CN113082196B - Repairing agent for promoting wound healing of type 2 diabetes - Google Patents
Repairing agent for promoting wound healing of type 2 diabetes Download PDFInfo
- Publication number
- CN113082196B CN113082196B CN202110466877.XA CN202110466877A CN113082196B CN 113082196 B CN113082196 B CN 113082196B CN 202110466877 A CN202110466877 A CN 202110466877A CN 113082196 B CN113082196 B CN 113082196B
- Authority
- CN
- China
- Prior art keywords
- adipose
- stem cells
- mice
- diabetes
- npy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/22—Hormones
- A61K38/2271—Neuropeptide Y
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/14—Drugs for dermatological disorders for baldness or alopecia
Abstract
The invention provides a repairing agent for promoting wound healing of type 2 diabetes, and belongs to the technical field of diabetes. The repairing agent provided by the invention consists of a low-concentration NPY solution and adipose-derived stem cells, and the wound of a type 2 diabetic mouse can be quickly and efficiently repaired by using the repairing agent. In addition, the repairing agent provided by the invention can effectively promote the generation and the growth of hair follicles at wounds, can effectively inhibit the expression of proinflammatory genes IL-1 and TNF-alpha, and can promote the expression of inflammation-inhibiting genes VEGF and TGF-beta.
Description
Technical Field
The invention belongs to the technical field of diabetes, and particularly relates to a repairing agent for promoting wound healing of type 2 diabetes.
Background
Wound healing is a complex process involving inflammation, proliferation and tissue remodeling, and is also highly regulated by various growth factors and cytochemokines. The current research proves that the chronic wound of the diabetic cannot be effectively controlled by a single administration treatment method, so that the research and the development of a novel repairing agent for promoting the wound healing of the type 2 diabetes mellitus patient have important significance for realizing the rapid healing of the wound of the type 2 diabetes mellitus patient.
Disclosure of Invention
The present invention aims to provide a repairing agent for promoting the healing of type 2 diabetes wounds.
In order to realize the purpose, the invention provides the following technical scheme:
the invention provides an application of a reagent for detecting the expression quantity of neuropeptide Y mRNA in the preparation of a kit for differentially detecting adipose-derived stem cells derived from normal sources and adipose-derived stem cells derived from type 2 diabetes, wherein the reagent is a primer for detecting the expression quantity of neuropeptide Y mRNA, and the sequence of the primer is as follows:
an upstream primer: 5' GGGGCCGGACTGTATTTACT-3
A downstream primer: 5 'ATGCTAGGTAACAAGCGAATGG-3'.
Secondly, the invention provides application of neuropeptide Y in preparing an adipose-derived stem cell growth factor VEGF, TGF-beta, HGF expression and secretion promoter, and is characterized in that the concentration of the neuropeptide Y is 10 -13 M。
The invention also provides a preparation method of the promoter, and the promoter is used for promoting hair follicle generation and hair follicle growth of type 2 diabetes patients.
Preferably, the number of the adipose stem cells of the normal origin per 200 μ l of the promoter is 5 × 10 5 The concentration of the neuropeptide Y solution is 10 -11 M。
Fourthly, the invention provides application of a composition containing normal adipose-derived stem cells and a neuropeptide Y solution in preparation of an inhibitor for expression of proinflammatory genes IL-1 and TNF-alpha.
The invention also provides application of the composition containing the normal adipose-derived stem cells and the neuropeptide Y solution in preparing an anti-inflammatory gene VEGF and TGF-beta expression promoter.
Preferably, the number of the normally derived adipose stem cells is 5 x 10 per 200 μ l of the composition 5 The concentration of the neuropeptide Y solution is 10 -11 M。
The invention further provides an application of the composition containing the adipose-derived stem cells and the neuropeptide Y solution in preparation of the type 2 diabetes wound healing repair agent.
