CN113073119A - Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration - Google Patents

Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration Download PDF

Info

Publication number
CN113073119A
CN113073119A CN202110276969.1A CN202110276969A CN113073119A CN 113073119 A CN113073119 A CN 113073119A CN 202110276969 A CN202110276969 A CN 202110276969A CN 113073119 A CN113073119 A CN 113073119A
Authority
CN
China
Prior art keywords
cxcr3
hbv
cells
tlrs
hepatitis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110276969.1A
Other languages
Chinese (zh)
Inventor
袁刚
曾传莉
朱德东
汪东辉
石小军
胡爱荣
胡耀仁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ningbo Huamei Hospital University of CAS
Original Assignee
Ningbo Huamei Hospital University of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ningbo Huamei Hospital University of CAS filed Critical Ningbo Huamei Hospital University of CAS
Priority to CN202110276969.1A priority Critical patent/CN113073119A/en
Publication of CN113073119A publication Critical patent/CN113073119A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7158—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for chemokines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention provides a method for researching that a TLRs/MyD88 signal channel mediated by CXCR3 promotes the canceration of hepatitis B cirrhosis, which comprises the following steps: extracting RNA and protein from LX-2 cells infected with lentivirus for PCR validation and WB validation; step four: the LX-2 cells infected with HBV lentivirus were transfected with CXCR3 interference and RNA and protein were extracted from LX-2 cells transfected with CXCR3 interference for qPCR validation and WB validation. The invention researches whether CXCR3 participates in regulating and controlling the expression of genes on TLRs/MyD88 signal channels and whether the proliferation, migration and apoptosis of hepatic stellate cells are influenced or not by culturing a hepatic stellate cell strain HBV-LX-2 over-expressing HBV in vitro and simultaneously transiently interfering the expression of CXCR3, thereby deducing the action of CXCR3 and TLRs/MyD88 signal channels in cirrhosis canceration. Research shows that the interference CXCR3 can down regulate the gene expression in TLRs/MyD88 signal path and inhibit the physiological activity of HBV-LX-2.

