colonization)

Utilize method known in the art to detect in the faecal samples whether have vaccine bacterial strain TyLH455.The vaccine bacterial strain that on culture plate, exists in the detection of primary ight soil.In some cases, be necessary by incubated overnight ight soil in having replenished the BBL Selenite F liquid nutrient medium of Aro/His/ Gelucystine with the vaccine bacterial strain enrichment in the faecal samples, so that detect bacterium.This substratum has restraining effect to intestinal bacteria but can promote Salmonella growth.

After having received vaccine, move time of being born among the volunteer during 1-6 days different time.For maximum dose level (10 ⁹Or 10 ¹⁰), the volunteer has positive plate culture for the first time in begin 1-3 days after inoculation, and when low dosage, only enrich liquid nutrient medium culture (selective medium that is used for selecting Salmonellas that suppresses other enterobacterias) vaccine bacterium at selenite and be positive.When paying a return visit in 2 months, have no talent among the volunteer who is studied and still carry the vaccine bacterium.

Table 17 dose quantity moves gives birth to (Colonization) 10 ⁵2 do not have 10 ⁶2 1-2 days interior 2/210 ⁷In 23 days 1/210 ⁸In 36 days 1/310 ⁹2/2 moves life in the time of 2 4-6 days, and the both had in the time of 1 day

The first dull and stereotyped cultivation 10 of male ^10**2/2 moves life in the time of 2 3-6 days, and the both was at the 1st day and

Have first dull and stereotyped cultivation of male in the time of 2 days ^*Measure by intact cell and LPS ELISA and with respect to the antigenic Widal of Hflagellar.In all detect with 1: 40 and more the highly diluted multiple serum is analyzed.

^*One of these volunteers have accepted 10 ¹⁰The booster dose of individual bacterium dosage is used 1 month the time after initial inoculation (not carrying out serological verification).

Immunogenicity

The elisa assay method of employing standard detects inducing the immunne response of vaccine bacterial strain.After having accepted the oral vaccine of single dose the 0th, 7,14,21 and 28 days, collect serum from the volunteer.(SIGMA, St.Louis MO) finish ELISA as antigen and detect with complete bacterium TyLH445 and salmonella typhi LPS.Serum when using the 0th day from each volunteer contrasts as inner female.Convalescent serum (great majority come from Mexico) with the patient that once infected the wild-type salmonella typhi is used as positive control.

The IgG antibody that adopts the ELISA method to resist complete vaccine bacterium or anti-salmonella typhi LPS detects, and found that seroconversion took place after receiving vaccine several volunteers in 21 days.Serum (epidemic disease is exempted from preceding serum) to the patient before the inoculation vaccine detects, and sets up a bottom line (base line) with these data.If the patients serum's that different time points is obtained after inoculation detected result then can be thought the positive than the big 0.2 ELISA OD unit of preimmune serum.

Other embodiments

Other embodiments, for example regulate the Salmonellas bacterial strain that only contains a sudden change in the seat and lower virulence at phoP/phoQ, and except that containing relevant sudden change of phoP or heredity variation, also at another gene, for example cya gene (adenylate cyclase) or crp gene (adenylate cyclase enzyme acceptor), in contain the bacterial strain of attenuation sudden change, all in this claim scope.

Sequence table

(1) aggregate data

(i) applicant: Miller, SamuelI.

Mekalanos，John?J.

(ii) denomination of invention: salmonella vaccines

(iii) sequence number: 15

(iv) mailing address

(A) addressee: Fish ﹠amp; Richardson

(B) street: 225 Franklin Street

(C) city: Boston

(D) state: Massachusetts

(E) country: U.S.A.

(F)ZIP：02110-2804

(V) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM PC compatibility

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#0.1, Version#1.25 and Word

Perfect(Version?5.1)

(Vi) present application materials:

(A) application number:

(B) applying date:

(C) classification number:

(Vii) Yi Qian application materials:

(A) application number: 08/090,526

(B) applying date: on July 9th, 1993

(Viii) lawyer/proxy's data:

(A) name: Clark, Paul T.

(B) registration number: 30,162

(C) reference/case number: 00786/220001

(ix) telecommunications data:

(A) phone: (617) 542-5070

(B) fax: (617) 542-8906

(C) fax: 200154

(2) recognition sequence numbering: 1 data:

(i) sequence signature:

(A) length: 2320

(B) type: nucleic acid

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: DNA (genome)

( xi ) ：SEQ ID NO：1：GTTAACCACT CTTAATAATA ATGGGTTTTA TAGCGAAATA CACTTTTTTA TCGCGTGTTC 60AATATTTGCG TTAGTTATTA TTTTTTTGGA ATGTAAATTc TCTCTAAACA CAGGTGATAT 120TTATGTTGGA ATTGTGGTGT TGATTCTATT CTTATAATAT AACAAGAAAT GTTGTAACTG 180ATAGATATAT TAAAAGATTA AATCGGAGGG GGAATAAAGC GTGCTAAGCA TCATCGTGAA 240TATGATTACA GCGCCTGCGA TGGCATATAA CCGTATTGCG GATGGAGCGT CACGTGAGGA 300CTGTGAAGCA CAATGCGATA TGTTCTGATT ATATGGCGAG TTTGCTTAAT GACATGTTTT 360TAGCCGAACG GTGTCAAGTT TCTTAATGTG GTTGTGAGAT TTTCTCTTTA AATATCAAAA 420TGTTGCATGG GTGATTTGTT GTTCTATAGT GGCTAAAGAC TTTATGGTTT CTGTTAAATA 480TATATGCGTG AGAAAAATTA GCATTCAAAT CTATAAAAGT TAGATGACAT TGTAGAACCG 540GTTACCTAAA TGAGCGATAG AGTGCTTCGG TAGTAAAAAT ATCTTTCAGG AAGTAAACAC 600ATCAGGAGCG ATAGCGGTGA ATTATTCGTG GTTTTGTCGA TTCGGCATAG TGGCGATAAC 660TGAATGCCGG ATCGGTACTG CAGGTGTTTA AACACACCGT AAATAATAAG TAGTATTAAG 720GAGTTGTT 728ATG AAA AAT ATT ATT TTA TCC ACT TTA GTT ATT ACT ACA AGC GTT TTG 776Met Lys Asn Ile Ile Leu Ser Thr Leu Val Ile Thr Thr Ser Val Leu

5 10 15GTT?GTA?AAT?GTT?GCA?CAG?GCC?GAT?ACT?AAC?GCC?TTT?TCC?GTG?GGG?TAT 824Val?Val?Asn?Val?Ala?Gln?Ala?Asp?Thr?Asn?Ala?Phe?Ser?Val?Gly?Tyr

20 25 30GCA?CGG?TAT?GCA?CAA?AGT?AAA?GTT?CAG?GAT?TTC?AAA?AAT?ATC?CGA?GGG 872Ala?Arg?Tyr?Ala?Gln?Ser?Lys?Val?Gln?Asp?Phe?Lys?Asn?Ile?Arg?Gly

35 40 45GTA?AAT?GTG?AAA?TAC?CGT?TAT?GAG?GAT?GAC?TCT?CCG?GTA?AGT?TTT?ATT 920Val?Asn?Val?Lys?Tyr?Arg?Tyr?Glu?Asp?Asp?Ser?Pro?Val?Ser?Phe?Ile

50 55 60TCC?TCG?CTA?AGT?TAC?TTA?TAT?GGA?GAC?AGA?CAG?GCT?TCC?GGG?TCT?GTT 968Ser?Ser?Leu?Ser?Tyr?Leu?Tyr?Gly?Asp?Arg?Gln?Ala?Ser?Gly?Ser?Val?65 70 75 80GAG?CCT?GAA?GGT?ATT?CAT?TAC?CAT?GAC?AAG?TTT?GAG?GTG?AAG?TAC?GGT 1016Glu?Pro?Glu?Gly?Ile?His?Tyr?Hie?Asp?Lys?Phe?Glu?Val?Lys?Try?Gly

85 90 95TCT?TTA?ATG?GTT?GGG?CCA?GCC?TAT?CGA?TTG?TCT?GAC?AAT?TTT?TCG?TTA 1064Ser?Leu?Met?Val?Gly?Pro?Ala?Tyr?Arg?Leu?Ser?Asp?Asn?Phe?Ser?Leu

100 105 110TAC?GCG?CTG?GCG?GGT?GTC?GGC?ACG?GTA?AAG?GCG?ACA?TTT?AAA?GAA?CAT 1112Tyr?Ala?Leu?Ala?Gly?Val?Gly?Thr?Val?Lys?Ala?Thr?Phe?Lys?Glu?His

115 120 125TCC?ACT?CAG?GAT?GGC?GAT?TCT?TTT?TCT?AAC?AAA?ATT?TCC?TCA?AGG?AAA 1160Ser?Thr?Gln?Asp?Gly?Asp?Ser?Phe?Ser?Asn?Lys?Ile?Ser?Ser?Arg?Lys

130 135 140ACG?GGA?TTT?GCC?TGG?GGC?GCG?GGT?GTA?CAG?ATG?AAT?CCG?CTG?GAG?AAT 1208Thr?Gly?Phe?Ala?Trp?Gly?Ala?Gly?Val?Gln?Met?Asn?Pro?Leu?Glu?Asn145 150 155 160ATC?GTC?GTC?GAT?GTT?GGG?TAT?GAA?GGA?AGC?AAC?ATC?TCC?TCT?ACA?AAA 1256Ile?Val?Val?Asp?Val?Gly?Tyr?Glu?Gly?Ser?Asn?Ile?Ser?Ser?Thr?Lys

165 170 175ATA?AAC?GGC?TTC?AAC?GTC?GGG?GTT?GGA?TAC?CGT?TTC?TGA?AAAGC 1300Ile?Asn?Gly?Phe?Asn?Val?Gly?Val?Gly?Tyr?Arg?Phe