Preferably, the number of the normally derived adipose stem cells is 5 x 10 per 200 μ l of the composition 5 The concentration of the neuropeptide Y solution is 10 -11 M。
Seventhly, the invention provides an accelerant for promoting wound healing of a type 2 diabetic patient, wherein the active ingredients of the accelerant are adipose-derived stem cells and a neuropeptide Y solution;
the number of the adipose stem cells of the normal source in the promoter is 5 x 10 per 200 mu l 5 The concentration of the neuropeptide Y solution is 10 -11 M。
Eighthly, the application of the neuropeptide Y in preparing the skin fibroblast proliferation and migration accelerant is characterized in that the concentration of the neuropeptide Y is 10 -13 M。
The beneficial effects of the invention are:
the invention discovers that NPY gene is differentially expressed in mouse adipose-derived stem cells and type 2 diabetes mouse adipose-derived stem cells, and NPY is low expressed in the type 2 diabetes mouse adipose-derived stem cells, so that whether the stem cells are from normal individuals or type 2 diabetes individuals can be identified by detecting the expression quantity of NPY in the adipose-derived stem cells, and whether the individuals suffer from type 2 diabetes can be detected by detecting the adipose-derived stem cells;
meanwhile, the present inventors have found that NPY is present at a low concentration of 10 -13 M, the compound can effectively promote the secretion and expression of growth factors VEGF, TGF-beta and HGF in the adipose-derived stem cells, so that the low-concentration NPY can be used for preparing the secretion and expression promoters of the growth factors VEGF, TGF-beta and HGF in the adipose-derived stem cells;
in addition, the combination of the NPY and the adipose-derived stem cells can effectively promote hair follicle generation and hair follicle growth, inhibit the expression of proinflammatory genes IL-1 and TNF-alpha, promote the expression of inflammation-inhibiting genes VEGF and TGF-beta and promote wound healing, so that the composition prepared from the NPY and the adipose-derived stem cells can be used for preparing a promoter for promoting hair follicle generation and hair follicle growth of a type 2 diabetes patient, preparing an expression inhibitor of the proinflammatory genes IL-1 and TNF-alpha and preparing a type 2 diabetes wound healing repair agent.
Drawings
Figure 1 results of glucose tolerance experiments: a is the blood sugar level of the mouse after glucose injection, and B is the statistical analysis of the area of the curve;
figure 2 results of insulin resistance experiments: a is the blood sugar level of the mouse after insulin injection, B is the area statistical analysis on the curve;
FIG. 3 the difference in expression of NPY in normal mouse-derived adipose stem cells and type 2 diabetic mouse-derived adipose stem cells;
FIG. 4 the differences in the secretion and expression of VEGF, TGF-. Beta.and HGF three growth factors after NPY treatment: A-C is the change of the secretion of three growth factors of VEGF, TGF-beta and HGF after NPY treatment with different concentrations;
D-F is the change of the expression quantity of three growth factors of VEGF, TGF-beta and HGF after NPY treatment with different concentrations;
figure 5 effect of NPY on cell proliferation: a is the growth curve of mouse adipose-derived stem cells, B is the growth curve of mouse fibroblasts;
FIG. 6 effect of NPY at different concentrations on migration velocity of skin fibroblasts: a is a scratch picture of skin fibroblasts, and B is the skin fibroblast scratch healing rate;
figure 7 effect of adipose stem cells and NPY in combination on skin wound healing: a is a photograph of wounds of 4 groups of mice within 12 days, and B is the healing rate of the wounds of the 4 groups of mice within 12 days;
figure 8 effect of adipose stem cells and NPY in combination on wound skin adjunct production: a is HE staining of granulation tissues of 4 groups of mice; b is the number of hair follicles of granulation tissues of 4 groups of mice; c is the hair follicle length of granulation tissue of 4 groups of mice;
figure 9 effect of adipose stem cells and NYP in combination on inflammatory response: a is the expression difference of IL-1 in the granulation tissue of the wound; b is the differential expression of TNF-a in wound granulation tissue; c is the difference in VEGF expression in wound granulation tissue; d is the expression difference of TGF-beta in the granulation tissue of the wound.
Detailed Description
In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.