Description

Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration
Technical Field
The invention belongs to the technical field of medical treatment, and particularly relates to a method for promoting hepatitis B cirrhosis canceration by using a TLRs/MyD88 signal channel mediated by CXCR 3.
Background
According to the world health organization statistics, in 2015, it is estimated that 2.57 million people suffer from chronic hepatitis B, and the infection of chronic Hepatitis B Virus (HBV) can cause liver cirrhosis and liver cancer [1,2, 3)]About 134 million people die of liver disease globally, and 74 million people die of cirrhosis[3]. HBV is primarily responsible for chronic liver disease and can persist in chronic infections in patients for decades, leading to inflammatory lesions of the liver. HBV does not directly cause liver cell pathology, but causes the development of hepatitis and liver cancer through immune and inflammatory reactions of the host. In the course of liver cancer development, chemokines and their receptors play an important role, the chemokine receptor CXCR3, a member of the CXC subfamily of chemokine receptors[4]And the gene is highly expressed in cancer cells such as colon cancer, melanoma, B lymphoma, breast cancer and the like. It can be specifically combined with ligand chemotactic factor CXCL9 to promote cancer cell migration and invasion[5]. CXCR3 can enhance the activity of phosphatidylinositol 3 kinase (PI3K) and downstream Akt, and further regulate the activities of cell proliferation, apoptosis and migration[6]CXCR3 can be expressed in a variety of cells, such as Th1T cells, CD 8T cells, NKT cells, NK cells, dendritic cells and certain cancer cells[7-9]CXCR3 is rapidly upregulated following interferon induction and promotes migration of T cells, such as CD4+ T and CD8+ T cells, to inflamed tissues[10,11]. Expression of CXCR3 on T cells modulates its anti-tumor response, while expression on tumor cells promotes cancer metastasis response[12,13]. Natural immunity and adaptive immunity play an important role in acute and chronic hepatitis b virus infection and pathogenesis. Toll-like receptors (TLRs) are natural immune recognition receptors that can resist microbial infection by recognizing cell wall components of bacteria and fungi and generate corresponding immune response[14-16]Myeloid differentiation factor 88(Myeloid differentiation mediating-responsive protein88, MyD88) is an adaptor protein common to TLRs other than TLR3, an adaptor protein containing a TIR domain in MyD88 (TIRdomain-mediating adaptor protein, TIRAP), TLR4 is capable of activating the TIRAP/MyD88 signaling pathway, activating the production of proinflammatory cytokines IL-6, IL-10, IL-12 and TNF- α via NF-. kappa.B and activin 1(AP1)[17,18]The TLR-promoted inflammatory factor response is also present in liver cells, and IL-6 and TNF-alpha have inhibitory effects on HBV replication in liver cells[19,20]. HBV is identified as a foreign body in the MyD88 signaling pathway[21-22]. The neutrophil alkaline phosphatase 3(neutrophilic alkaline phosphatase3, NALP3) complex in the cytoplasm is activated and promotes the secretion of inflammatory factors IL-1 beta, and the abnormal secretion of IL-1 beta can make the body produce or aggravate inflammatory response. Mature IL-1 β binds to the IL-1 β receptor on the cell and promotes reactivation of the adaptor protein molecule MyD88[23-24]. The chemokine receptors CXCR3 and TLRs/MyD88 signal pathways play an important role in inducing the development of hepatitis B to cancer, and in previous researches, the roles of CXCR3, TLRs and the like in the cancer are mainly researched, and the regulation and control relationship between the CXCR3 and the TLRs is less researched for the development of liver cancer.
Disclosure of Invention
The invention provides a method for promoting hepatitis B cirrhosis canceration by using a TLRs/MyD88 signal pathway mediated by CXCR3 to overcome the defects of the prior art.
In order to achieve the purpose, the invention adopts the following technical scheme: a method for studying the TLRs/MyD88 signal pathway mediated by CXCR3 in promoting the canceration of hepatitis B cirrhosis, which comprises
The method comprises the following steps: constructing an HBV overexpression lentiviral vector;
step two: infecting LX-2 cells with HBV lentivirus;
step three: extracting RNA and protein from LX-2 cells infected with lentivirus for PCR validation and WB validation;
step four: the LX-2 cells infected with HBV lentivirus were transfected with CXCR3 interference and RNA and protein were extracted from LX-2 cells transfected with CXCR3 interference for qPCR validation and WB validation.
Preferably, in the first step, the HBV overexpression lentiviral vector is constructed by constructing Hepatitis Bvirus (GeneID:944566, 479bp) into pCDH-CMV-MCS-EF1-copGFP-T2A-Puro overexpression lentiviral vector.
Preferably, in the first step, the sequence of the HBV overexpression PCR verification primer is HBV-F: TCTCAGCAATGTCAACGACC, respectively;
HBV-R：AATTTATGCCTACAGCCTCCT。
preferably, in the second step, the lentiHBV virus and the polybrene are added to the LX-2 cells to infect the cells, and the LX-2 cells not infected with the HBV virus are screened out with puromycin to obtain the LX-2 cell line stably overexpressing HBV.
Preferably, in the fourth step, the CXCR3 interfering agent infecting the lentivirus LX-2 cells can be selected from siRNA-F1, siRNA-F2 and siRNA-F3.
Preferably, the CXCR3 interfering agent is preferably siRNA-F3, and the sequence of the siRNA-F3 is CUGGAGAACUUCAGCUCUUTT.
Preferably, in the second step, 5ug/ml puromycin is added to the LX-2 cells infected with HBV lentivirus and the LX-2 cells not transfected with virus, and after killing all the LX-2 cells not transfected with virus, the puromycin concentration is reduced to 2ug/m to obtain the LX-2 cell line stably overexpressing HBV.
Preferably, the method also comprises the step of carrying out a CCK8 experiment, a cell migration experiment and an apoptosis experiment on the LX-2 cells infected by the HBV lentivirus transfected by the CXCR3 interfering agent.
Preferably, blood from normal persons and liver cancer cirrhosis patients is detected by ELISA, and Mason staining is performed on liver cancer tissues and tissues around the cancer.