180 185ATAAGCTATG?CGGAAGGTTC?GCCTTCCGCA?CCGCCAGTCA?ATAAAACAGG?GCTTCTTTAC 1360CAGTGACACG?TACCTGCCTG?TCTTTTCTCT?CTTCGTCATA?CTCTCTTCGT?CATAGTGACG 1420CTGTACATAA?CATCTCACTA?GCATAAGCAC?AGATAAAGGA?TTGTGGTAAG?CAATCAAGGT 1480TGCTCAGGTA?GGTGATAAGC?AGGAAGGAAA?ATCTGGTGTA?AATAACGCCA?GATCTCACAA 1540GATTCACTCT?GAAAAATTTT?CCTGGAATTA?ATCACAATGT?CATCAAGATT?TTGTGACCGC 1600CTTCGCATAT?TGTACCTGCC?GCTGAACGAC?TACTGAAAAG?TAGCAAGGTA?TGTATTTTAT 1660CCAGGAGAGC?ACCTTTTTTG?CGCCTGGCAG?AAGTCCCCAG?CCGCCACTAG?CTCAGCTGGA 1720TAGAGCATCA?ACCTCCTAAG?TTGATGGTGC?GAGGTTCGAG?GCCTCGGTGG?CGGTCCAATG 1780TGGTTATCGT?ATAATGTTAT?TACCTCAGTG?TCAGGCTGAT?GATGTGGGTT?CGACTCCCAC 1840TGACCACTTC?AGTTTTGAAT?AAGTATTGTC?TCGCAACCCT?GTTACAGAAT?AATTTCATTT 1900ATTACGTGAC?AAGATAGTCA?TTTATAAAAA?ATGCACAAAA?ATGTTATTGT?CTTTTATTAC 1960TTGTGAGTTG?TAGATTTTTC?TTATGCGGTG?AATCCCCCTT?TGCGGCGGGG?CGTCCAGTCA 2020AATAGTTAAT?GTTCCTCGCG?AACCATATTG?ACTGTGGTAT?GGTTCACCGG?GAGGCACCCG 2080GCACCGCAAT?TTTTTATAAA?ATGAAATTCA?CACCCTATGG?TTCAGAGCGG?TGTCTTTTTA 2140CATCAGGTGG?GCAAGCATAA?TGCAGGTTAA?CTTGAAAGAT?ACGATCAATA?GCAGAAACCA 2200GTGATTTCGT?TTATGGCCTG?GGGATTTAAC?CGCGCCAGAG?CGTATGCAAG?ACCCTGGCGC 2260GGTTGGCCGG?TGATCGTTCA?ATAGTGCGAA?TATGAATGGT?TACCAGCCGC?CTGCGAATTC 2320

(2) recognition sequence numbering: 2 data:

(i) sequence signature:

(A) length: 53

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(xi) sequence description: SEQ ID NO:2CATTTCTCAT TGATAATGAG AATCATTATT GACATAATTG TTATTATTTT ACG 53

(2) recognition sequence number: 3 data

(i) sequence signature:

(A) length: 688

(B) type: nucleic acid

(C) chain: two strands

(D) topological structure: linearity

( xi ) ：SEQ ID NO：3GAGCGCATTA TCAGATAAAT TGATTTATTT CTCACTTTCA TTCTATTTTC ATCAGGAATC 60CCTGTGTCCT GTGCGGTAAT CTGCTGCTAT CGAGAACGAC AGACATCGCT AACAGTATAT 120ATGGAAACAT CAAAAGACAA GACGATAACA AGCCCAGGGC CATACATAGT TCGATTACTT 180AACAGCTCAC TGAACGGCTG TGAGTTTCCA TTGCTGACAG GCCGAACACT CTTTGTGGTA 240GGTCAGAGTG ATGCGCTCAC TGCTTCAGGT CAACTCCCTG ATATACCTGC CGATAGCTTT 300TTTATCCCGC TGGACCATGG CGGAGTAAAT TTTGAAATCC AGGTGGATAC GGATGCGACC 360GAAATTATAC TCCATGAGCT GAAAGAAGGA AATTCTGAAT CTCGTTCGGT GCAATTAAAT 420ACGCCAATAC AGGTCGGTGA ATTGCTTATC CTGATTCGCC CGGAAAGCGA GCCGTGGGTG 480CCCGAGCAGC CTGAGAAGTT AGAAACGTCT GCAAAAAAGA ACGAGCCGCG TTTTAAAAAC 540GGAATTGTAG CAGCACTGGC CGGGTTTTTT ATATTGGGAA TTGGGACTGT GGGGACGTTA 600TGGATACTTA ACTCGCCGCA GCGGCAGGCC CGAGAGCTCG ATTCGTTATT GGGGCAGGAG 660AAGGAGCGTT TTCAGGTGTT GCCAGGCC 688

(2) recognition sequence number: 4 data

(i) sequence signature:

(A) length: 16

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA (genome)

(xi) sequence description: SEQ ID NO:4:AATATCGCCC TGAGCA 16

(2) recognition sequence number: 5 data:

(i) sequence signature:

(A) length: 4044

(B) type: nucleic acid

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: DNA (genome)

( xi ) ：SEQ ID NO：5：GGTTAACTCT TCGTTGAATA AAAAATGTCA ATGACGTTCC ATAATTCAGG AGATGAACTT 60CACAAGTCAT TATATATAAC AGGAGGTGCT ATGAAACATC ATGCTTTTAT GCTTTGGTCA 120TTACTTATTT TTTCATTCCA TGTTTTGGCC AGTTCAGGCC ATTGTTCTGG TTTACAACAG 180GCATCATGGG ATATTTTTAT CTACGATTTT GGTAGTAAAA CCCCGCAACC ACCTACAAAT 240ACTGATAAAA AGCAAGCCAG GCAGATTAGT TCACCGTCCT GCCCGACGAC AAAACCCATG 300ATGTCCGCAC CAGTCAATGA CGCCAGGAAA GGGAATACTT TCTCCAGAAC ATAATGTTAT 360TTATCTACAA TGGTGCCGAC GACTACTTTT AGCCACCCGG AAATCTTGAT TGCCATCAAA 420TATAGCTGGC ATTATTTTTC CTGACGTGTA TAGTGCGCCT CGTTATCCCC ATTAAGGAAT 480TTGTTTGTCT CGTAAAATGA CAGGAATTGT CAAAACCTTT GATTGTAAGA GCGGTAAAGG 540TCTCATCACC CCCTCCGATG ACGCAAAGAT GTTCAGGTCC ACATTTCAGC ATGTCGCCAA 600CACGAAACAG AAGCGCTTAT CCCCGGTATA CGCGTTGAGT TTTATCGTAT TAATGGCCTC 660CGCGGACCTA CCGCCGCCAA CGTTTATCTT TCATAATTCG TCACCCGGCA TTTTTCAGAA 720AAATTTAGCG AGTACGTCTA CCTCCGCAGC CTGCTATGAG GCTTTGCCTG AAAGGCTGCA 780GAATGTTTTC AGTGGCGAAA ATCTAAAAGA TTTATTTTGC TAATCAGTCC TGTGACCTCT 840TTTATCATAT ATCGGGTGCC CCCCCTTCTC ACTTTGTTTA ACGTGAAGAA ATGTACAGCC 900GTTTTTCACT GTGATAGCAT CTAATATTGC AAAAGTATTT AACGCTATAT ACCCATTGTC 960ACAGGAGTGG CTGCGTGCGA GCTGAGCTAT TTAACCGAAG TATTTATGTG ATCATTGGAA 1020TTATCTCTAT TGCCGCTCAA TGCTACGTCA TATTCAGTGG GTATAAATCG CCAATATAGT 1080TGTAACGCTA TTTATTTTTA GGGTAATAAT TGAATGACTT TGCTTTCAGG AAAAACCACA 1140CTGGTTCTCT GCCTCTCCTC TATTTTATGT GGATGTACGA CGAACGGCTT ACCCACACCT 1200 TATAGTATTA ATTTGTCGTT CCCGGTCATT ACACAAAACC AGATTAATTC CGGTGGTTAT 1260TACATAAATG ACGCGGAACA AATTCGGACA ACTGATGGTC TGTGCCTTGA TGCAGGCCCA 1320GATCAACAGA ATCGTTTGAC GCTGCGGGAG TGTAAGCATG TGCAATCTCA GCTTTTCTCA 1380TTTCACCGAG ACAGAATCAC GCAGGGTGAG AAATGTCTGG ATGCCGCAGA CAAGGTACAA 1440AAGAAGGCAC ACCAATCATT CTTTATTCAT GCACGGGTAA TGATAACCAG CGCTGGCTCA 1500CTGATCATAA CAAAATTAAG GGGAAACAGA GCCGAAAATG CCTGGGCACA AATAGCATTA 1560TTGTCAGAAA AGGCGACCCT GTTGTGTTGG CCGATTGCGA TTTTAGTCGC GCCCTGGAAT 1620TTACCATCAG GTAGCAGGAC ACCGCTGTGA AGAGAGTGCC GCTAACCTCT TGACACGACA 1680ACAGGTTAGC GACCTTTACT TCCACGTGCG ATCAATTTAC TTTACGTCCG CAACGTCAGG 1740ATGACAAAAC GGCGGCTAAA CCTTGACACC AGTTATATAC CCAGCrTAAA TACTGGTCAT 1800CCAACCAGTA AAAAGGAAAT GGCGATGTTC GTCGAACTCG TTTATGACAA GCGAAATGTT 1860GAAGGTTTGC CAGGCGCACG CGAAATCATC CTCAATGAAC TCACAAAACG CGTACATCAA 1920CTTTTTCCCG ATGCGCAAGT GAAAGTTAAG CCAATGCAGG CGAACGCATT AAACAGTGAC 1980TGTACAAAAA CCGAGAAAGA ACGGCTGCAC CGTATGCTGG AAGAGATGTT TGAAGAGGCT 2040GATATGTGGC TGGTCGCCGA ATAACGTCCC CTCCTGCGAA AGCCAACATG TCCGATCGAA 2100AACAGCGCCC TGAGGCGCTG TCTGTGACGA TATAACGCAA ACGCTACCAC TCAGAACATG 2160TTGTTGTTGA TACCTCAGAC CGGTATGTGG AACCGACATT CATCGCTTCA CTGGCCTGTC 2220GGTATGAGTA GCCCTTATCA ACAATCAGCT GTGCGCATTC CAGCCTGAAA TCTGAAAGTA 2280CGTTTGGTTT TGTTGTTTAT TAAGAGCCTA TCCCATTAGA CTCTTTTATT CGCCAAACTG 2340GCTTTAACGA TTACGCCTAC TGGGATAGGT TCTAAACTTA TCATCAATAC GTAAAATACC 2400TATTTACGAA CAAAAAGTAA CAGGTAAAAA TCCGAAATAA AACCAGCATA ACTAAAACTT 2460ACTGCAGATA TGCACACGCA TTATTACTAT GTTTCCAGGA TAGTCTCGAC CAGTCAAGAC 2520TATCTATTTT ATATAAAAAG GGAAATACTT CACATGAATA AAATACATGT TACATATAAA 2580AATCTCTTAC TTCCGATTAC CTTCATCGCG GCAACTCTAA TTAGCGCCTG TGATAACGAT 2640AAAGATGCCA TGGCGGAAGC TGAAAAAAAT CAAGAGAAAT ACATGCAAAA AATCCAGCAA 2700AAAGAGCACC AGCAATCAAT GTTCTTTTAC GACAAAGCCG AAATGCAAAA AGCTATTGCC 2760AATATCAACG CAAAAGGTGG AGCCAATCTT GCGATTATTG AAGTCCGTTT CTTCAAGGGC 2820GGGTATTCAT TCATTCGACA AAGCGTTAAC ACCCCTGCTA AAGTAGAGGT GTTTAAATTT 2880AACAACGGCT ACTGGGGGGG ACCTTCGCCT GTCAATTTAA CCATCTTTGG CACTATAACA 2940GAGGAGCAAA AACAAGAAGC ACTAAAAGAG GCTTTATTCA AATTCGACTC GATCAATTTC 3000AGCATTATAC CAGAGCGTAT TCAGGAAACA ATTAAACGCG CTAACGCCAG TGGCATCATT 3060TCCGTTACGG AAGATAGCGA TATCGTTGTA CGAGCAGAGA TAGCTCATAA TGGCGAATTC 3120GTCTATGACA TTACCATCAC TGCTAAAAAT ACAGCACGTG CGGTAATGAC CTTAAATAAG 3180GATGGTTCTA TTGCCGGATA TGAGATCAAA GAACCTTTCG CCCCAAAAAA AGAAGCCGAA 3240AAAGCACAGC AACTTGTTGA ACAATCGAGA AAAGACATTG AAAGTCCAGC GTAAAAAAGC 3300AGCTGGAAAG ATGAACGAAA TACAGCAGAC ATTTAAAAAT AGCAGGCGAT ACAAACATTG 3360ATAAAAATTA TAGCGCGAAA GAGCGCGTGC CAGGTACTAA GGCACTGCTT GAAGACAGCG 3420AATCGCTATT TCATTCTCTG ACACTGTAAT TTTTCGTACT CAAGATGTTT ATTTATTGAG 3480TCTTTTGTGG ATAACCAGGT GAAGTTATGT GACGCCAGGA ATCTATTCCA GCGGGCGTAC 3540TTGTTGGAGC CAGTGTGAAG CCGGGCAGCG CGCAGAAACC GGAGCGTATA CGTTGTACGT 3600AAGAATTTCG AGCACTGCCC GACCTAAAAA TGATGAATAA AATAGATATT TTAAAGAGGT 3660AATATGAAGA ATTTTTTCAA AATAATTACT GATTTCATCG CGGATATTTC CCTTGATCTA 3720TTTGCTATAT TTTTATGCAT GTTATTCGTA TACAAAACAG GACCATCAAT TGGTGTGATA 3780TCATTTTTTA TTGCATTAAT TATTTATATC ATTCTTCATT TTTTTTTACT CATTTCTTGA 3840AAAAATCATA AAAAAAATAT TCAAATAAGT ATTTAAAATT ATTGTTTTGT GGTACAAATT 3900CAGCGCAATA AAACAGAGCA ACTAAAAAAA ATTAGGCGTA GCGAAGTGGA AAAGGACTGT 3960CATGTACTGG ACCGTGAGCT GGTCGGGAGA GCAATGTACG GGAAAGAGCG AAATACTGTC 4020ATTGATATGA GCAGGAATAT CGAT 4044