Example 1 establishment of mouse model for type 2 diabetes
(1) 100C 57BL/6 male mice are purchased from Beijing Wintonlihua laboratory animal company, the mice are about 4 weeks old, after the mice arrive at a mouse house, the mice are fed with common feed for one week, the mice gradually adapt to the environment of the mouse house, and the mice are allowed to drink water and eat food freely in the environment with constant temperature of 25 ℃, moderate humidity and alternating light and shade;
(2) Randomly dividing into two groups after 1 week, wherein 50 patients in type 2 diabetes (T2D group) are fed with high-sugar and high-fat feed; a normal control group (CHOW group) of 50 animals, fed with normal basal diet;
(3) After the mice are fed in groups, recording the weight change of the mice at a fixed time every week, and when the weights of the two groups of mice are obviously different, starting to measure the blood sugar of the mice at a fixed time every morning every week and recording the numerical value change of the blood sugar and the weights of the mice;
(4) When the mice were raised for 22 weeks, there was a significant difference in blood glucose levels between the two groups, and the blood glucose levels of the type 2 diabetic mice increased, and STZ injection was initiated on the T2D group of mice. Injecting the mice in the T2D group into the abdominal cavity of each mouse according to the weight of each mouse and the concentration of 40 mg/kg STZ, continuously injecting for 3D, and detecting the blood sugar of the mice by a tail tip blood sampling method at the 3 rd after injection, and performing glucose tolerance and insulin resistance experiments on the two groups of mice when the detected blood sugar is higher than 220 mg/ml;
(5) When the T2D group mice have glucose tolerance difference and insulin resistance phenomena, the mice can be judged to be established as type 2 diabetes mouse models, and then experiments of isolated culture of adipose-derived stem cells and wound model establishment and treatment can be carried out on the two groups of mice.
The experimental results are shown in fig. 1 and fig. 2, and it can be seen that the T2D group mice have glucose tolerance differences and insulin resistance phenomena, and thus, the model construction is successful.
Example 2
Separating and culturing mouse fat stem cell and fibroblast
(1) Adipose-derived stem cells: c57BL/6 mice and T2D mice are killed by removing necks, the mice are disinfected by 75% alcohol, the abdomens of the mice are carefully cut open by using sterilized scissors and tweezers to avoid the hair of the mice so as to avoid the contamination of the adipose tissues with bacteria, the white adipose tissues around the epididymis of the mice are carefully clamped by using the tweezers, and the mice are immediately put into physiological saline;
(2) (ii) a Fibroblast cell: killing the mice within one day of birth, soaking in 75% ethanol for 5min, carefully shearing skin tissues on the backs of the mice by using sterilized scissors and tweezers, and putting the mice into physiological saline containing double antibodies;
(3) Placing the adipose tissues and skin tissues of a mouse into an ultra-clean workbench for operation treatment, washing the mouse adipose tissues and the skin tissues for 3 times by using 0.9% physiological saline (containing double antibodies), washing away grease on the surface of the adipose tissues, removing other tissues such as epididymis, blood vessels and the like in the tissues, then cutting the tissues into minced meat, and carefully transferring the tissues into a 15 ml sterile centrifuge tube by using a sterile pipette;
(4) Adding collagenase I with the volume 2 times that of a centrifugal tube, sealing a bottle opening with a sealing film, placing the centrifugal tube in a water bath kettle at 37 ℃ for tissue digestion, manually shaking and shaking the centrifugal tube at intervals of 5min for full contact reaction of the collagenase and fat or skin tissues, wherein the digestion time of the fat tissues is about 20 min (the digestion time of the skin tissues is about 30 min) until no larger tissue blocks exist in the centrifugal tube;
(5) Immediately adding an equal volume of culture medium to terminate digestion after digestion is completed, centrifuging for 5min at 1 r/min, carefully sucking the supernatant in a centrifuge tube, retaining the cell mass at the bottom, adding 4ml of fresh cell culture solution to resuspend cells, gently blowing, mixing uniformly, sieving with a 200-mesh cell sieve (skin tissue does not need to be sieved), carefully inoculating the uniformly mixed cells into a 6 cm2 culture dish by using a pipette, gently blowing, mixing uniformly mixed cell solution, and placing at 37 ℃ and 5% CO 2 Culturing in an incubator to obtain the adipose-derived stem cells and the fibroblasts.