In conclusion, the invention researches whether CXCR3 participates in regulating and controlling the expression of genes on TLRs/MyD88 signal channels and influences on proliferation, migration and apoptosis of hepatic stellate cells by culturing a hepatic stellate cell strain HBV-LX-2 over-expressing HBV in vitro and simultaneously transiently interfering the expression of CXCR3 so as to infer the action of CXCR3 and TLRs/MyD88 signal channels in liver cirrhosis canceration. Research shows that the interference CXCR3 can down regulate the gene expression in TLRs/MyD88 signal path and inhibit the physiological activity of HBV-LX-2.
Drawings
FIG. 1 shows the result of verification of LX-2 over-expression of HBV (in comparison with control, # denotes P < 0.05; in comparison with NC, # denotes P <0.05)
FIG. 2 shows the effect of CXCR3 interference in HBV-LX-2 cells (vs control, # denotes P < 0.05; vs NC, # denotes P <0.05)
FIG. 3 is a statistical chart of cell proliferation rate measured by CCK 8.
FIG. 4 is a statistical chart of cell mobility.
FIG. 5 is a line drawing of the cell lines 24h and 48 h.
FIG. 6 is a statistical plot of the streaks of cells at 24h and 48 h.
FIG. 7 is a statistical graph of apoptosis rates.
FIG. 8 is a flow chart of apoptosis (vs control, indicates P < 0.05; vs NC, # indicates P < 0.05).
FIG. 9 shows the results of the mason staining and inflammatory factor content in the cirrhosis tissue (vs control, # stands for P < 0.05; vs NC, # stands for P < 0.05).
FIG. 10: results of mason staining and inflammatory factor content in cirrhosis tissues (vs control, # stands for P < 0.05; vs NC, # stands for P < 0.05).
Detailed Description
In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.
A method for promoting hepatitis B cirrhosis canceration by TLRs/MyD88 signal pathway mediated by CXCR3 comprises
The method comprises the following steps: constructing an HBV overexpression lentiviral vector;
step two: infecting LX-2 cells with HBV lentivirus;
step three: extracting RNA and protein from LX-2 cells infected with lentivirus for PCR validation and WB validation;
step four: transfecting HBV lentivirus infected LX-2 cells with a CXCR3 interference agent, and extracting RNA and protein from the CXCR3 interference agent transfected LX-2 cells to perform qPCR verification and WB verification; in the first step, the HBV overexpression lentiviral vector is constructed by constructing Hepatitis Bviruses (GeneID:944566, 479bp) into a pCDH-CMV-MCS-EF1-copGFP-T2A-Puro overexpression lentiviral vector, and the HBV overexpression PCR verification primer sequence is HBV-F:
TCTCAGCAATGTCAACGACC；
HBV-R：AATTTATGCCTACAGCCTCCT。
in the second step, the HBV slow virus is infected on the LX-2 cell and puromycin is used for screening, so that an LX-2 cell line which stably over-expresses the HBV can be obtained.
At this time, the LX-2 cells stably over-expressing HBV and the LX-2 cells transfecting HBV lentiviruses with CXCR3 interfering agent are subjected to qPCR verification and WB verification to compare the protein contents of TLR4, MyD88, COL1A1 and BIRC 5;
it is also desirable to subject LX-2 cells, LX-2 cells stably overexpressing HBV, and LX-2 cells transfected with a CXCR3 interfering agent to a CCK8 assay, a cell migration assay, and an apoptosis assay.
It is also needed to compare the IL-6 and IL-1 beta content in the cell by performing ELISA detection on LX-2 cells, LX-2 cells stably over-expressing HBV and LX-2 cells transfecting HBV lentiviruses with CXCR3 interfering agent, so as to obtain that the interference of CXCR3 can inhibit the expression of TLRs/MyD88 pathway-related proteins and collagen in HBV-LX-2 cells.
The following describes a method for promoting the hepatitis B cirrhosis canceration by a TLRs/MyD88 signal pathway mediated by CXCR3 in combination with practical experimental conditions.
1 Experimental materials and methods
1.1 Experimental materials:
clinical samples: 6 cases of paracancer liver tissues, 6 cases of liver cancer tissues, 10 cases of normal human blood and 10 cases of blood of liver cancer patients. The hepatic stellate cell line LX-2.
1.2 Experimental reagents: masson trichrome staining solution (G1340) was purchased from Solebao corporation; FBS (10099141, Gibco TM), streptomycin mixed solution (P1400, Solarbio), trypsin-EDTA digestive juice (T1300, Solarbio), CCK-8 method cell proliferation assay kit (KGA317, Kaiybe), OPTI-MEM (31985-TM3000(L3000015, Invitrogen), AnnexinV-FITC/PIApoptosis kit (AP101-100-kit, MultiSiENCES Union), TrizonReagent (CW0580S, CWBIO-kang is a century), Ultrapure RNA extraction kit (CW0581M, CWBIO-kang is a century), HiFiScriptcDNA first chain synthesis kit (CW2569, CWBIO-kang is a century), UltraSYBR mix (CW 09M, CWBIO-kang is a century), RIPA cell lysate (C1053, Beijing primrose Gene technology, Inc.), protein quantification kit (BCAProteinAssaykit) (CW0014, CWB-century), PVDF membrane (IPVH00010, Millipore), milk powder for sealing and defatting (P2, Beijing prim Gene technology, GmbH 809676), bovine serum albumin for hypersensitive (RWB 23A 9676, RWB-A969676, and RWB 9676: RabbitAnti-GAPDH (ab181602, Abcam, 1/10000) (supplied by customer), secondary antibody: Goatanti-MouseIgG1(HRP) (ab97240, Abcam, 1/2000) (customer supplied) Primary antibody of interest: rabbitAntiTICXCR 3(ab71864, Abcam, 1/1000), rabbitAntiTLR4(ab22048, Abcam, 1/1000), rabbitAntiMYD88(ab133739, Abcam, 1/1000), rabbitAntiNLRP3(ab214185, Abcam, 1/500), rabbitAntiColagen-I (ab34710, Abcam, 1/1000), rabbitAntiSurvivin (ab469, Abcam, 1/5000) secondary antibody: horseradish enzyme-labeled goat anti-rabbit IgG (H + L) (ZB-2301, Zhonghua Jinqiao, 1/2000).
1.3 Experimental instruments: microscope (CX41 OLYMPUS); microtomes (BQ-318D, bernas); inverted fluorescence microscope (MF53), full-automatic enzyme labeling instrument (WD-2102B), NovoCyteTMFlow cytometer (Novocyte2060R), low temperature high speed centrifuge (TGL-16G), and fluorescent PCR instrument (CFXConnect)TMReal-time), protein vertical electrophoresis (DYY-6C), fully automatic sample rapid grinding (Tiss-12), ultra high sensitivity chemiluminescence imaging system (ChemiDocTM XRS +).
1.4 Experimental methods