(2) recognition sequence number: 6 data:

(i) sequence signature:

(A) length: 87 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide Met Lys His His Ala Phe Met Leu Trp Ser Leu Leu Ile Phe Ser Phe1 5 10 15His Val Leu Ala Ser Ser Gly His Cys Ser Gly Leu Gln Gln Ala Ser

20 25 30Trp?Asp?Ile?Phe?Ile?Tyr?Asp?Phe?Gly?Ser?Lys?Thr?Pro?Gln?Pro?Pro

35 40 45Thr?Asn?Thr?Asp?Lys?Lys?Gln?Ala?Arg?Gln?Ile?Ser?Ser?Pro?Ser?Cys

50 55 60Pro?Thr?Thr?Lys?Pro?Met?Met?Ser?Ala?Pro?Val?Asn?Asp?Ala?Arg?Lys65 70 75 80Gly?Asn?Thr?Phe?Ser?Arg?Thr

85

(2) recognition sequence number: 7 data

(i) sequence signature:

(A) length: 178 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:7Met Thr Leu Leu Ser Gly Lys Thr Thr Leu Val Leu Cys Leu Ser Ser1 5 10 15Ile Leu Cys Gly Cys Thr Thr Asn Gly Leu Pro Thr Pro Tyr Ser Ile

20 25 30Asn?Leu?Ser?Phe?Pro?Val?Ile?Thr?Gln?Asn?Gln?Ile?Asn?Ser?Gly?Gly

35 40 45Tyr?Tyr?Ile?Asn?Asp?Ala?Glu?Gln?Ile?Arg?Thr?Thr?Asp?Gly?Leu?Cys

50 55 60Leu?Asp?Ala?Gly?Pro?Asp?Gln?Gln?Asn?Arg?Leu?Thr?Leu?Arg?Glu?Cys65 70 75 80Lys?His?Val?Gln?Ser?Gln?Leu?Phe?Ser?Phe?His?Arg?Asp?Arg?Ile?Thr

85 90 95Gln?Gly?Glu?Lys?Cys?Leu?Asp?Ala?Ala?Asp?Lys?Val?Gln?Lys?Lys?Ala

100 105 110His?Gln?Ser?Phe?Phe?Ile?His?Ala?Arg?Val?Mer?Ile?Thr?Ser?Ala?Gly

115 120 125Ser?Leu?Ile?Ile?Thr?Lys?Leu?Arg?Gly?Aen?Arg?Ala?Glu?Asn?Ala?Trp

130 135 140Ala?Gln?Ile?Ala?Leu?Leu?Ser?Glu?Lys?Ala?Thr?Leu?Leu?Cys?Trp?Pro145 150 155 160Ile?Ala?Ile?Leu?Val?Ala?Pro?Trp?Asn?Leu?Pro?Ser?Gly?Ser?Arg?Thr

165 170 175Pro?Leu

(2) recognition sequence number: 8 data:

(i) sequence signature:

(A) length: 79 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:8Met Phe Val Glu Leu Val Tyr Asp Lys Arg Asn Val Glu Gly Leu Pro1 5 10 15Gly Ala Arg Glu Ile Ile Leu Asn Glu Leu Thr Lys Arg Val His Gln

20 25 30Leu?Phe?Pro?Asp?Ala?Gln?Val?Lys?Val?Lys?Pro?Met?Gln?Ala?Asn?Ala

35 40 45Leu?Asn?Ser?Asp?Cys?Thr?Lys?Thr?Glu?Lys?Glu?Arg?Leu?His?Arg?Met

50 55 60Leu?Glu?Glu?Met?Phe?Glu?Glu?Ala?Asp?Met?Trp?Leu?Val?Ala?Glu65 70 75

(2) recognition sequence number: 9 data:

(i) sequence signature:

(A) length: 246 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:9Met Asn Lys Ile His Val Thr Tyr Lys Asn Leu Leu Leu Pro Ile Thr1 5 10 15Phe Ile Ala Ala Thr Leu Ile Ser Ala Cys Asp Asn Asp Lys Asp Ala

20 25 30Met?Ala?Glu?Ala?Glu?Lys?Asn?Gln?Glu?Lye?Tyr?Met?Gln?Lys?Ile?Gln

35 40 45Gln?Lys?Glu?His?Gln?Gln?Ser?Met?Phe?Phe?Tyr?Asp?Lys?Ala?Glu?Met

50 55 60Gln?Lys?Ala?Ile?Ala?Asn?Ile?Asn?Ala?Lys?Gly?Gly?Ala?Asn?Leu?Ala65 70 75 80Ile?Ile?Glu?Val?Arg?Phe?Phe?Lys?Gly?Gly?Tyr?Ser?Phe?Ile?Arg?Gln

85 90 95Ser?Val?Asn?Thr?Pro?Ala?Lys?Val?Glu?Val?Phe?Lys?Phe?Asn?Asn?Gly

100 105 110Tyr?Trp?Gly?Gly?Pro?Ser?Pro?Val?Asn?Leu?Thr?Ile?Phe?Gly?Thr?Ile

115 120 125Thr?Glu?Glu?Gln?Lys?Gln?Glu?Ala?Leu?Lys?Glu?Ala?Leu?Phe?Lys?Phe

130 135 140Asp?Ser?Ile?Asn?Phe?Ser?Ile?Ile?Pro?Glu?Arg?Ile?Gln?Glu?Thr?Ile145 150 155 160Lys?Arg?Ala?Asn?Ala?Ser?Gly?Ile?Ile?Ser?Val?Thr?Glu?Asp?Ser?Asp

165 170 175Ile?Val?Val?Arg?Ala?Glu?Ile?Ala?His?Asn?Gly?Glu?Phe?Val?Tyr?Asp

180 185 190Ile?Thr?Ile?Thr?Ala?Lye?Asn?Thr?Ala?Arg?Ala?Val?Met?Thr?Leu?Asn

195 200 205Lys?Asp?Gly?Ser?Ile?Ala?Gly?Tyr?Glu?Ile?Lys?Glu?Pro?Phe?Ala?Pro

210 215 220Lys?Lys?Glu?Ala?Glu?Lys?Ala?Gln?Gln?Leu?VaL?Glu?Gln?Ser?Arg?Lys225 230 235 240Asp?Ile?Glu?Ser?Pro?Ala