Example 3 measurement of the expression difference of NPY in Normal mouse-derived adipose Stem cells and type 2 diabetic mouse-derived adipose Stem cells
1. Adipose-derived stem cell RNA extraction
(1) Cell extraction: carefully absorbing the culture solution by using a pipette gun, washing the culture solution for 2 times by using a phosphate buffer solution, directly adding 600 microliters of lysis solution into a culture dish, carefully blowing the lysis solution by using the pipette gun to fully lyse the cells, and adding the lysate to a DNA removal column; tissue extraction: approximately weighing 20-30 mg of mouse tissue, placing the mouse tissue into a 1.5 ml RNase free centrifuge tube, adding 600 mul of lysate, and grinding the tissue at a high speed by using an electric tissue grinder for about 1 min to avoid RNA degradation as much as possible in the grinding process. Placing the ground tissue homogenate into a refrigerated centrifuge, centrifuging at 13000 rpm for 3 min, carefully sucking the tissue supernatant by a pipette gun and adding the tissue supernatant to a DNA removal column;
(2) Centrifuging at 13000 rpm for 60 s, and reserving filtrate;
(3) Accurately measuring the volume of the filtrate, adding 70% ethanol, and carefully blowing and mixing with a pipette without centrifugation;
(4) Adding the mixed liquid into an RA adsorption column twice, centrifuging at 13000 rpm for 30 s and then discarding the waste liquid, wherein each time is not more than 600 mul;
(5) Adding 700 mul of deproteinizing liquid RW1, standing at room temperature for 1 min, centrifuging at the rotating speed of 12000 rpm for 30 s, and discarding waste liquid;
(6) Washing liquor is repeatedly carried out for two times, 500 microliters of rinsing liquor RW is added, centrifugation is carried out for 30 s at the rotating speed of 12000 rpm, and waste liquor is discarded;
(7) Putting the RA adsorption column into a new 1.5 ml centrifuge tube again, centrifuging at 13000 rpm for 2 min, and removing rinsing liquid as much as possible;
(8) Placing the rinsed adsorption column RA into a clean RNase free centrifuge tube, carefully adding 30 mul of RNase free water to the middle part of an adsorption film, placing the adsorption film at room temperature, standing for 1 min, and centrifuging at the rotating speed of 12000 rpm for 1 min to obtain RNA of cells or tissues;
(9) And subpackaging the extracted RNA into a plurality of 200 microliter centrifuge tubes, and storing in a refrigerator at-80 ℃ for conveniently measuring the RNA concentration, running electrophoresis and reverse transcription.
Reverse transcription of RNA
(1) DNA reaction for genome removal
The reaction mixture was prepared on ice with the following ingredients, the order of addition was noted, and finally the sample RNA was added to avoid degradation. Mixing, centrifuging at low speed, and treating at 42 deg.C for 2 min.
| Reagent | Amount of the |
| 5×gDNA Eraser Buffer | 2.0 µl |
| gDNA Eraser | 1.0 µl |
| Total RNA | |
| RNase Free H 2 O | up to 10 µl |
(2) Reverse transcription reaction
The reverse transcription preparation liquid is carried out on ice, and the reverse transcription is carried out after soft and uniform mixing. The reaction sequence was 37 deg.C, 15min, 85 deg.C, 5s, 4 deg.C, 5 min.
| Reagent | Amount of the use |
| (1) Reaction solution of (1) | 10.0 µl |
| PrimeScript RT Enzyme Mix I | 1.0 µl |
| |
1 |
| 5× |
4 µl |
| RNase Free H 2 O | 4 µl |
| Total | 20µl |
After reverse transcription, the concentration of ssDNA is measured, and the concentration of the DNA is diluted to 100-200 ug/mul for qPCR experiment.
3. Quantitative PCR detection
(1) The method comprises the steps of calculating the positions of a sample and a gene by using a specific 96-well plate, setting an internal reference gene for comparison, repeating the steps for three times in each group, preparing PCR reaction liquid, wherein the volume of the whole reaction system is 10 mu l, uniformly mixing reaction liquid which is not suitable for degradation in advance in order to improve the experiment efficiency in the experiment process, and finally adding a DNA template. Firstly, uniformly mixing 5 mul SYBR Premix Ex Taq (Tli RNaseH Plus) 2x, 0.4 mul PCR Primer and 3.2 mul dH2O per well, adding 9 mul mixed liquor into each well, and finally adding 1 mul DNA template, wherein the whole operation needs to be carried out on ice in a dark place, so as to prevent the degradation and pollution of samples.