1.4.1 Mason staining preparation of paraffin sections: placing the liver paraffin tissue slices of normal people and liver cirrhosis patients into an oven at 65 ℃ for 2h, and dewaxing: standing in xylene for 10min, hydrating: sequentially adding 100% ethanol, 95% ethanol, 80% ethanol and purified water for 5min each. Dyeing the treated liver slices with Weigert hematoxylin staining solution for 10min, differentiating with acidic ethanol for 5-15 s, and washing with water; returning the Masson bluing solution to blue for 5min, and washing with distilled water for 1 min; dyeing with ponceau fuchsin dyeing solution for 8 min; during the operation, according to the weight ratio of distilled water: weak acid solution 2: 1, preparing weak acid working solution in proportion, and washing for 1min by using the weak acid working solution; washing with phosphomolybdic acid solution for 2 min; washing with weak acid working solution for 1 min; directly placing into aniline blue staining solution for dyeing for 2 min; washing with weak acid working solution for 1 min; dehydrating with 95% ethanol rapidly, dehydrating with anhydrous ethanol for 3 times, each for 5-10s, sealing with ultra-clean high-grade sealing glue, and performing microscopic examination.
1.4.2 construction of HBV overexpression Lentiviral vector construction: hepatitis Bvirus (GeneID:944566, 479bp) is constructed on a pCDH-CMV-MCS-EF1-copGFP-T2A-Puro overexpression lentiviral vector, and the HBV overexpression PCR verification primer sequence is HBV-F:
TCTCAGCAATGTCAACGACC，HBV-R：AATTTATGCCTACAGCCTCCT。
general biology company.
CXCR3-siRNA-F1:GCUAAAUGACGCCGAGGUUTT；
CXCR3-siRNA-F2:AGAGAGGGCUCCAGAGGCATT；
CXCR3-siRNA-F3:CUGGAGAACUUCAGCUCUUTT。
CXCR3 interference results PCR validation primer sequences: CXCR 3-F: AATGACGCCGAGGTTGC, CXCR 3-R: CCAGAGCCAAAGACCCACT are provided.
1.4.3 LX-2 cell culture
Taking out LX-2 cells to be recovered from a liquid nitrogen tank and immediately putting the LX-2 cells into a dry constant-temperature heater at 37 ℃; after the cells are completely melted, quickly transferring the cell suspension into a prepared DMEM complete culture medium, and uniformly mixing; culturing in a 5% CO2 incubator at 37 deg.C; the cell state was observed the next day, and the solution was changed when the cell state was good. 1.4.4HBV slow virus transfection cell experiment LX-2 cells with good state are removed DMEM culture medium supernatant, washed twice with 1 XPBS, digested for 2-3min by 0.25% pancreatin (containing 0.02% EDTA), added with DMEM culture medium to stop digestion and suspend cells; collecting cells into a 10ml centrifuge tube, centrifuging at 1000rpm for 3min, discarding supernatant, adding DMEM culture medium into a suction tube, and blowing uniformly; after diluting the cells to an appropriate density, the suspension was added to a plate and cultured in a 5% CO2 incubator at 37 ℃. When the cell density reaches 60%, preparing for transfection; lentivirus and polybrene are added into LX-2 cells, and RNA and protein are extracted for PCR verification and WB verification 72 hours after virus infection.
1.4.5 Stable screening of HBV Lentiviral LX-2 cells
When the cell density of the LX-2 reaches 60 percent, preparing transfection; adding HBV (hepatitis B virus) lentivirus and polybrene into cells, after virus infection is carried out for 72 hours, taking untransfected blank cells as a control, adding 5ug/ml puromycin into the two cells for culture, observing once a day, leading the blank cells to be dead completely, when transfected HBV overexpression group cells still survive, indicating that the primary screening of the cells is successful, reducing the puromycin concentration to 2ug/ml, continuing to culture, when the cells can be subjected to normal passage after steadily increasing and dead and floating cells are almost not existed in the culture process, indicating that the cells are completely and stably screened successfully, and maintaining the culture environment by using a trace culture medium containing puromycin.
1.4.6 transfection of LX-2 cells with CXCR3 Interferon
When the density of the LX-2 cells reaches 70%, preparing for transfection; replacing the culture medium of the cells with a serum-free culture medium with a volume of 1 ml; taking 2 sterilized EP tubes, adding 125ul Opti-MEM into each tube, adding 5uLlipofectamine3000 into one tube, adding 12.5ul siRNA (siRNA dry powder is dissolved by DEPC water; 125ul/1OD) into the other EP tube, mixing uniformly, and incubating at room temperature for 5 min; uniformly mixing the two EP tubes, incubating at room temperature for 15min, dripping the mixed solution into corresponding holes in a six-hole plate, and putting the cells back into an incubator for culture; adding 1ml of DMEM complete culture medium with 20% of serum content into a six-well plate after 6h of transfection; PCR and WB were performed 48h later for interference validation.
1.4.7 CCK8 experiments
After transfecting LX-2 cells with the CXCR3 interfering agent and NC, adding 10ul of CCK8 detection reagent into each hole of a 96-hole plate, and incubating for 2 hours at 37 ℃; the OD value of each well is detected by a microplate reader at a wavelength of 450nm, and the survival rate is calculated.
1.4.8 cell migration assay
After transfection of LX-2 cells with the CXCR3 interfering agent and NC, scratching each well with a 10ul pipette tip, thinning the line as perpendicular as possible to the bottom, discarding the culture solution after scratching, washing gently with PBS 3 times, immediately photographing the scratch of each well after adding a fresh serum-free culture medium, then adding a drug, and photographing the scratch of each well again for 24h and 48 h. Then, the migration rate of the cells was calculated according to the scratch width corresponding to the two time periods of 0-24h and 0-48 h.
1.4.9 apoptosis assay
1X 106-3X 106 cells were collected, centrifuged at 1500rpm with 1ml PBS, 3min and washed twice. The 5 XBindingBuffer was diluted to 1 XBindingBuffer with double distilled water. 300ul of pre-cooled 1 XBinding Buffer was taken to resuspend the cells. 3ul of annexin V-APC and 5ul of 7-AAD were added to each tube. After gentle mixing, incubate for 10min at room temperature in the dark. Then 200ul of precooled 1 × BindingBuffer is added into each tube, and the mixture is mixed evenly and detected by an up-flow meter.
1.4.10 Westernblot(WB)