245

(2) recognition sequence number: 10 data:

(i) sequence signature:

(A) length: 3700

(B) type: nucleic acid

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: DNA (genome)

( xi ) ：SEQ ID NO：10TTTTGGTTTG CTGCCGTTTG GGATAACTGC ATAGAGAGCG GCCAAGTCGC TTGCGGTCGG 60TATCTCGAGT ATATCGAAAT CCATGTGGCC ATTGACCTCT TCAAGCGCTC ACGTTAACTA 120CCTGCTCTTT TTTGAGCACC AACATCCCAG GTTCGTCACA GTAAATCGTA TCGTGATTAT 180TGCTAATCGT CAGTTTACCG CTCCGAAAGC AAACTAAAGT GAAACTGCTT ACATAAAGAT 240TTTTGATGGT AACCTGCTGA GTCTGACTTT TAATTTGCTG CCGGGTATTT GTCAAAAGTG 300ATTTTAATTT CTGTAAGTTA TCTGCGGCAG GACGCTGATG ACTATTACTT ACAAAGGTTA 360CATTTTCCAT ATTATCCCTT TGTTGAACTT ATTTTAATGT TCCTTACTGG TATCCTACTG 420AAAAAATCTC AGTTGTAAAT GCTCTTTATT AGCGTGTGTT GGCAATGGTC TGATTGTTAC 480ACCAAAAGAA CCCAAATTTG GGTAATTTAT CTACAGTAGT TTAAGCCCCA ATGGGGATGA 540TGGTTCTTTT AATATGTGTT GAGACGCATT ATACAGAATA AATTGATTTT ATTTCTCACT 600TTTCATTCTA TTTTCATCAG GAATCCCTGT GTCCTGTGCG GTAATCTGCT GCTATCGAGG 660AACGACAGAC ATCGCTAACA GTATATATGG AAACATCAAA AGAGAAGACG ATAACAAGCT 720TTCCAGGGCC ATACATAGTT CGATTACTTA ACAGCTCACT GAACGGCTGT GAGTTTCCAT 780TGGGCCTGAC AGGCCGAACA CTCTTTGTGG TAGGTCAGAG TGATGCGCTC ACTGCTTCAG 840GTCAATGTGA TAGCTCCCTG ATATACCTGC CGATAGCTTT TTTATCCCGC TGGACCATGG 900CGGAGTAAAT TTTAGGGAAA TCCAGGTGGA TACGGATGCG ACCGAAATTA TACTCCATGA 960GCTGAAAGAA GGAAATTATG TCTGAATCTC GTTCGGTGCA ATTAAATACG CCAATACAGG 1020TCGGTGAATT GCTTATCCTG TGATTCGCCC GGAAAGCGAG CCGTGGGTGC CCGAGCAGCC 1080TGAGAAGTTA GAAACGTCTG CATAAAAAAG AACGAGCCGC GTTTTAAAAA CGGAATTGTA 1140GCAGCACTGG CCGGGTTTTT TATAGAAAGT TGGGAATTGG GACTGTGGGG ACGTTATGGA 1200TACTTAACTC GCCGCAGCGG CAGGCCGCAG GTGTAAGAGC TCGATTCGTT ATTGGGGCAG 1260GAGAAGGAGC GTTTTCAGGT GTTGCCAGGC CGGGACGGAA AATGCTCTAT GTCGCTGCGC 1320AAAATGAAAG AGATACGTTG TGGGCTCGTC AGGTTTTAAA TAGCGAGGGG CGATTATGAT 1380AAAAATGCGC GAGTGATTAA CGAAAACGAA GAAAATAAGC GTAGAATCTC TATCTGGCTG 1440GATACCTATT ATCCGCAGCT GGCTTATTAT CGGATTCATT TCGATTAGAG CCGCGTAAAC 1500CCGTTTTCTG GCTAAGCCGC CAGCGAAACA CGATGAGCAA GAAAGAGTCT CGAGGTGTTA 1560AGTCAAAAGC TGAGAGCGCT AATGCCTTAC GCGGATTCGG TTAACATCAA ACGTTGATGG 1620ACGATGTTAC CGCAGCAGGC CAGGCGGAAG CGGGGCTAAA ACAGCAGGCG TTAAGAAGAT 1680TACCTTATTC CCGCAGGAAT CATAAGGGGG GCGTAACGTT TGTTATTCAG GGGGCGCTCG 1740GTGAGATGAT GTAGAAATAC TCAGAGCCCG TCAATTTGTC GATAGCTATT ACCGCACATG 1800GGGAATGGGA CGCTATGTGC AGTTTGCGAT CGAATTAAAA GATGACTGGC TCAAGGGGCG 1860CTCATTTGAG CAGTACGGGG CGGAAGGTTA TATCAAAATG AGCCCAGGCC ATTGGTATTT 1920CCCAAGCCCA GAGGGCTTTA ATTTAACGTA AATAAGGAAG TCATTATGGC AACACCTTGG 1980TCAGGCTATC TGGATATGGA CGTCTCAGCA AAATTTGATA CGGGCGTTGA TAATCTACAA 2040ACGCAGGTAA CAGAGGCGAT GTTACTGGAT AAATTAGCAG CAAAACCCTC CGATCCGGCG 2100CTACTGGCGG CGTATCAGAG TAAGAAAAAC TCTCGGAATA TAACTTGTAC CGTAACGCGC 2160AATCGAACAC GGTAAAAGTC TTTAAGGATA TGATTGATGC TGCCATTATT CAGAACTTCC 2220GTTAATCAGT TATAAGGTGG ATTATGTCGA TTAAGCAACT ATTGTCCCTG AGAATGCCGT 2280TATAGGGCAG GCGGTCAATA TCAGGTCTAT GGAAATAGAA CGGACATTGT CTCGCTGGAT 2340GACCGGCTAC TCCAGGCTTT TTCTGGTTCG GCGATTGCCT AGAAACGGCT GTGGATAAAC 2400AGACGATTAG CAACAGGATT GAGGACCCTA ATCTGGTGAC GGATTATTTC CTAAAGAGCT 2460GGCTATTTCG CAAGAGATGA TTTCAGATTA TAACCTGTAT GTTTCTATGA GGTCAGTAGC 2520CTTACTCGTA AAGGAGTCGG GGCTGTTGAA ACGCTATTAC GCTCATGATT CTTGGATGTC 2580GATATCTATA TACTTTTCTG CTGGTAATGA CCCTTGCCGG CTGTAAGGAT AAGGATCTTA 2640GCTTTTAAAA GGACTGGACC AGGAACAGGC TAATGAGGTC ATTGCCGTTC TGCAAATGCA 2700CAGAAATATA GAGGCGAATA AAATTGATAG CGGAAAATTG GGCTATAGCA TTACCGTTGC 2760TGAGCAGGTA CTGATTTTAC CGCTGCGGTG TACTGGATTA AAACTTATCA GCTTCCTCCC 2820CGGCCACGGG TAATTGGAAA TAGCGCAGAT GTTCCCGGCG GATTCGCTGG TATCGTCTCC 2880GCGAGCTGAA AAGGAAAACC AGGTTATATT CGGCTATTGA ACAGCGACTG GAACAGTCAT 2940TACAGACGAT GGAGGGCGAT GTGCTCTCCG CCAGGGTCCA TATTAGTTAT GATATTGATG 3000CTGGTGAAAA TGGCCGCCCG CAAGGCAAAA CCTGTTCATC TGTCGGCATT AGCCGTATAT 3060GAACGAGGTT CGCCGCTTGC GCATCAAGAA GATCAGCGAT ATCAAGCGTT TCTTAAAGAA 3120TAGTTTTGCC GATGTGGATT ATGACAACAA TTTCTGTTGT GTTGTCAGAA CGTTCTGATG 3180CCCAATTACA GGCTCCCGGC ACACCAGTAA AAGTAACGTA ATTCTTTTGC AACCAGTTGG 3240ATTGTTTTGA TTATTTTGTT ATCCGTGATG TCAGATACAG GCTTTGGCGT CTGGTATTAC 3300AAAAACCATT ATGCCCGCAA TAAGAAAGGC ATAACGGGGA GTACTGATGA TAAGGCGAAA 3360TCGTCAAATG AATAGGCAGC CATTACCCAT TATCTGGCAA AGAATCATTT TTGATCCGTT 3420ATCGTATATC CATCCTCAGC GGTTGCAGAT AGCGCCGGAA ATGATTGTCA GACCGCGCCA 3480CGCGAAATGA GTTAATACTG GCGGCATGGC GGCGGCTTAA GAACGGAGAA AAGGAGTGTA 3540TTCAAAACTC ACTGACGCAG CTGTGGCTGC TCAGTGGCGC CGACTGCCGC AAGTAGCGTA 3600TTTACTAAAC TGAGAGCCGA TCTGGCAAGG CAGGGAGCCT TGCTTGGCCT AGCCGGATTG 3660GGCGAAATGA GTTAATACTG GCGGCATGGC GGCTTGCCAT 3700

(2) recognition sequence number: 11 data:

(i) sequence signature:

(A) length: 392 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:11Met Glu Thr Ser Lys Glu Lys Thr Ile Thr Ser Pro Gly Pro Tyr Ile 15 10 15Val Arg Leu Leu Asn Ser Ser Leu Asn Gly Cys Glu Phe Pro Leu Leu

20 25 30Thr?Gly?Arg?Thr?Leu?Phe?Val?Val?Gly?Gln?Ser?Asp?Ala?Leu?Thr?Ala

35 40 45Ser?Gly?Gln?Leu?Pro?Asp?Ile?Pro?Ala?Asp?Ser?Phe?Phe?Ile?Pro?Leu

50 55 60Asp?His?Gly?Gly?Val?Asn?Phe?Glu?Ile?Gln?Val?Asp?Thr?Asp?Ala?Thr65 70 75 80Glu?Ile?Ile?Leu?His?Glu?Leu?Lys?Glu?Gly?Asn?Ser?Glu?Ser?Arg?Ser