(2) Reaction procedure for performing PCR: PCR preliminary activation, 95 ℃ for 2 min → cycle denaturation, 95 ℃ for 5s, annealing extension, 60 ℃ for 10 s,40 cycles → 95 ℃ for 5s,60 ℃ for 1 min,95 ℃ → cooling, 50 ℃,30 s;
(3) The primer sequences for NPY are as follows:
the experimental result is shown in fig. 3, the expression of mRNA of NPY in T2D mouse adipose-derived stem cells is significantly lower than that of mRNA in normal control mouse adipose-derived stem cells, so that whether stem cells are derived from normal individuals or type 2 diabetes individuals can be detected by detecting the expression level of NPY, and whether individuals suffer from type 2 diabetes can be detected by detecting adipose-derived stem cells.
EXAMPLE 4 Effect of different concentrations of NPY on the secretion and expression of growth factor in adipose-derived stem cells
(1) Culturing adipose-derived stem cells of normal mice to P3 generation, inoculating to six-well plate at the same density, dividing into three groups, adding low serum culture medium as control, and adding NPY concentration of 10 into the other two groups -9 M、10 -13 Low serum medium of M
(2) Culturing the P3 generation mouse fat stem cell for 3 days, collecting the cell supernatant, detecting the concentration of various growth factors in the supernatant by using a kit, simultaneously extracting cell RNA, detecting the change of the expression quantity of the three growth factors in the cell, wherein the RNA extraction and detection are carried out in the same way as the 3,VEGF, TGF-beta and HGF primer sequences as follows:
the experimental results are shown in fig. 4, and it can be seen that there are differences in the secretion and expression of growth factors when NPY at different concentrations stimulates adipose stem cells. When NPY is at low concentration 10 -13 M is capable of effectively promoting the secretion and expression of growth factors VEGF, TGF-beta and HGF in the adipose-derived stem cells.
Example 5
Regulation of adipose stem cells and fibroblasts by NPY at different concentrations
(1) And taking the adipose-derived stem cells and fibroblasts of the third generation, when the growth density reaches 90%, after digesting and counting the cells, inoculating the cells on a 96-well plate according to the cell density of 2000-3000 cells per well, and adding 100 mul of culture solution per well.
(2) The 96 well plate was set at 37 ℃ and 5% CO 2 After culturing for 24 h, taking 3-5 holes of the adipose-derived stem cells every day, adding 10 mul of CCK-8 solution into each hole under a dark condition, slightly shaking the 96-hole plate to mix the solutions uniformly, putting the solution into an incubator at 37 ℃ for incubation for 1 h, and continuously detecting the OD value under the wavelength of 450 nm for 7 days.
(3) According to the OD value detected in one week, a cell growth curve is drawn.
The experimental results are as followsAs shown in FIG. 5, a high concentration of NPY (10) can be seen -7 M、10 -9 M) inhibition of growth of adipose stem cells and fibroblasts, low concentration of NPY (10) -11 M、10 -13 M) promote the growth of adipose-derived stem cells and fibroblasts.
Example 6
Effect of different concentrations of NPY on skin fibroblasts
(1) The partitions are drawn on the bottom of the culture dish by a pen, so that the microscope is ensured to be in the same area every time.
(2) Taking third generation fibroblast, and pressing the cell according to 10% 5 One was inoculated in a prepared petri dish and cultured overnight for 24 h.
(3) When the cell density reaches 80% -90%, a 10 microliter gun head is used for scratching the cells compared with a ruler. A scratch width of 0 h was recorded by photographing.
(4) According to the growth and proliferation speed of the cells, the same position is photographed at intervals of 12 h, 24 h and 48 h, and the scratch area is recorded.
As shown in FIG. 6, the results of the experiment were analyzed by comparison to find NPY (10) at a low concentration -11 M) has more remarkable promoting effect on skin fibroblasts.
Example 7 therapeutic Effect of NPY and adipose-derived Stem cells in combination on skin wounds of type 2 diabetic mice
Mouse wound model preparation and wound analysis
(1) Randomly selecting a T2D group of mice, carrying out general anesthesia on the mice by carrying out intraperitoneal injection on anesthetic according to the weight of the mice by a dose of 0.2 ml/10g, fixing limbs of the mice by medical adhesive tapes after anesthesia, cutting off hair on the back of the mice by a proper amount, and then depilating the back of the mice by depilatory cream.