Adding LX-2 cells which are stably screened and transfected with CXCR3 interference agent into lysate, standing on ice for 15min, centrifuging at high speed of 12000r/min for 10min, taking supernatant, adding buffer solution, boiling for 5min, and storing at-20 ℃. Protein concentration in cell supernatant was detected with BCA protein quantification kit and a standard curve was drawn. SDS-PAGE gels were prepared, loaded, run initially, run 60V for protein compaction, run 80V for protein separation (120 min), and gels containing the internal control or target bands were cut. Sequentially placing the sponge, the filter paper, the glue, the membrane, the filter paper and the sponge. The desired tape composite was immersed in the chilled 1 × transfer solution and transferred to the film at a constant rate of 300 mA. 3% skimmed milk blocking solution was prepared with 1 × TBST, and blocked for 1 h. PVDF membrane is incubated overnight. Washing the membrane, soaking in 1 × TBST for 10min, discarding, and repeating for 3 times. The PVDF membrane was incubated for 2 hours for secondary antibody. Washing the membrane, soaking in 1 × TBST for 10min, discarding, and repeating for 3 times. And soaking the PVDF membrane by using a luminous liquid, placing the PVDF membrane in a sample placing area of the ultra-high sensitivity chemiluminescence imaging system, and running a program to perform development imaging.
1.4.11 statistical analysis
The data obtained were plotted using GraphPadPrism software, all data analyzed using SPSS19.0, with p <0.05 indicating significant differences.
2 results
2.1 Stable overexpression of HBV Lentiviruses in LX-2 cell lines
As shown in FIG. 1, in order to construct an LX-2 cell line stably expressing HBV, we constructed an HBV lentiviral over-expression vector pCDH-CMV-MCS-EF1-copGFP-T2A-Puro, and packaged the virus with 293T cells, and the virus titer reached 108. LX-2 cells are infected by HBV overexpression lentivirus, and an LX-2 cell line of the HBV is stably overexpressed by screening puromycin. Through fluorescent quantitative PCR verification, the HBV overexpression is obvious.
2.2 interference with CXCR3 Gene expression
As shown in FIG. 2, in order to screen the CXCR3 interferon with the best knockdown effect, we synthesized 3 CXCR3 interferors, siRNA-F1, siRNA-F2 and siRNA-F3, which were transfected into LX-2 cell lines stably expressing HBV, respectively. The expression of CXCR3 transcription level verified by qPCR shows that the efficiency of 3 interferents reaches more than 50%, wherein the interference effect of siRNA-F1 and siRNA-F3 is the best. WB verifies the protein level interference effect of CXCR3, and finds that the interference efficiency of siRNA-F3 reaches more than 50%. Combining the results of qPCR and WB, siRNA-3 was selected as an interfering agent for subsequent experiments.
2.3 interfering with CXCR3 inhibits the proliferation and migration of HBV-LX-2 cells and promotes apoptosis
As shown in fig. 3-7, in order to verify the effect of CXCR3 on proliferation, migration and apoptosis of HBV-LX-2 cells, CXCR3 interfering agent siRNA-F3(siCXCR3) was transfected in LX-2 cells stably expressing HBV, CCK8 detected LX-2 cell proliferation activity, cell lineation detected cell migration rate, and flow cytometry detected apoptosis rate. After disrupting CXCR3, proliferation rates were significantly reduced after 48h and 72h in culture, cell migration rates were significantly reduced in siCXCR3 group after 24h and 48h streaking, and LX-2 apoptosis rates were significantly increased compared to control and NC groups. It shows that after CXCR3 is interfered, the proliferation rate of HBV-LX-2 cell is reduced, cell migration is inhibited and cell apoptosis is promoted.
2.4 liver cirrhosis tissue hyperfibrosis and abnormal increase of IL-6 and IL-1 beta expression
As shown in FIG. 8, 10 cases of blood samples of normal persons and liver cancer patients with liver cirrhosis were examined by ELISA, and the degree of fibrosis in liver tissue was examined by Mason staining 6 liver cancer tissues and 6 paracarcinoma tissues. ELISA detection results show that the contents of IL-beta and IL-6 in the blood of the cirrhosis patients are obviously increased compared with normal people. Mason stain, blue for nuclei, collagen fibers, red for cytoplasm, red cells. As can be seen, the liver cancer tissue appears blue in a large area and contains a large amount of collagen fibers, while the paracarcinoma tissue contains a smaller amount of blue collagen fibers. It shows that the IL-beta and IL-6 content in the blood of the liver cancer patient is abnormally increased, the liver tissue contains a large amount of collagen fibers, and the liver cirrhosis degree is serious.
2.5 interfering CXCR3 can inhibit the expression of TLRs/MyD88 pathway related protein and collagen in HBV-LX-2 cells
As shown in fig. 9, when the CXCR3 interfering agent was transformed into the cells stably expressing HBV-LX-2 and the protein was extracted, WB assay found that the protein content of TLR4, MyD88, COL1a1, BIRC5 was significantly reduced in siCXCR3 group compared to control and NC group. Compared with the control group, the expression level of the NALP3 protein is obviously reduced, but compared with NC, the expression level of the NALP3 protein is not obviously different. When the content of IL-6 and IL-1 beta in HBV-LX-2 cells transformed with siCXCR3 was measured by ELISA, the content of IL-beta in the siCXCR3 group was significantly increased compared with the control group, but the content of IL-1 beta was not significantly different compared with NC, and the content of IL-6 was not significantly different compared with the control group and NC. The result shows that the interference of the expression of CXCR3 can inhibit the expression of TLR4/MyD88 and NALP3 in an inflammation-inducing inflammatory factor expression pathway, and simultaneously inhibit the expression of a collagen gene COL1A1 and an apoptosis inhibitor BIRC5, but although the expression of key proteins in the inflammation-inducing pathway is regulated, the contents of inflammatory factors IL-6 and IL-1 beta are not obviously changed, and the content of IL-1 beta is increased compared with that of a control group, but the increase amplitude is small.