85 90 95Val?Gln?Leu?Asn?Thr?Pro?Ile?Gln?Val?Gly?Glu?Leu?Leu?Ile?Leu?Ile

100 105 110Arg?Pro?Glu?Ser?Glu?Pro?Trp?Val?Pro?Glu?Gln?Pro?Glu?Lys?Leu?Glu

115 120 125Thr?Ser?Ala?Lys?Lys?Asn?Glu?Pro?Arg?Phe?Lye?Asn?Gly?Ile?Val?Ala

130 135 140Ala?Leu?Ala?Gly?Phe?Phe?Ile?Leu?Gly?Ile?Gly?Thr?Val?Gly?Thr?Leu145 150 155 160Trp?Ile?Leu?Asn?Ser?Pro?Gln?Arg?Gln?Ala?Ala?Glu?Leu?Asp?Ser?Leu

165 170 175Leu?Gly?Gln?Glu?Lys?Glu?Arg?Phe?Gln?Val?Leu?Pro?Gly?Arg?Asp?Lys

180 185 190Met?Leu?Tyr?Va1?Ala?Ala?Gln?Asn?Glu?Arg?Asp?Thr?Leu?Trp?Ala?Arg

195 200 205Gln?Val?Leu?Als?Arg?Gly?Asp?Tyr?Asp?Lys?Asn?Ala?Arg?Val?Ile?Asn

210 215 220Glu?Asn?Glu?Glu?Asn?Lys?Arg?Ile?Ser?Ile?Trp?Leu?Asp?Thr?Tyr?Tyr225 230 235 240Pro?Gln?Leu?Ala?Tyr?Tyr?Arg?Ile?His?Phe?Asp?Glu?Pro?Arg?Lys?Pro

245 250 255Val?Phe?Trp?Leu?Ser?Arg?Gln?Arg?Asn?Thr?Met?Ser?Lys?Lys?Glu?Leu

260 265 270Glu?Val?Leu?Ser?Gln?Lys?Leu?Arg?Ala?Leu?Met?Pro?Tyr?Ala?Asp?Ser

275 280 285Val?Asn?Ile?Thr?Leu?Met?Asp?Asp?Va1?Thr?Ala?Ala?Gly?Gln?Ala?Glu

290 295 300Ala?Gly?Leu?Lys?Gln?Gln?Ala?Leu?Pro?Tyr?Ser?Arg?Arg?Asn?His?Lys305 310 315 320Gly?Gly?Val?Thr?Phe?Val?Ile?Gln?Gly?Ala?Leu?Asp?Asp?Val?Glu?Ile

325 330 335Leu?Arg?Ala?Arg?Gln?Phe?Val?Asp?Ser?Tyr?Tyr?Arg?Thr?Trp?Gly?Gly

340 345 350Arg?Tyr?Val?Gln?Phe?Ala?Ile?Glu?Leu?Lys?Asp?Asp?Trp?Leu?Lys?Gly

355 360 365Arg?Ser?Phe?Gln?Tyr?Gly?Ala?Glu?Gly?Tyr?Ile?Lys?Met?Ser?Pro?Gly

370 375 380His?Trp?Tyr?Phe?Pro?Ser?Pro?Leu385 390

(2) recognition sequence number: 12 data:

(i) sequence signature:

(A) length: 80 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:12Met Ala Thr Pro Trp Ser Gly Tyr Leu Asp Asp Val Ser Ala Lys Phe 15 10 15Asp Thr Gly Val Asp Asn Leu Gln Thr Gln Val Thr Glu Ala Leu Asp

20 25 30Lys?Leu?Ala?Ala?Lys?Pro?Ser?Asp?Pro?Ala?Leu?Leu?Ala?Ala?Tyr?Gln

35 40 45Ser?Lys?Leu?Ser?Glu?Tyr?Asn?Leu?Tyr?Arg?Asn?Ala?Gln?Ser?Asn?Thr

50 55 60Val?Lys?Val?Phe?Lys?Asp?Ile?Asp?Ala?Ala?Ile?Ile?Gln?Asn?Phe?Arg65 70 75 80

(2) recognition sequence number: 13 data:

(i) sequence signature:

(A) length: 101 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:13Met Ser Ile Ala Thr Ile Val Pro Glu Asn Ala Val Ile Gly Gln Ala 15 10 15Val Asn Ile Arg Ser Met Glu Thr Asp Ile Val Ser Leu Asp Asp Arg

20 25 30Leu?Leu?Gln?Ala?Phe?Ser?Gly?Ser?Ala?Ile?Ala?Thr?Ala?Val?Asp?Lys

35 40 45Gln?Thr?Ile?Thr?Asn?Arg?Ile?Glu?Asp?Pro?Asn?Leu?Val?Thr?Asp?Pro

50 55 60Lys?Glu?Leu?Ala?Ile?Ser?Gln?Glu?Met?Ile?Ser?Asp?Tyr?Asn?Leu?Tyr65 70 75 80Val?Ser?Mer?Val?Ser?Thr?Leu?Thr?Arg?Lys?Gly?Val?Gly?Ala?Val?Glu

85 90 95Thr?Leu?Leu?Arg?Ser

100

(2) recognition sequence number: 14 data:

(i) sequence signature:

(A) length: 252 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:14Met Ile Arg Arg Tyr Leu Tyr Thr Phe Leu Leu Val Met Thr Leu Ala 15 10 15Gly Cys Lys Asp Lys Asp Leu Leu Lys Gly Leu Asp Gln Glu Gln Ala

20 25 30Asn?Glu?Val?Ile?Ala?Val?Leu?Gln?Met?His?Asn?Ile?Glu?Ala?Asn?Lys

35 40 45Ile?Asp?Ser?Gly?Lys?Leu?Gly?Tyr?Ser?Ile?Thr?Val?Ala?Glu?Pro?Asp

50 55 60Phe?Thr?Ala?Ala?Val?Tyr?Trp?Ile?Lys?Thr?Tyr?Gln?Leu?Pro?Pro?Arg65 70 75 80Pro?Arg?Val?Glu?Ile?Ala?Gln?Met?Phe?Pro?Ala?Asp?Ser?Leu?Val?Ser

85 90 95Ser?Pro?Arg?Ala?Glu?Lys?Ala?Arg?Leu?Tyr?Ser?Ala?Ile?Glu?Gln?Arg

100 105 110Leu?Glu?Gln?Ser?Leu?Gln?Thr?Met?Glu?Gly?Val?Leu?Ser?Ala?Arg?Val

115 120 125His?Ile?Ser?Tyr?Asp?Ile?Asp?Ala?Gly?Glu?Asn?Gly?Arg?Pro?Pro?Lys

130 135 140Pro?Val?His?Leu?Ser?Ala?Leu?Ala?Val?Tyr?Glu?Arg?Gly?Ser?Pro?Leu145 150 155 160Ala?His?Gln?Ile?Ser?Asp?Ile?Lys?Arg?Phe?Leu?Lys?Asn?Ser?Phe?Ala

165 170 175Asp?Val?Asp?Tyr?Asp?Asn?Ile?Ser?Val?Val?Leu?Ser?Glu?Arg?Ser?Asp

180 185 190Ala?Gln?Leu?Gln?Ala?Pro?Gly?Thr?Pro?Val?Lys?Arg?Asn?Ser?Phe?Ala

195 200 205Thr?Ser?Trp?Ile?Val?Leu?Ile?Ile?Leu?Leu?Ser?Val?Met?Ser?Ala?Gly

210 215 220Phe?Gly?Val?Trp?Tyr?Tyr?Lys?Asn?His?Tyr?Ala?Arg?Asn?Lys?Lys?Gly225 230 235 240Ile?Thr?Ala?Asp?Asp?Lys?Ala?Lys?Ser?Ser?Asn?Glu

245 250

(2) recognition sequence number: 15 data:

(i) sequence signature:

(A) length: 818

(B) type: nucleic acid

(C) chain: two strands

(D) topological structure: linearity

( xi ) ：SEQ ID NO：15CATAACAACT CCTTAATACT ACTTATTATT TACGGTGTGT TTAAACACCT GCAGTACCGA 60TCCGGCATTC AGTTATCGCC ACTATGCCGA ATCGACAAAA CCACGAATAA TTCACCGCTA 120TCGCTCCTGA TGTGTTTACT TCCTGAAAGA TATTTTTACT ACCGAAGCAC TCTATCGCTC 180ATTTAGGTAA CCGGTTCTAC AATGTCATCT AACTTTTATA GATTTGAATG CTAATTTTTC 240TCACGCATAT ATATTTAACA GAAACCATAA AGTGTTTAGC CACTATAGAA CAACAAATCA 300CCCATGCAAC ATTTTGATAT TTAAAGAGAA AATCTCACAA CCACATTAAG AAACTTGACA 360CCGTTCGGCT AAAAAACATG TCATTAAGCA AACTCGCCAT ATAATCAGAA CATATCGCAT 420TGTGCTTCAC AGTCCTCACG TGACGCTCCA TCCGCAATAC GGTTATATGC CATCGCAGGC 480GCTGTAATCA TATTCACGAT GATGCTTAGC ACGCTTTATT CCCGCTCCGA TTTAATCTTT 540TAATATATCT ATCAGTTACA ACATTTCTTG TTATATTATA AGAATAGAAT CAACACCACA 600ATTCCAACAT AAATATCACC TGTGTTTAGA GAGAATTTAC ATTCCAAAAA AATAATAACT 660AACGCAAATA TTGAACACGC GATAAAAAAG TCTATTTCGC TATAAAACCC ATTATTATTA 720AGAGTGGTTA ACTCTTCGTT GAATAAAAAA TGTCAATGAC GTTCCATAAT TCAGGAGATG 780AACTTCACAA GTCATTATAT ATAACAGGAG GTGCTATG 818