(2) After the hair removal is finished, round holes with the diameter of 8-10 mm are cut on the left side and the right side of the back of the mouse respectively, and disinfection is carried out during operation to avoid wound infection.
(3) Immediately after wound preparation, groups were divided into 20T 2D mice treated by cell or PBS injection treatment, and randomly divided into 4 groups of 5 mice each. After wound modeling in the first group of mice, each mouse was filled with the wound modelInjecting 200 mul PBS solution into the mouse wound; the second group of mice injected 200 μ l of NPY solution (concentration of 10. Mu.l) at the wound site -11 M); the third group of mice, injected 5X 10 at the wound 5 C57BL/6 mouse adipose-derived stem cells; a fourth group of mice injected with 200 μ l of NPY solution and 5X 10 at the same time at the wound 5 And C57BL/6 mouse adipose-derived stem cells.
(4) After the mouse wound model is manufactured, the wound area is measured, the photographing record of the unified height is carried out by a camera, the wound area of the first day is recorded, the photographing record of the unified height is carried out on the mouse wound continuously every day later, and the mouse wound healing condition is contrastingly observed. The data were analyzed by integrating the diameter measurements of the wounds in mice, calculating the area of the wounds using Image J software and assessing the rate of wound healing in mice.
The experimental result is shown in fig. 7, and it can be seen from the figure that, in the combined group of the adipose-derived stem cells and the NPY solution, the wound healing rate of the mouse reaches about 43% at the 4 th day, the wound healing speed is obviously faster than that of other groups, and in the 10 th day, the wound healing rate of the mouse reaches 90%, the wound is basically healed, which shows that the combined treatment of the adipose-derived stem cells and the NPY solution on the wound healing of the mouse has a synergistic effect, so that the adipose-derived stem cells and the NPY solution can be prepared into a composition to prepare the repairing agent for wound healing of type 2 diabetes.
Example 8 Effect of NPY and adipose Stem cells in combination on Hair follicle Generation number and Hair follicle growth Length in type 2 diabetic mice
Dehydration and slicing of mouse skin tissue
1. Embedding
(1) According to the mouse grouping (same mouse treatment as in example 7), mice were sacrificed by cervical dislocation at 12 d, wound granulation and 3 mm tissue of peripheral tissue were taken, and skin tissue samples were trimmed to 0.5 cm in size 3 The tissue blocks were placed in a 15 ml centrifuge tube, 4% paraformaldehyde was added, and the tube was fixed in a refrigerator at 4 ℃ overnight.
(2) Washing: wrapping the fixed skin tissue block with two layers of gauze mask, and washing the fixing solution with running water for 2-3 h.
(3) And (3) dehydrating: adopting an ethanol dehydration method with different concentrations, wherein the ethanol concentrations are as follows in sequence: 50% absolute ethanol 15min → 70% ethanol 20 min → 80% ethanol 20 min → 90% ethanol 20 min → 95% ethanol I10 min → 95% ethanol II 20 min → absolute ethanol I30 min → absolute ethanol II 30 min → absolute ethanol: xylene (1.
(3) And (3) transparency: xylene I, 15min → xylene II, 15 min.
(4) Wax dipping: the tissue block was transferred to a beaker with melted wax, marked and placed in a 65 ℃ oven, wax cup I1.5 h → wax cup II 1.5 h.
(5) Embedding a sample: and quickly pouring the wax-soaked tissue sample into a paper tank, placing the sample in the middle of the paper tank, cooling, and storing in a refrigerator at 4 ℃ for later use.
2. Wax trimming block
(1) Trimming the wax block embedded with the sample, observing the position of the sample tissue, cutting off the wax around the tissue block, and protruding the tissue block by a small block.
3. Slicing
The tissue is sliced with a microtome, which typically slices the tissue to a thickness of 5 μm so that the slices do not easily break.
4. Exhibition piece
After slicing, carefully picking up the tissue slices by using a needle point, directly placing the tissue slices in warm water for spreading, carefully fishing out the tissue slices by using a glass slide, closely attaching the tissue slices to the glass slide, and drying the tissue slices on a dryer at 42 ℃; alternatively, a drop of ultrapure water was dropped onto the upper portion of the slide using a syringe, and the tissue section was carefully placed on the drop. After the tissue section is fully developed, the ultrapure water is sucked away, and the tissue section is continuously dried on a 42 ℃ wafer drier with attention paid to no bubbles.