Discussion 3 HBV induces hepatitis B, chronic hepatitis in the long term progresses to cirrhosis and liver cancer, and in chronic fibroproliferative disease the presence of myofibroblasts is critical to the development of tissue fibrosis[25]In the course of the development of liver fibrosis, Hepatic Stellate Cells (HSC) differentiate into proliferating, migrating myofibroblasts, and secrete collagen type I COL1A1 and other proteins constituting pathological fibrous tissues, inducing liver fibrosis[26]. Excessive liver fibrosis can induce the development of liver cancer, the chemokine CXCR3 plays an important role in the process, and CXCR3 plays a role in promoting the proliferation and migration of cancer cells in previous researches[6]While TLRs/MyD88 signal pathway has important role in liver inflammation reaction caused by HBV, the experiment aims to explore the role of CXCR3 and TLRs/MyD88 signal pathway in the development of hepatitis B cirrhosis to cancer. In the experiment, the hepatic stellate cell LX-2 is cultured in vitro, and the LX-2 cell line is transfected by the HBV overexpression lentivirus, and the LX-2 cell strain which stably overexpresses the HBV is obtained by stable screening. The effect of interfering the expression of CXCR3 is achieved by synthesizing the interference agent of CXCR3 and transforming the interference agent into HBV-LX-2 cells, and the result shows that the expression level of CXCR3 is more than 50% lower than that of a control group, thereby achieving the interference effect. The experimental result shows that the interference of CXCR3 expression can inhibit the proliferation and migration of HBV-LX-2 cell and promote the apoptosis. Previous studies have shown that CXCR3 is up-regulated in expression in primary and metastatic cancer cells, and CXCR3 activates PI3K/Akt via the G protein subunit to increase intracellular calcium levels in glioma cells, thereby promoting proliferation, migration and invasion of cancer cells[27]CXCR3 is expressed in large amounts in gastric cancer tissues accompanied by lymph node metastasis, and CXCR3 is presumed to promote lymph node metastasis[28]In squamous cell carcinoma of the tongue, CXCL9/CXCR3 promotes the invasion and metastasis of cancer cells by activating the Akt signaling pathway[29]These demonstrate that CXCR3 promotes cell proliferation, migration and invasion, and that we interfere with the expression of CXCR3, resulting in inhibition of cell proliferation and migrationThis is consistent with the expression of CXCR3 in other cancer cells, suggesting that inhibition of CXCR3 expression may inhibit progression of hepatic stellate cells overexpressing HBV toward carcinogenesis. After HBV viral infection, chronic infection for a long time can progress to cirrhosis and liver cancer[30]The experiment carries out Mason staining on the liver cirrhosis tissue of a patient with hepatitis B liver cancer, and the result shows that the liver tissue contains a large amount of collagen fibers, but the content of the collagen fibers in the tissues beside the liver cancer is very small, which indicates that the liver cancer can induce and accumulate the collagen fibers to cause liver cirrhosis lesion, and simultaneously, the abnormal increase of the content of IL-1 beta and IL-6 is detected and found in the blood of the patient with the liver cancer, which indicates that the liver cancer induced by the hepatitis B can promote the expression of a large amount of inflammatory factors, and the inflammatory reaction is aggravated by the excessive IL-1 beta and IL-6[23,24]To promote the development of liver cirrhosis. By interfering with the expression of CXCR3, inhibiting the expression of TLR4/MyD88 protein, NAPL3 is obviously reduced compared with a control group, but has no obvious difference compared with NC, which shows that the reduction of CXCR3 does not strongly inhibit the expression of NAPL3, and correspondingly, the content of IL-6 in HBV-LX-2 cells is not obviously changed, and the IL-beta is obviously increased, but the increase amplitude is small. The action mechanism of NAPL3 in liver cancer is controversial, and research shows that after NAPL3 is interfered in liver cancer cell, NAPL3 promotes proliferation of liver cancer cell and inhibits apoptosis of liver cancer cell[31]In the research of Chinese herbal medicines on liver cancer, the Chinese herbal medicines inhibit the expression of NAPL3 and then inhibit the proliferation and metastasis of liver cancer cells[32]. In the experiment, the proliferation rate of HBV-LX-2 cells is reduced, the apoptosis rate is increased, and the migration capacity is inhibited, and the TLR4/MyD88/NAPL3 is supposed to be down-regulated to induce the series of cell activities. Although inflammatory factors are not changed remarkably, the expression level of a collagen gene COL1A1 is remarkably reduced after the expression of CXCR3 is interfered, and the condition that CXCR3 is reduced, so that the synthesis of collagen is reduced, and the degree of liver fibrosis is reduced. Research shows that the expression level of COL1A1 is up-regulated in gastric cancer cells, and invasion and metastasis of the cells are promoted[33,34]In cervical cancer, COL1A1 can inhibit cancer cell apoptosis through PI3K pathway, and interference with COL1A1 can remarkably promote cancer cell apoptosis[35]This is in the study of usThe results are consistent, the interference of CXCR3 down-regulates the expression of COL1A1 protein, promotes the apoptosis of HBV-LX-2 cells, inhibits the migration of cells, and the result of BIRC5 protein down-regulation also verifies that BIRC5 is an anti-apoptotic protein[36]BIRC5 is abundantly expressed in many malignant tumors, such as gastric cancer, lung cancer, colon cancer and ovarian cancer [37,38 ]]Affecting cell division and proliferation and inhibiting apoptosis in cancer cells[39]Interfering with transcription and expression of BIRC5, triggering apoptosis of cancer cells[40,41]. The results of the BIRC protein down-regulation, the cell proliferation inhibition and the cell apoptosis promotion in the experiment also indicate that the interference of CXCR3 can inhibit the development of HBV-LX-2 cells to cancer cells. In conclusion, the expression of the CXCR3 can be reduced to inhibit the expression of genes on a TLR4/MyD88 signal channel, inhibit the proliferation and migration of cells and promote apoptosis so as to achieve the aim of inhibiting the trend of liver cirrhosis towards liver cancer, the research finds that the effect of reducing the CXCR3 on the expression level of NALP3 and the content of related inflammatory factors is small, and the regulation and control relationship between the CXCR3 and the inflammatory factors in the process of transferring the liver cirrhosis from B to cancer is still to be researched.
It is to be understood that the described embodiments are merely a few embodiments of the invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Claims (9)

1. A method for studying the TLRs/MyD88 signal pathway mediated by CXCR3 in promoting the canceration of hepatitis B cirrhosis, which comprises
The method comprises the following steps: constructing an HBV overexpression lentiviral vector;
step two: infecting LX-2 cells with HBV lentivirus;
step three: extracting RNA and protein from LX-2 cells infected with lentivirus for PCR validation and WB validation;
step four: the LX-2 cells infected with HBV lentivirus were transfected with CXCR3 interference and RNA and protein were extracted from LX-2 cells transfected with CXCR3 interference for qPCR validation and WB validation.
2. The method of claim 1, wherein in step one, the HBV overexpression lentiviral vector is constructed by constructing Hepatitis Bvirus (GeneID:944566, 479bp) into pCDH-CMV-MCS-EF1-copGFP-T2A-Puro overexpression lentiviral vector.
3. The method for promoting the carcinogenesis of hepatitis B virus by using a CXCR3 mediated TLRs/MyD88 signaling pathway in the first step, according to claim 2, wherein the HBV overexpression PCR verification primer sequences are HBV-F: TCTCAGCAATGTCAACGACC, respectively;
HBV-R：AATTTATGCCTACAGCCTCCT。
4. the method of claim 1, wherein in the second step, a slow HBV virus and a polybrene are added to LX-2 cells to infect the cells, and LX-2 cells not infected with the HBV virus are screened out by puromycin to obtain an LX-2 cell line stably overexpressing HBV.
5. The method of claim 1, wherein in step four, the CXCR3 interfering agent infecting the lentiviral LX-2 cells is selected from the group consisting of siRNA-F1, siRNA-F2, siRNA-F3, using a CXCR3 mediated TLRs/MyD88 signaling pathway to promote the progression of hepatitis b cirrhosis.
6. The method of claim 5, wherein said CXCR3 interfering agent is preferably siRNA-F3, and said siRNA-F3 has the sequence CUGGAGAACUUCAGCUCUUTT, and said TLRs 3 mediated signal pathway MyD88 is used for promoting the canceration of hepatitis B cirrhosis.
7. The method of claim 4, wherein in the second step, 5ug/ml puromycin is added to LX-2 cells infected with HBV lentivirus and LX-2 cells not transfected with virus, and after killing all LX-2 cells not transfected with virus, the puromycin concentration is reduced to 2ug/m to obtain LX-2 cell line stably overexpressing HBV.
8. The method of claim 1, further comprising performing a CCK8 assay, a cell migration assay and an apoptosis assay on the HBV lentivirus infected LX-2 cells transfected with a CXCR3 interfering agent.
9. The method of claim 1, wherein the blood of normal human and liver cancer patients is tested by ELISA and Mason staining is performed on liver cancer tissues and tissues around the liver cancer.
CN202110276969.1A 2021-03-15 2021-03-15 Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration Pending CN113073119A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110276969.1A CN113073119A (en) 2021-03-15 2021-03-15 Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110276969.1A CN113073119A (en) 2021-03-15 2021-03-15 Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration

Publications (1)

Publication Number Publication Date
CN113073119A true CN113073119A (en) 2021-07-06

Family

ID=76612685

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110276969.1A Pending CN113073119A (en) 2021-03-15 2021-03-15 Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration

Country Status (1)

Country Link
CN (1) CN113073119A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090208486A1 (en) * 2004-03-09 2009-08-20 Makoto Taketo Pharmaceutical composition comprising cxcr3 inhibitor
CN102161982A (en) * 2011-03-09 2011-08-24 苏州大学 Monoclonal antibodies (McAb) against human CXCR3 molecules and application thereof
CN111893185A (en) * 2020-08-10 2020-11-06 梁嵘 Construction method and application of cell strain expressing NTNG1 gene

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090208486A1 (en) * 2004-03-09 2009-08-20 Makoto Taketo Pharmaceutical composition comprising cxcr3 inhibitor
CN102161982A (en) * 2011-03-09 2011-08-24 苏州大学 Monoclonal antibodies (McAb) against human CXCR3 molecules and application thereof
CN111893185A (en) * 2020-08-10 2020-11-06 梁嵘 Construction method and application of cell strain expressing NTNG1 gene

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
孙立华等: "Th17 细胞表面CCR4、CCR6、CXCR3 表达量检测对慢性乙型肝炎患者病情评估的价值", 《中国现代医学杂志》 *
孙立华等: "Th17 细胞表面CCR4、CCR6、CXCR3 表达量检测对慢性乙型肝炎患者病情评估的价值", 《中国现代医学杂志》, vol. 27, no. 3, 15 February 2017 (2017-02-15), pages 69 - 73 *
朱玉强等: "CXC趋化因子受体3的单克隆抗体抑制体外培养的MCF-7细胞和HepG2细胞的增殖及迁移", 《细胞与分子免疫学杂志》, vol. 31, no. 11, 28 November 2015 (2015-11-28), pages 1544 - 1548 *
马良等: "TLR4/MyD88/NF-κB 信号通路在乙肝病毒所致肝硬化中的表达及其临床意义", 《中国现代医学杂志》 *
马良等: "TLR4/MyD88/NF-κB 信号通路在乙肝病毒所致肝硬化中的表达及其临床意义", 《中国现代医学杂志》, 6 August 2020 (2020-08-06), pages 1 - 11 *

Similar Documents

Publication Publication Date Title
CN105435228B (en) New anti-tumor application of arsenic trioxide and anti-tumor preparation
Yue et al. PGRN−/− TAMs-derived exosomes inhibit breast cancer cell invasion and migration and its mechanism exploration
Zhang et al. TIPE2 suppresses the tumorigenesis, growth and metastasis of breast cancer via inhibition of the AKT and p38 signaling pathways
Yu et al. ERBB2 gene expression silencing involved in ovarian cancer cell migration and invasion through mediating MAPK1/MAPK3 signaling pathway.
Xie et al. Retracted: KIF20A silence inhibits the migration, invasion and proliferation of non‐small cell lung cancer and regulates the JNK pathway
Deng et al. Hsa_circ_0088233 alleviates proliferation, migration, and invasion of prostate cancer by targeting hsa-miR-185-3p
Zhao et al. CD151 promotes breast cancer metastasis by activating TGF-β1/Smad signaling pathway.
CN111690742A (en) Application of de-linear ubiquitination enzyme FAM105B in diagnosis, treatment and prognosis judgment of liver cancer
Liao et al. USP3 promotes proliferation of non-small cell lung cancer through regulating RBM4.
CN106701801B (en) Detection marker and kit for B lymphoma and leukemia and application of detection marker and kit
Xu et al. Upregulation of NFKBIZ affects bladder cancer progression via the PTEN/PI3K/Akt signaling pathway
Zhang et al. C-MYC-induced upregulation of LINC01503 promotes progression of non-small cell lung cancer.
Nakayama et al. Pancreatic cancer cell-derived exosomes induce epithelial-mesenchymal transition in human pancreatic cancer cells themselves partially via transforming growth factor β1
Wang et al. CSMD1 suppresses cancer progression by inhibiting proliferation, epithelial-mesenchymal transition, chemotherapy-resistance and inducing immunosuppression in esophageal squamous cell carcinoma
CN113584173B (en) Application of lncRNA SLC25A21-AS1 AS esophageal squamous cell carcinoma marker
CN110172462B (en) Gene with promotion effect on generation and development of tumor, expression product and application thereof
Zhang et al. EFEMP1 binds to STEAP1 to promote osteosarcoma proliferation and invasion via the Wnt/β-catenin and TGF-β/Smad2/3 signal pathways
CN113908283A (en) PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer
Lv et al. ARP3 promotes tumor metastasis and predicts a poor prognosis in hepatocellular carcinoma
Huang et al. Dextran sulfate effects EMT of human gastric cancer cells by reducing HIF-1α/TGF-β
CN113499440B (en) Application of reagent for down regulating RBMS1 expression in preparation of medicine for treating lung cancer
CN113073119A (en) Method for researching promotion of TLRs/MyD88 signal pathway mediated by CXCR3 on hepatitis B cirrhosis canceration
TWI670080B (en) Method for inhibiting survival, tumorigenesis and metastasis of cancer cells and/or cancer stem cells
CN112891354B (en) Application of MDM2 inhibitor Nutlin-3a in preparation of medicine for activating cancer cell apoptosis induced by endoplasmic reticulum stress
CN114306611A (en) ABHD2 gene expression inhibitor, application and medicine thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210706

RJ01 Rejection of invention patent application after publication