Table 12

14082s ATCCCS019 phoN2 zxx∷6251Tn10d-Cm 25CS015 phoP102∷Tn10d-Cm 25AD154 phoP12 puB1744∷Tn10 3TT13208 phoP105∷Tn10d 26CS585 pagD1∷TnphoA phoN2 xxx∷6215Tn10d-Cm C5586 pagD1∷TnphoA phoP105∷To10d phoN2 xxx∷6215Tn10d-Cm CS619 pagE1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS620 pagE1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS1599 pagF1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS1600 pagF1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS334 pagG1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS335 pagG1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm C51488 pagH1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS1489 pagH1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS2054 pagI1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS2055 pagI1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS1074 pagJ1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS1075 pagJ1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS767 pagK1∷TnphoA phoN2 xxx∷6215Tn10dCm CS768 pagK1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS993 pagL1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS994 pagL1∷TnphoA phoP105∷Tn10d phoN2xxx∷6215Tn10d-Cm CS1845 pagM1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS1846 pagM1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS728 pagN1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS729 pagN1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS1194 pagO1∷TnphoA PhoN2 xxx∷6215Tn10d-Cm CS1195 pagO1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm CS1247 pagP1∷TnphoA phoN2 xxx∷6215Tn10d-Cm CS1248 pagP1∷TnphoA phoP105∷Tn10d phoN2 xxx∷6215Tn10d-Cm AK3011-3314 Tn10Δ16Δ17 18-SM10 ( pRT291 ) pRT291 ( TnphoA ) , 37

The Tet of pRK290 ^rAnd Km ^rContain Gm and obtain MM294 (pPH1JI) ^rPlasmid pPH1JI, its incompatible 37 3 Behlau et al., 1993 with pRK290, J.Bacteriol., 175:4475-8418 Lehrer et al., 1991, Cell, 64:229-3025 Miller et al., 1989, Proc.Natl.Acad.Sci.USA, 86:5054-5826 Miller et al., 1990, J.Bacteriol., 172:2485-9037 Taylor et al., 1989, J.Bacteriol., 171:1870-78

Table 13

To wild type strain with have an invalid phoP ^-The pag ∷ phoA activity of the bacterial strain at seat

Compare

Active (AP unit) a allelotrope logarithmic phase stationary growth phase

PhoP ⁺PhoP ^-PhoP ⁺PhoP ^-Reduce multiple ^bpagD1∷TnphoA 32 2 79 9 16pagE1∷TnphoA 96 2 108 3 48pagF1∷TnphoA 89 4 276 10 22pagG1∷TnphoA 35 1 65 6 35pagH1∷TnphoA 35 5 38 6 7pagI1∷TnphoA 12 2 24 8 6pagJ1∷TnphoA 123 8 944 88 15pagK1∷TnphoA 30 3 123 26 10pagL1∷TnphoA 7 1 35 4 7pagM1∷TnphoA 92 11 439 130 8pagN1∷TnphoA 23 1 58 2 23pagO1∷TnphoA 31 2 54 12 16pagP1∷TnphoA 38 1 27 3 38

^aThe AP activity value is (24) represented according to the unit that Miller defines beta-galactosidase enzymes.This numerical value is represented the result of three experiments that repeat (at every turn establishing two repetitions).PhoP ^*The pag ∷ TnphoA that is illustrated in the CS019 bacterial strain that contains wild-type phoP seat inserts.PhoP ^-The allelic gene bacterial strain that waits of PhoP105 ∷ Tn10 is carried in expression.

^bThe active reduction of AP when the multiple value that enzymic activity reduces represents to obtain invalid phoP105 allelotrope.These numerical value be from the culture of logarithmic phase, calculate and be rounded to nearest integer.

Table 14

Pag ∷ phoA gene fusion influences strain gene type LD to Salmonellas sodoku power ₅₀ ^aMSI ^bReference 14028s wild-type＜20 6.13 25CS015 phoP102 ∷ Tn10-Cam 7.0 * 10 ⁵0.40 25CS585 pagD1 ∷ TnphoA 4.0 * 10 ⁵0.01 15CS1074 pagJ1 ∷ TnphoA 4.0 * 10 ³0.56 this research CS767 pagK1 ∷ TnphoA 9.0 * 10 ⁴0.04 this research CS1845 pagM1 ∷ TnphoA 3.0 * 10 ⁴0.09 this research

^aThe mensuration of 50% lethal dose is to utilize the method for Reed and Muench (31), and 10 mouse of every kind of diluent peritoneal injection are carried out.

^bThe average CFU of Salmonellas that the mensuration of scavenger cell survival index (MSI) obtains the scavenger cell culture (three repetitions are set) that added behind the gentamicin 24 hours removes and adds the average CFU of Salmonellas that obtains in the back 1 hour scavenger cell culture in gentamicin and carry out.16?Kier?et?al.，1979，J.Bacteriol.，138：155-6125?Miller?et?al.，1989，Proc.Natl.Acad.Sci.USA，86：5054-58

Table 15

, / MSIa bATCC14028 3.90 ATCCCS019 phoN2 zxx∷6251Tn10d-Cm ( 31 ) CS585 CS019.pagD∷TnphoA 0.002 ( 4 ) CS586 CS585：phoP105∷Tn10d-Tet ( 4 ) JSG205 ATCC14028.msgA∷MudJ 0.01 JSG225 JSG205.phoP105∷Tn10d-Tet CS811 CS019.envE∷TnphoA CS812 CS811.phoP105∷Tn10d-Tet CS100 ATCC14028.phoP105∷Tn10d-Tet 0.01 TT1320JSG232 JSG205.envF∷pGPP2 JSG234 CS019.envF∷pGPP2 JSG235 JSG234.phoP105∷Tn10d-Tet JSG244 JSG205.phoP105∷Tn10d-Tet CS099 ATCC14028：zxx3024∷Tn10Δ16Δ17pol-2 ( Whitfield polA ) Ty2 Vi FDA ATCC9150 ATCC ATCC13428 ATCC VR1SM10λpir thi-l thr-l leuB6 supE44 tonA21 lacYlrecA∷RP4-2-Tc∷MuDH5c F-φ80dlacZΔM15Δ ( lacZYA-argF ) U169endAlrecAlhsdR17deoRthi-lsupE44λ-

gyrA96relA1 MGH Peruvian MGH MGH MGH MGH MGH MGH MGH pWPL17 pWP0612.8Kb HpaIpBR322 pCAA9 envFTnphoApWPL17 pGP704 pir ( 34 ) pGPP2 envF∷phoApGP704 pWP061 pagC ( 36 )

^aMSI (phage survival index) is that the number of bacteria by will infect back 2 hours time survival calculates divided by infecting the counting of bacterium relevant with cell that exists after 30 minutes.

^bMGH, hospital general, Massachusetts, ATCC, American type culture collection, FDA, Food and Drug Administration, VRI, the 4 Belden et al. of institute of viruses, 1989, Infect.Immun., 57:1-731 Miller et al., 1989, Proc.Natl.Acad.Sci.USA, 86:5054-5834 Miller et al., 1988, J.Bacteriol., 170:2575-8336 pulkkinen et al., 1991, J.Bacteriol., 173:86-93

Table 16

Active aJSG205 msgA:MudJ 461 (B) JSG244 of alkaline phosphatase and beta-galactosidase gene fusion-activity bacterial strain genes involved type gene fusion phoP105 ∷ Tn10d-Tet 415 (B)

msgA：MudJJSG226 envE∷TnphoA 50(A)JSG229 phoP105∷Tn10d-Tet 60(A)

envE∷TnphoAJSG204 pagD∷TnphoA 76(A)JSG225 phoP105∷Tn10d-Tet 9(A)

pagD∷TnphoAJSG234 envF∷pGPP2 16(A)JSG235 phoP105∷Tn10d-Tet 19(A)

envF∷pGPP2JSG232 msgA∷MudJ 10(A)

EnvF ∷ pGPP2 ^a(A) AP (alkaline phosphatase) or (B) β-gal (beta-galactosidase enzymes)

Claims

1, a kind of vaccine, it contains a kind of bacterium, and this bacterium carries out constitutive expression and makes its virulence attenuating owing to being in two composition regulation systems controls gene down.

2, according to the described vaccine of claim 1, wherein said constitutive expression is result that composition is undergone mutation in described pair of composition regulation system.

3, according to the described vaccine of claim 1, wherein said bacterial cell contains second sudden change of lowering virulence.

4, according to the described vaccine of claim 1, wherein said bacterial cell is a salmonella cell, and described pair of composition regulation system is the phoP regulation domain, and described gene is the gene that regulated by the phoP regulation domain.

5, according to the described vaccine of claim 4, wherein said constitutive expression is a results of mutation.

6, according to the described vaccine of claim 5, wherein said sudden change is to be positioned at the phoP regulation domain.

7, according to the described vaccine of claim 6, wherein said sudden change is to be positioned at the phoP gene.

8, according to the described vaccine of claim 6, wherein said sudden change is to be positioned at the phoQ gene.

9, according to the described vaccine of claim 6, wherein said sudden change is phoP ^cSudden change.

10, according to the described vaccine of claim 6, wherein said sudden change is not reversibility sudden change.

11, according to the described vaccine of claim 4, wherein said constitutive expression is the result who changes in the promotor of described regulated gene.

12, according to the described vaccine of claim 4, wherein said gene is the prg gene.

13, a kind of vaccine, it contains salmonella cell, and described salmonella cell is owing to the expression of the virulence gene that regulated by the phoP regulatory region has reduced virulence.

14, according to the described vaccine of claim 13, it is results of mutation that wherein said expression reduces.

15, according to the described vaccine of claim 14, wherein said sudden change is to be positioned at the prgH gene.

16, according to the described vaccine of claim 14, wherein said sudden change is to be positioned at prgA, prgB, prgC or prgE gene.

17, according to the described vaccine of claim 4, wherein said gene is the pag gene.

18, according to the described vaccine of claim 17, wherein said pag seat is the pagC seat.

19, according to the described vaccine of claim 4, it is further characterized in that described salmonella cell comprises first sudden change of lowering virulence and second sudden change of lowering virulence.

20, according to the described vaccine of claim 19, wherein said first sudden change is in phoP regulatory region gene.

21, according to the described vaccine of claim 20, wherein said first sudden change is in the phoP gene.

22, according to the described vaccine of claim 20, wherein said first sudden change is in the phoQ gene.

23, according to the described vaccine of claim 20, wherein said first sudden change is a kind of phoP ^cSudden change.

24, according to the described vaccine of claim 19, wherein said first sudden change is in the gene that regulated by the phoP regulatory region.

25, according to the described vaccine of claim 19, wherein said second sudden change is a sudden change in the die aromatischen Aminosaeuren synthetic gene.

26, according to the described vaccine of claim 25, wherein said second sudden change is an aro sudden change.

27, according to the described vaccine of claim 19, wherein said second sudden change is to be positioned at the gene that regulated by the phoP regulation domain.