5. Hematoxylin-eosin staining
(1) Before dyeing, the skin tissue section is placed in an oven at 60 ℃ in advance for baking for 2 hours to melt paraffin.
(2) Placing the slices into a staining rack, and staining according to the following steps: xylene I,10 min → xylene II,10 min → absolute ethanol I, 5min → absolute ethanol II, 5min → 95% ethanol I,3 min → 90% ethanol, 3 min → 80% ethanol, 2 min → 70% ethanol, 2 min → 50% ethanol, 2 min → distilled water, 2 min → hematoxylin, 5-15min → tap water, 2 min → distilled water, 2 min → 1% hydrochloric acid ethanol, 4 s → tap water bluing, 10 min → distilled water, 2 min → 50% ethanol, 2 min → 70% ethanol, 2 min → 80% ethanol, 2 min → eosin, 45s → 90% ethanol, 3 min → 95% ethanol II,3 min → absolute ethanol I,3 min → absolute ethanol II, 5min → xylene I, 5min → xylene II,5 min.
(3) After dyeing, a drop of neutral resin is quickly dropped on the tissue section, the section is lightly sealed by a cover glass, the section is prevented from sliding, and the section is placed in a ventilation kitchen and dried for standby.
The experimental result is shown in fig. 8, and it can be seen that the hair follicle growth number and the hair follicle growth length of the fat stem cell and NPY solution combined group are significantly greater than those of the fat stem cell group, the NPY solution group and the PBS group, and the effect is very significant, which indicates that the fat stem cell can cooperate with the NPY solution to promote the hair follicle growth and the hair follicle growth of the type 2 diabetic mouse, so that the fat stem cell and the NPY solution can be prepared into a composition to prepare the hair follicle growth and hair follicle growth promoter of the type 2 diabetic mouse.
Example 9 Effect of NPY and adipose-derived Stem cells in combination on inflammatory response at wound site in type 2 diabetic mice
(1) The mice are treated in the same way as in example 7, after the wounds of the type 2 diabetes mice are treated by injection, the newly-grown granulation tissues at the wounds of four groups of mice are taken at 12 d, RNA in the tissues is extracted, the related inflammatory factors are subjected to gene detection, and the RNA extraction and detection are the same as in example 3;
(2) The primer sequences for IL-1 and TNF- α are as follows:
IL-1 Forward Primer：CGAAGACTACAGTTCTGCCATT，
IL-1 Reverse Primer：GACGTTTCAGAGGTTCTCAGAG；
TNF-α Forward Primer：CCCTCACACTCAGATCATCTTCT,
TNF-α Reverse Primer：GCTACGACGTGGGCTACAG。
the experimental results are shown in fig. 9, and it can be seen that in the NPY and adipose-derived stem cell combination group, the gene expression amounts of the proinflammatory genes IL-1 and TNF- α are significantly lower than those of other groups, and the gene expression levels of the inflammation-inhibiting genes VEGF and TGF- β are significantly higher than those of other control groups, which indicates that NPY and adipose-derived stem cells have synergistic effects on inhibiting the proinflammatory genes IL-1 and TNF- α and promoting the expression of the inflammation-inhibiting genes VEGF and TGF- β, so that adipose-derived stem cells and NPY solution can be prepared into a composition to prepare an expression inhibitor of the proinflammatory genes IL-1 and TNF- α and an expression promoter of the inflammation-inhibiting genes VEGF and TGF- β.
The technical features of the present invention, which are not described in the present application, can be implemented by or using the prior art, and are not described herein again, and of course, the above description is not limited to the above examples, and the present invention is not limited to the above examples, and variations, modifications, additions and substitutions which can be made by those skilled in the art within the spirit of the present invention should also fall within the scope of the present invention.