28, according to the described vaccine of claim 23, wherein said second sudden change is in the prg seat.

29, according to the described vaccine of claim 13, be further characterized in that described salmonella cell contains two mutator genes, lower first mutator gene of virulence and second mutator gene that lowers virulence.

30, according to the described vaccine of claim 29, wherein said second gene is in the prg seat.

31, according to the described vaccine of claim 30, wherein said gene is prgH.

32, according to the described vaccine of claim 30, wherein said gene is prgA, prgB, prgC or prgE.

33, according to the described vaccine of claim 27, wherein said second sudden change is in the pag seat.

34, according to the described vaccine of claim 27, wherein said second sudden change is the pagC sudden change.

35, according to the described vaccine of claim 4, wherein said Salmonellas is the kind of salmonella typhi.

36, according to the described vaccine of claim 4, wherein said Salmonellas is a kind of Salmonella enteritidis and is salmonella typhimurium strain.

37, according to the described vaccine of claim 4, wherein said Salmonellas is Salmonella choleraesuls.

38, according to the described vaccine of claim 4, wherein said vaccine is a live vaccine.

39, a kind of vaccine, it contains bacterial cell, and two composition regulation systems controls gene down that is in of this cell is undergone mutation and is made its virulence attenuating.

40, according to the described vaccine of claim 39, its feature is that also described bacterial cell contains a sudden change of lowering virulence at second gene.

41, according to the described vaccine of claim 39, wherein said bacterial cell is that salmonella cell and described pair of composition regulation system are the phoP regulatory regions.

42, according to the described vaccine of claim 41, wherein said gene is the prg gene.

43, according to the described vaccine of claim 41, wherein said gene is prgH.

44, according to the described vaccine of claim 41, wherein said gene is prgA, prgB, prgC or prgE.

45, according to the described vaccine of claim 41, wherein said gene is the pag gene.

46, according to the described vaccine of claim 45, wherein said gene is pagC.

47, according to the described vaccine of claim 41, wherein said bacterial cell also contains a kind of sudden change in second gene, and described sudden change is lowered the virulence of described bacterial cell.

48, according to the described vaccine of claim 47, wherein said second gene is a kind of die aromatischen Aminosaeuren biosynthesis gene.

49, according to the described vaccine of claim 48, wherein said second gene is a kind of aro gene.

50, a kind of vaccine that contains salmonella cell, described cell have first sudden change of lowering virulence and second sudden change of lowering virulence are arranged in phoP regulatory region gene in a die aromatischen Aminosaeuren biosynthesis gene.

51, according to the described vaccine of claim 50, wherein said first sudden change is in the aro gene.

52, according to the described vaccine of claim 51, wherein said second sudden change is a kind of phoP sudden change.

53, a kind of bacterial cell, its composing type ground are expressed a kind of gene that is under two composition regulation system controls, and contain a sudden change of lowering virulence, and this sudden change can not cause being in the said pair of gene under the control of composition regulation system and carry out constitutive expression.

54, according to the described bacterial cell of claim 53, a kind of composition that further is included in the described pair of composition regulation system is undergone mutation.

55, according to the described bacterial cell of claim 53, wherein said cell is a salmonella cell, the gene that regulated by the phoP regulatory region is expressed on this groups of cells moulding ground, and include a sudden change of lowering virulence, the gene that this sudden change can not cause being under the control of phoP regulatory region carries out constitutive expression.

56, according to the described bacterial cell of claim 55, wherein said constitutive expression is undergone mutation by the phoP regulatory region and is caused.

57, according to the described bacterial cell of claim 55, wherein said constitutive expression is to be caused by the sudden change in the phoP gene.

58, according to the described bacterial cell of claim 55, wherein said constitutive expression causes by undergoing mutation in the phoQ gene.

59, according to the described bacterial cell of claim 56, wherein said sudden change is the phoPc sudden change.

60, according to the described bacterial cell of claim 56, wherein said sudden change is a kind of disappearance.

61,, be further characterized in that described attenuating virulence sudden change is in the die aromatischen Aminosaeuren synthetic gene according to the described bacterial cell of claim 55.

62, according to the described bacterial cell of claim 61, wherein said attenuating virulence sudden change is a kind of aro sudden change.

63, according to the described bacterial cell of claim 55, the sudden change of wherein said attenuating virulence is in phoP regulatory region gene.

64, according to the described bacterial cell of claim 63, wherein said attenuating virulence sudden change is the phoP gene.

65, according to the described bacterial cell of claim 63, wherein said attenuating virulence sudden change is in the phoQ gene.

66, according to the described bacterial cell of claim 55, wherein said attenuating virulence sudden change is in the prg seat.

67, according to the described bacterial cell of claim 66, wherein said attenuating virulence sudden change is in the prgH gene.

68, according to the described bacterial cell of claim 66, wherein said attenuating virulence sudden change is in prgA, prgB, prgC or prgE gene.

69, according to the described bacterial cell of claim 55, wherein said attenuating virulence sudden change is in the pag seat.

70, according to the described bacterial cell of claim 55, wherein said attenuating virulence sudden change is a kind of pagC sudden change.

71, according to the described bacterial cell of claim 55, wherein said cell is a kind of salmonella typhi.

72, according to the described bacterial cell of claim 55, wherein said cell is a kind of Salmonella enteritidis and is salmonella typhimurium strain.

73, according to the described bacterial cell of claim 55, wherein said salmonella cell is Salmonella choleraesuls.

74, a kind of bacterial cell, it has the sudden change of lowering virulence in the gene that regulated by the phoP regulatory region.

75, according to the described bacterial cell of claim 74, wherein said bacterial cell is a salmonella cell, and the sudden change of described attenuating virulence is in the gene that regulated by the phoP regulatory region.

76, according to the described bacterial cell of claim 75, wherein said gene is the prg gene.

77, according to the described bacterial cell of claim 76, wherein said gene is the prgH gene.

78, according to the described bacterial cell of claim 76, wherein said gene is prgA, prgB, prgC or prgE gene.

79, according to the described bacterial cell of claim 75, wherein said gene is the pag gene.

80, according to the described bacterial cell of claim 29, wherein said gene is pagC.

81, according to the described bacterial cell of claim 74, further comprise second sudden change, this sudden change is lowered virulence but is not caused being subjected to the gene of phoP regulatory region adjusting to carry out constitutive expression.

82,1 described bacterial cell according to Claim 8, wherein said second sudden change is in the die aromatischen Aminosaeuren synthetic gene.

83,2 described bacterial cells according to Claim 8, wherein said second sudden change are a kind of aro sudden changes.

84,1 described bacterial cell according to Claim 8, wherein said second sudden change is in phoP regulatory region gene.

85,4 described bacterial cells according to Claim 8, wherein said second sudden change is in the phoP seat.

86,4 described bacterial cells according to Claim 8, wherein said second sudden change is in the phoQ seat.

87,1 described bacterial cell according to Claim 8, wherein said second sudden change is in the gene that regulated by the phoP regulatory region.

88,7 described bacterial cells according to Claim 8, wherein said second sudden change is in the pag seat.

89, according to the described bacterial cell of claim 75, wherein said cell is a kind of salmonella typhi.

90, according to the described bacterial cell of claim 75, wherein said cell is a kind of Salmonella enteritidis and is salmonella typhimurium strain.

91, according to the described bacterial cell of claim 75, wherein said cell is a kind of Salmonella choleraesuls.

92, a kind of salmonella cell of work has wherein inserted a proteinic gene of coding stem, the adjusting composition of perhaps described heterologous protein gene in a kind of virulence gene.

93, according to the described Salmonellas viable cell of claim 92, wherein said virulence gene is at the phoP regulatory region.

94, according to the described Salmonellas viable cell of claim 94, wherein said virulence gene is the gene that a kind of phoP of being subjected to regulatory region is regulated.

95, according to the described Salmonellas viable cell of claim 94, wherein said virulence gene is the prgH gene.

96, according to the described Salmonellas viable cell of claim 95, wherein said virulence gene is the prgH gene.

97, according to the described Salmonellas viable cell of claim 95, wherein said virulence gene is prgA, prgB, prgC or prgE gene.

98, according to the described Salmonellas viable cell of claim 94, wherein said virulence gene is the pag gene.

99, according to the described Salmonellas viable cell of claim 98, wherein said pag gene is pagC.

100, according to the described Salmonellas viable cell of claim 92, wherein said salmonella cell carries second sudden change of lowering virulence.

101, according to the described Salmonellas viable cell of claim 100, wherein said second sudden change is a kind of aro sudden change.

102, according to the described Salmonellas viable cell of claim 92, the DNA of wherein said coding heterologous protein is in the promotor that regulated by environment and controls down.

103, according to the described Salmonellas viable cell of claim 92, wherein said Salmonellas is a kind of salmonella typhi.

104, according to the described Salmonellas viable cell of claim 92, further contain being in of promising T7 polysaccharase coding and be subjected to dna sequence dna under the promotor control that environment regulates, and a kind of T7 transcribes the susceptibility promotor, and described T7 transcribes the expression that the susceptibility promotor is controlled described heterologous antigen.

105, a kind of carrier that can be incorporated in the Salmonellas karyomit(e) comprises

First dna sequence dna of coding heterologous protein, second dna sequence dna of a kind of marker of encoding, and necessary the third dna sequence dna that is subjected to the gene product of phoP regulatory region adjusting of coding maintenance virulence, described the third dna sequence dna is because of the inactivation of undergoing mutation.

106, according to the described carrier of claim 105, the gene that the wherein said phoP of being subjected to regulatory region is regulated is a kind of prg seat.

107, according to the described carrier of claim 106, wherein said gene is prgH.

108, according to the described carrier of claim 106, wherein said gene is prgA, prgB, prgC or prgE.

109, according to the described carrier of claim 105, the gene that the wherein said phoP of being subjected to regulatory region is regulated is the pag seat.

110, according to the described carrier of claim 109, wherein said pag seat is pagC.

111, according to the described carrier of claim 105, the location of wherein said first dna sequence dna on described carrier can make described the 3rd dna sequence dna inactivation of undergoing mutation.

112, according to the described carrier of claim 105, wherein said carrier can not duplicate in the wild type salmonella bacterial strain.

113, according to the described carrier of claim 105, first dna sequence dna of wherein said coding heterologous protein is under the promotor control that is subjected to the environment adjusting.

114, according to the described carrier of claim 105, comprise further being in a kind of dna sequence dna of being subjected to the coding T7 polysaccharase under the promotor control that environment regulates and a kind of T7 being transcribed responsive promotor that described T7 transcribes the expression that the susceptibility promotor is controlled first dna sequence dna of described coding heterologous protein.

115, make it to have the method for opposing by bacterial disease for a kind of animal immune inoculation, this method comprises uses the described vaccine of claim 1.

116, according to the described method of claim 115, wherein said bacterium is a Salmonellas, and described vaccine is the described vaccine of claim 4.

117, make it to resist method by bacterial disease for a kind of animal inoculation pvaccination, described method comprises uses the described vaccine of claim 39.

118, according to the described method of claim 115, wherein said bacterium is that Salmonellas and described vaccine are the described vaccines of claim 41.

119, make it to resist method by salmonellal disease for a kind of animal inoculation pvaccination, this method comprises the vaccine of using claim 50.

120, a kind of carrier contains the DNA of coding pagC gene product.

121, the cell that contains the described carrier of claim 120.

122, produce the method for pagC gene product, comprise and cultivate the described cell of claim 121 and from described cell or substratum, be purified into the pagC gene product.

123, a kind of purifying preparation of pagC gene product.

124, in a kind of sample, detect the method that Salmonellas exists, comprise described sample is contacted with coding pagC DNA, and detect the DNA of described coding pagC and the hybridization that described sample amplifying nucleic acid is carried out.

125, a kind of carrier that contains the DNA of coding prgH gene product.

126, the cell that contains the described carrier of claim 125.

127, the method for preparing the prgH gene product comprises and cultivates the described cell of claim 126 and be purified into the prgH gene product from described cell or substratum.

128, a kind of purifying preparation of prgH gene product.

129, the method that has Salmonellas in the test sample, this method comprise the DNA of described sample with coding prgH are contacted, and detect the DNA of described coding prgH and the hybridization of described sample amplifying nucleic acid.

130, a kind of method that makes the bacterium attenuation, described bacterium contains a kind of pair of composition regulation system, and this method comprises makes the gene that is under the control of described two one-tenth sub-system carry out constitutive expression.

131, according to the described method of claim 124, wherein said bacterium is a Salmonellas, and described two one-tenth sub-system is the phoP regulatory region.

First sudden change has taken place in 132, a kind of bacterial cell in the phoP regulon of this bacterium, second sudden change has taken place in the die aromatischen Aminosaeuren synthetic gene and make the bacterium attenuation.

133, according to the described bacterial cell of claim 132, wherein said bacterial cell is a salmonella cell.

134, according to the described salmonella cell of claim 133, wherein said salmonella cell is a salmonella typhimurium cell.

135, according to the described salmonella cell of claim 133, wherein said salmonella cell is a Salmonella enteritidis.

136, according to the described salmonella cell of claim 135, wherein said salmonella cell is a Salmonella pylorum cell.

137, according to the described salmonella cell of claim 135, wherein said salmonella cell is the Salmonella paratyphi A cell.

138, according to the described salmonella cell of claim 135, wherein said salmonella cell is the moscow' paratyphi B cell.

139, according to the described salmonella cell of claim 133, wherein said salmonella cell is the Salmonella choleraesuls cells.

140, according to the described salmonella cell of claim 133, wherein said salmonella cell is the Salmonella typhimurium mycetocyte.

141, according to the described bacterial cell of claim 133, wherein said first sudden change contains the not reversibility null mutation that is arranged in the phoP/phoQ seat.

142, according to the described bacterial cell of claim 141, wherein said sudden change comprises and has lacked 100 Nucleotide at least.

143, according to the described bacterial cell of claim 142, wherein said sudden change comprises and has lacked 500 Nucleotide at least.

144, according to the described bacterial cell of claim 143, wherein said sudden change comprises and has lacked 750 Nucleotide at least.

145, according to the described bacterial cell of claim 144, wherein said sudden change is included in the described phoP/phoQ seat and has lacked 376-1322 position Nucleotide.

146, according to the described bacterial cell of claim 141, wherein said second sudden change is included in the AroA seat one not reversibility null mutation.

147, according to the described bacterial cell of claim 141, wherein said second sudden change is included in the AroC/AroD seat one not reversibility null mutation.

148, according to the described bacterial cell of claim 146, further be included in a sudden change in the non-aromatic amino acid synthetic gene, wherein said sudden change provides the amino acid whose auxotroph of described non-aromatic for described cell.

149, according to the described bacterial cell of claim 148, wherein said amino acid is Histidine.

150, according to the described bacterial cell of claim 149, wherein said salmonella typhi has genotype AroA ^-, His ^-, phoP/phoQ ^-

151, according to the described bacterial cell of claim 150, wherein said salmonella typhi is TyH445.

152, according to the described bacterial cell of claim 134, wherein said first sudden change be included in the phoP/phoQ seat can not answer type null mutation.

153, according to the described bacterial cell of claim 152, wherein said sudden change comprises the disappearance of the 376-1322 position Nucleotide at described phoP/phoQ seat.

154, according to the described bacterial cell of claim 152, wherein said second sudden change comprises the not reversibility null mutation that is arranged in the AroA seat.

155, according to the bacterial cell of claim 154, further be included in a sudden change in the non-aromatic amino acid synthetic gene, wherein said sudden change provides the amino acid whose auxotroph of described non-aromatic for described cell.

156, a kind of vaccine that contains the described bacterial cell of claim 132.

157, a kind of DNA of purifying basically, it contains the sequence of the pagD that encodes.

158, according to the described DNA of claim 157, wherein said sequence comprises the 91-354 position Nucleotide of SEQ ID NO:5.

159,, further comprise the 4-814 position Nucleotide of SEQ ID NO:15 according to the described DNA of claim 158.

160, a kind of DNA of purifying basically, it comprises the 4-814 position Nucleotide of SEQ ID NO:15.

161, according to the described DNA of claim 160, wherein said dna sequence dna comprises the 562-814 position Nucleotide of SEQ IDNO:15.

162, according to the described DNA of claim 160, wherein said dna sequence dna comprises the 4-776 position Nucleotide of SEQ IDNO:15.

163, according to described DNA of claim 158 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contain the aminoacid sequence that provides basically in SEQ ID NO:6.

164, a kind of DNA of purifying basically includes the sequence of the envE that encodes.

165, according to the described DNA of claim 164, wherein said sequence contains the 1114-1650 position Nucleotide of SEQ ID NO:5.

166, described DNA of claim 165 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product have the aminoacid sequence that provides among the SEQ ID NO:7 basically.

167, a kind of DNA of purifying basically, this DNA contain the sequence of the msgA that encodes.

168, according to the described DNA of claim 167, wherein said sequence contains the 1825-2064 position Nucleotide of SEQ ID NO:5.

169,, further contain the 1510-1824 position Nucleotide of SEQ ID NO:5 according to the described DNA of claim 168.

170, a kind of DNA of purifying basically comprises the 1510-1760 position Nucleotide of SEQ ID NO:5.

171, described DNA of claim 168 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contain the aminoacid sequence that provides among the SEQ ID NO:8 basically.

172, a kind of DNA of purifying basically, it comprises the sequence of the envF that encodes.

173, according to the described DNA of claim 172, wherein said sequence contains the 2554-3294 position Nucleotide of SEQ ID NO:5.

174,, further comprise the 2304-2553 position Nucleotide of SEQ ID NO:5 according to the described DNA of claim 173.

175, described DNA of claim 173 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contain the aminoacid sequence that provides among the SEQ ID NO:9 basically.

176, a kind of DNA of purifying basically, it contains sequence or its fragment that provides among the SEQ ID NO:5.

177, a kind of DNA of purifying basically, it contains sequence or its fragment that provides among the SEQ ID NO:10.

178, a kind of DNA of purifying basically, it contains the sequence of the prgH that encodes.

179, according to the described DNA of claim 178, wherein said sequence contains the 688-1866 position Nucleotide among the SEQ ID NO:10.

180,, further contain the 1-689 position Nucleotide of SEQ ID NO:10 according to the described DNA of claim 179.

181, described DNA of claim 179 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contain the aminoacid sequence that provides among the SEQ ID NO:11 basically.

182, a kind of DNA of purifying basically, it contains the sequence of the prgI that encodes.

183, according to the described DNA of claim 182, wherein said sequence comprises the 1891-2133 position Nucleotide of SEQ ID NO:10.

184,, also contain the 1-689 position Nucleotide of SEQ ID NO:10 according to the described DNA of claim 183.

185, described DNA of claim 183 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contains the aminoacid sequence of SEQ ID NO:12 basically.

186, a kind of DNA of purifying basically, it contains the sequence of the prgJ that encodes.

187, according to the described DNA of claim 186, wherein said sequence comprises the 2152-2457 position Nucleotide of SEQ ID NO:10.

188,, further contain the 1-689 position Nucleotide of SEQ ID NO:10 according to the described DNA of claim 187.

189, the DNA of claim 187 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contain the aminoacid sequence that provides among the SEQ ID NO:13 basically.

190, a kind of DNA of purifying basically, it contains the sequence of the prgK that encodes.

191, according to the described DNA of claim 190, wherein said sequence contains the 2456-3212 position Nucleotide of SEQ ID NO:10.

192,, further comprise the 1-689 position Nucleotide of SEQ ID NO:10 according to the described DNA of claim 191.

193, the DNA of claim 191 and degeneracy varient thereof, a kind of product of wherein said sequence encoding, this product contain the aminoacid sequence that provides among the SEQ ID NO:14 basically.

Sudden change has taken place and has made this bacterium attenuation in 194, a kind of bacterial cell in being selected from one or more genes of pagD, pagE, pagF, pagG, pagH, pagI, pagJ, pagK, pagL, pagM, pagN, pagP, envE and envF.

Sudden change has taken place and bacterial virulence is lowered at the one or more genes that are selected from pagC, pagD, pagJ, pagK, pagM and msgA in 195, a kind of bacterial cell.

Sudden change has taken place and bacterial virulence is lowered in 196, a kind of bacterial cell in being selected from one or more genes of prgH, prgI, prgJ and prgK.