Claims (2)
1. The application of the promoter in preparing the medicine for promoting the generation of hair follicles and the growth of the hair follicles of wounds of type 2 diabetes patients is characterized in that the active ingredients of the promoter are adipose-derived stem cells and neuropeptide Y solution;
the number of the adipose-derived stem cells in each 200 μ l of the promoter is 5 × 10 5 The concentration of the neuropeptide Y solution is 10 -11 M。
2. The application of a composition containing adipose-derived stem cells and a neuropeptide Y solution in preparing a type 2 diabetes wound healing repair agent;
the number of adipose stem cells per 200 μ l of the composition is 5 x 10 5 The concentration of the neuropeptide Y solution is 10 -11 M。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110466877.XA CN113082196B (en) | 2021-04-28 | 2021-04-28 | Repairing agent for promoting wound healing of type 2 diabetes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110466877.XA CN113082196B (en) | 2021-04-28 | 2021-04-28 | Repairing agent for promoting wound healing of type 2 diabetes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113082196A CN113082196A (en) | 2021-07-09 |
| CN113082196B true CN113082196B (en) | 2022-10-14 |
Family
ID=76680878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110466877.XA Active CN113082196B (en) | 2021-04-28 | 2021-04-28 | Repairing agent for promoting wound healing of type 2 diabetes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113082196B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2007320031B2 (en) * | 2006-10-06 | 2013-05-02 | University Of Virginia Patent Foundation | Methods and compositions useful for diabetic wound healing |
| US20090304654A1 (en) * | 2008-04-30 | 2009-12-10 | Regents Of The University Of California | Methods for isolating adipose-derived stem cells and therapeutic use thereof |
| CN112111451B (en) * | 2020-11-23 | 2021-03-02 | 北京达熙生物科技有限公司 | Method for increasing yield of stem cell cytokines |
-
2021
- 2021-04-28 CN CN202110466877.XA patent/CN113082196B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113082196A (en) | 2021-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111394299B (en) | In-vitro construction method and application of liver organoid | |
| Yoshimura et al. | Cell-assisted lipotransfer for facial lipoatrophy: efficacy of clinical use of adipose-derived stem cells | |
| CN104225667B (en) | Angiogenesis-facilitating temperature-sensitive hydrogel powder and temperature-sensitive hydrogel prepared from same | |
| CN108719274B (en) | Tissue preservation solution | |
| CN103451148A (en) | Human normal bronchial epithelial cell and preliminary isolated culture and subculture methods and purposes thereof | |
| Han et al. | Combining platelet-rich plasma and tissue-engineered skin in the treatment of large skin wound | |
| CN113082196B (en) | Repairing agent for promoting wound healing of type 2 diabetes | |
| CN100348097C (en) | Method for hatching serpentes | |
| CN107899015A (en) | Purposes of the pharmaceutical composition in fibroblastic growth is adjusted | |
| CN107779430A (en) | The collection method of umbilical cord mesenchymal stem cells supernatant | |
| CN103642800A (en) | siRNA molecule composition, and applications thereof in treatment of hypertrophic scars | |
| CN108967358A (en) | A kind of construction method of zebra fish FL tumor model and its application | |
| Highman et al. | A new method for the production of experimental bacterial endocarditis | |
| Lektemur Alpan et al. | Evaluation of the effect of injectable platelet-rich fibrin (i-PRF) in wound healing and growth factor release in rats: a split-mouth study | |
| CN109517772A (en) | The building of Lactococcus lactis MG1363 a kind of and its application in treatment puerpera's cracked nipple | |
| CN109234298A (en) | The building of Lactobacillus crispatus ATCC55221 a kind of and its application in treatment puerpera's cracked nipple | |
| CN109355257A (en) | The mescenchymal stem cell mixed culturing method of different tissue sources | |
| CN104116756A (en) | Application of soracan gum for preparing medicine for promoting skin wound healing | |
| KR20200074869A (en) | Composition for treating Graft Versus Host Disease comprising clonal stem cell | |
| CN109964860A (en) | A method of promoting lefteye flounder spermary apoptosis of germ cells | |
| CN115109755B (en) | Dicer-knocked-out mononuclear cells, composition and application thereof in preparation of glioblastoma treatment drugs | |
| CN108841869A (en) | A kind of construction method of zebra fish NK/TCL tumor model and its application | |
| CN108379277A (en) | Application of the rhodioside in the drug for preparing treatment diabetic wounds ulcer | |
| CN103487585A (en) | Method used for detecting hair follicle stem cell VEGF165 protein expression by using western blot assay | |
| CN115094134B (en) | Application of PCSK9 in macrophage M2 type polarization and related diseases thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |