CN111893185A - Construction method and application of cell strain expressing NTNG1 gene - Google Patents

Abstract

The invention belongs to the technical field of cell biology, and particularly discloses a construction method and application of a cell strain expressing NTNG1 gene. By taking the liver cancer cell as a target system, the liver cancer cell stably overexpressing the NTNG1 gene is obtained through the NTNG1 overexpression lentivirus infection. The liver cancer cell is taken as a target system, and the NTNG1 is used for interfering the lentivirus infection, so that the liver cancer cell with the NTNG1 gene stably knocked down is obtained. Through the application of the cell strain constructed by the invention, the influence of NTNG1 on liver cancer proliferation, growth, apoptosis, invasion, migration and mouse tumor formation is researched, an experimental basis is provided for the molecular mechanism and prognosis judgment of liver cancer generation and development, and a basis is provided for clinical application.

Description

Construction method and application of cell strain expressing NTNG1 gene

Technical Field

The invention relates to the technical field of cell biology, in particular to a construction method and application of a cell strain expressing NTNG1 gene.

Background

Hepatocellular carcinoma (HCC, hereinafter referred to as liver cancer) is the sixth most common cancer worldwide and the third most common cause of death. According to the cancer statistics of 2018, 841,000 new HCC cases are annually present worldwide, with about 55% of HCC patients from china. In recent years, liver cancer is also one of the leading causes of cancer death in our country, and the death rate is higher at 2 nd. Because of the lack of effective clinical diagnosis targets, the malignancy of liver cancer is extremely high, the invasiveness is strong, the progress is rapid, most patients reach middle and late stages in treatment, even if the patients receive standard systemic treatment, the median OS is not more than 14 months, and the liver cancer is still the digestive system malignant tumor with the highest mortality rate. Therefore, finding some accurate biomarkers has important clinical significance in the diagnosis or prognosis of liver cancer.

NTNG1 is located in chromosome 1p13.3 region, encodes 539 amino acids, consists of 10 exons, is about 60.5kDa in length, and belongs to a member of the laminin-associated protein Netrin family. Netrin was first discovered in caenorhabditis elegans in 1990, Netrins, as a class of autocrine proteins or membrane-bound proteins, can exert distinct effects by binding to a heterogeneous receptor. Initially they played important roles in the development of the central nervous system, including regulating migration, differentiation and apoptosis of nerve cells, stabilizing the blood-brain barrier, and limiting immune cells from entering the central nervous system. In addition, Netrins are involved in physiological processes such as adhesion, migration and differentiation of non-neural tissues, such as angiogenesis, lymphangiogenesis and inflammation. However, the expression of NTNG1 in liver cancer tissues is not reported.

Only literature (Fujita Y, Nakanishi T, Ueno M, Itohara S, Yamashita T. Netherin-G1 regulations micro administration of antibodies Axons and Supports the Survival of Layer V neurones in the Postnatal Mouse brain cell Rep.2020; 31 (4): 107580. doi: 10.1016/j. cell 2020.107580) is currently available for in vivo experimental studies of NTNG1 to modulate the function of the Mouse brain nervous system, showing that stable knock-down of NTNG1 can lead to aggregation of Microglial cells in the Mouse brain and to loss of cortical Neurons. It was revealed that NTNG1 is involved in regulating the bidirectional neurotrophic interaction between brain projection axon neurons and microglia.

However, at present, no report is found about the application of a cell strain for stably over-expressing NTNG1 gene and a cell strain for stably knocking down NTNG1 in human primary liver cancer.

Disclosure of Invention

The invention aims to provide a cell strain capable of expressing NTNG1 gene and a construction method of the cell strain. Through the construction and application of the cell strain, the influence of NTNG1 on liver cancer proliferation, growth, apoptosis, invasion, migration and mouse tumor formation is researched, an experimental basis is provided for the molecular mechanism and prognosis judgment of liver cancer occurrence and development, and a basis is provided for clinical application.

In order to solve the technical problems, the invention adopts the following technical scheme:

in one aspect, the invention provides a molecular marker of hepatocellular carcinoma, wherein the molecular marker is an expression product of NTNG1 gene or NTNG1 gene.

Further, the hepatocellular carcinoma is a human primary liver cancer.

In one aspect, the invention provides a use of at least one of the expression products of the NTNG1 gene or the NTNG1 gene in the preparation of a hepatocellular carcinoma drug.

In one aspect, the invention provides an application of at least one of a cell strain stably overexpressing NTNG1 gene or a cell strain stably knocking down NTNG1 gene in the content evaluation of NTNG1 gene inside and outside organism cells.

In another aspect, the invention provides a cell line stably overexpressing NTNG1 gene, which uses liver cancer cells as a target system and is infected by NTNG1 overexpression lentivirus to obtain the liver cancer cells stably overexpressing NTNG1 gene.

Further, the liver cancer cells are SMMC7721 and/or HepG2 cells.

Further, after the infection, positive cloning was performed using antibiotics to establish a 14 day stable cell line.

In another aspect, the present invention provides a method for constructing a cell line stably overexpressing NTNG1 gene, comprising the following steps:

(a) the sequences were cut with restriction enzymes EcoR I and BamH I, respectively, as SED ID NO: 1, electrophoresing to obtain the sequence shown as SED ID NO: 2, a linearized support;

(b) extracting total RNA from fresh tissue specimen, reverse transcribing to cDNA, PCR amplifying to obtain sequence such as SEDID NO: 3, a fragment of the NTNG1 gene;

(c) connecting the linearized vector with an NTNG1 gene fragment by using DNA ligase to obtain an NTNG1 overexpression lentiviral vector;

(d) sequences such as SED ID NO: 4, infecting a liver cancer cell strain by the NTNG1 overexpression lentivirus, and carrying out drug screening by using antibiotics to obtain a cell strain stably overexpressing the NTNG1 gene.

Further, the conditions of the packaging are: mixing at room temperature for 20min, transfecting for 20 hr, and collecting.

Further, the electrophoresis conditions are as follows: 1% agarose gel, 230V, 30 min.

Further, the PCT amplification system is as follows:

the sequence of primer 1 here is: ctaccggactcagatctcgagGCCACCATGTATTTGTCAAGATTCCTGTCGA, respectively;

the sequence of primer 2 is: gtcatccttgtaatcgaattc GAACACCAGGGGGCTGGCG are provided.

Further, the connection conditions are as follows: water bath at 37 deg.C for 30min, and transformation.

Further, the lentiviral vector is Plvx-CMV-MCS-T2A-Blasticidin; the antibiotic is blasticidin.

Further, the liver cancer cell strain is selected from Huh-7 cells, SMMC7721 cells, MHCC-97H cells and HepG2 cells.

Further, the method also comprises the step of verifying the expression level of the NTNG1 in the cell strain which stably over-expresses the NTNG1 gene by utilizing qRT-PCR and western blot method.

According to the invention, the liver cancer cell is directly infected by the NTNG1 overexpression lentivirus, so that a cell strain for stably overexpressing the NTNG1 gene is constructed; and verifying the expression quantity of the NTNG1 gene in the cell strain by utilizing a qRT-PCR and western blot method, and displaying that the expression quantity of the constructed cell strain is higher than that of a control cell strain. Verification shows that the NTNG1 gene can be efficiently and stably over-expressed in the constructed cell strain.

In one aspect, the invention provides a cell line for stably knocking down NTNG1 gene, wherein the cell line takes liver cancer cell as a target system and is expressed by a sequence such as SED ID NO: 7, the NTNG1 interferes with the lentivirus infection to obtain the liver cancer cell with the stably knocked-down NTNG1 gene.

Further, the liver cancer cells are SMMC7721 and/or HepG2 cells.

Further, after the infection, positive cloning was performed using antibiotics to establish a 14 day stable cell line.

In one aspect, the invention provides a construction method for stably knocking down an NTNG1 gene cell strain, which comprises the following steps:

(1) nucleotide sequences as described by SED ID NO: shRNA templates shown in 5 were ligated to sequences such as SED ID NO: 6 to obtain NTNG1 interference lentivirus vector;

(2) sequences prepared using NTNG1 to interfere with lentiviral vector packaging such as SED ID NO: NTNG1 shown in fig. 7 interferes with lentiviruses; the NTNG1 interferes the slow virus to infect the liver cancer cell strain, the infected cell is cultured, and the cell strain with the NTNG1 gene stably knocked down is obtained by screening with antibiotics.

Further, the conditions of the packaging are: mixing at room temperature for 20min, transfecting for 20 hr, and collecting.

Further, the connection conditions are as follows: ligation was performed at 22 ℃ for 1 h.

Further, the lentiviral vector is Plvx-hU6-MCS-ZsGreen 1-Puro; the antibiotic is puromycin.

Further, the liver cancer cell strain is selected from Huh-7 cells, SMMC7721 cells, MHCC-97H cells and HepG2 cells.

Further, the method also comprises the step of verifying the expression level of the NTNG1 in the cell strain with the stably knocked-down NTNG1 gene by utilizing a qRT-PCR and western blot method.

According to the invention, the NTNG1 is interfered with lentivirus to directly infect the liver cancer cell, so that a cell strain for stably knocking down the NTNG1 gene is constructed; and verifying the expression quantity of the NTNG1 gene in the cell strain by utilizing a qRT-PCR and western blot method, and displaying that the expression level of the constructed cell strain is lower than that of a control cell strain. Can realize the further research on the function of the NTNG1 gene.

Advantageous effects

According to the invention, the expression level of the NTNG1 gene in the liver cancer tissue is found to be higher than that of the adjacent tissue by research, which shows that the correlation between the expression level of the NTNG1 gene and the liver cancer is obvious, and the expression product of the NTNG1 gene or the NTNG1 gene can be used as a molecular marker of the liver cancer, so that effective information can be provided for diagnosis and targeted therapy of the liver cancer.

Experiments show that the expression products of the NTNG1 gene and the NTNG1 gene participate in invasion, migration, apoptosis and cell cycle process of cell cancer, so that the expression products of the NTNG1 gene or the NTNG1 gene can be used as cancer diagnosis, metastasis, molecules and prognosis markers, early discovery and early treatment of liver cancer can be realized, and the survival rate of patients is improved. The NTNG1 gene and its expression product can be used as the therapeutic target of liver cancer, and can be used for preparing medicine for treating liver cancer;

experiments show that the provided cell strain for stably knocking down the NTNG1 gene and the cell strain for stably over-expressing the NTNG1 gene both have influence on the tumorigenicity in vivo, can realize further research on the function of the NTNG1 gene, is beneficial to disclosing the generation and development processes of liver cancer, and provides more information for the targeted treatment of the liver cancer.

Drawings

Figure 1 NTNG1 is expressed in liver cancer cell lines. (A) qRT-PCR measures the expression levels of NTNG1mRNA in normal hepatocytes and in liver cancer cell lines and in the normal hepatocyte line. (B) western blot detects the expression level of NTNG1 protein in hepatoma cell lines and normal hepatoma cell lines in hepatoma cells and hepatoma cell lines. (C) NTNG1 overexpressed HepG2 cell line NTNG1mRNA and protein expression levels. (D) SMMC7721 cell line NTNG1mRNA and protein expression levels over-expressed by NTNG 1. (E) NTNG1mRNA and protein expression levels in the HepG2 cell line with NTNG1 knockdown. (F) NTNG1mRNA and protein expression levels in the SMMC7721 cell line that were knocked down by NTNG 1. Data are mean ± standard deviation of 3 independent experiments.

Figure 2 NTNG1 is expressed in human liver cancer tissue. (A) Expression of NTNG1mRNA in 42 paired HCC tissues and paracarcinoma tissues. (B) The average expression level of NTNG1mRNA in 42 matched HCC tissues and para-carcinoma tissues was detected by qRT-PCR. (C) western blot detects the expression level of NTNG1 protein in 42 paired HCC and para-cancerous tissues. (D) Histogram of gray values obtained from NTNG1 protein expression in 42 matched HCC tissues and paracancerous tissues. Data are mean ± standard deviation of 3 independent experiments.

FIG. 3(A) CCK-8 tests the effect of overexpression of NTNG1 on cell proliferative capacity. The NTNG1 is over-expressed, the proliferation rates of HepG2 and SMMC7721 cell strains are respectively obviously increased (P is less than 0.0001); (B) CCK8 examined the effect on cell viability following NTNG1 knockdown. After the NTNG1 is knocked down, the proliferation rates of HepG2 and SMMC7721 cell strains are respectively obviously reduced (P is less than 0.0001); (C) plate clone formation experiments examined the effect of NTNG1 overexpression on cell growth. Colonies of HepG2 and SMMC7721 cell strains over expressing NTNG1 are increased, and the formed colonies are obviously enlarged; (D) plate clone formation experiments examined the effect of knockdown of NTNG1 on cell growth. After knocking down of NTNG1, the colony numbers of HepG2 and SMMC7721 cell strains are obviously reduced, and the colony formation is obviously reduced.

Figure 4 NTNG1 significantly inhibited apoptosis of human liver cancer cells and regulated cell cycle progression (a) flow cytometry examined the effect of NTNG1 overexpression on apoptotic capacity. (B) Flow cytometry examined the effect on apoptosis following NTNG1 knockdown. (C) Flow cytometry examined the effect of overexpression of NTNG1 on the cell cycle. (D) Flow cytometry examined the effect of knocking down NTNG1 on the cell cycle.

FIG. 5 NTNG1 remarkably promotes invasion and migration capacity of human liver cancer cells (A) Transwell experiment detects the influence of over-expression of NTNG1 on invasion capacity of cells. The NTNG1 is over-expressed, and the invasion capacity of HepG2 and SMMC7721 cells is obviously enhanced respectively. (B) Transwell experiments examined the effect of NTNG1 knockdown on cell invasiveness. After NTNG1 knockdown, the invasive capacity of HepG2 and SMMC7721 cells, respectively, was significantly reduced. (C) Cell scratch assay examined the effect of NTNG1 overexpression on the ability of HepG2 and SMMC7721 cells to migrate. The NTNG1 is over-expressed, and promotes the migration capability of HepG2 and SMMC7721 cells. (D) The cell scratch test examined the effect of NTNG1 knockdown on the migratory capacity of HepG2 and SMMC7721 cells. After the knock-down of NTNG1, the migration capacity of HepG2 and SMMC7721 cells is obviously inhibited respectively.

FIG. 6 NTNG1 inhibits tumor growth in nude mice (A) nude mice injected with SMMC7721-NTNG1-KD and negative controls were followed up for 6 weeks for growth and tumor growth. (B) Tumor volumes were examined every other week and growth curves of the transplanted tumors were plotted for each group of nude mice. (C) At the end of the experiment, mice were sacrificed and tumors were isolated. SMMC7721 cells formed smaller tumors after NTNG knockdown compared to control (NC). (D) Relative weight of tumors in each group. (E) Relative tumor volume per group.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention.

1.1 tissue samples

42 patients who received surgical resection from Guangxi medical university affiliated tumor hospital in 2018 and 10 months to 2019 and 12 months were collected with liver cancer tissues and corresponding adjacent paracancerous tissues. All patients prior to surgery were informed that their surgical specimens may be used in the study, had written informed consent, and the study protocol was approved by the ethical and research committee of the affiliated tumor hospital, Guangxi medical university.

1.2 culture of cell lines

Human hepatoma cell lines (Huh-7, SMMC7721, MHCC-97H and HepG2) and normal hepatocytes (L02) were cultured in DMEM medium supplemented with 10% Fetal Bovine Serum (FBS) and 1% diabatic (penicillin and streptomycin) hyperglycemia at 37 ℃ with 5% CO₂Culturing in an incubator.

Example 1

qRT-PCR detection of expression of NTNG1

Fresh tissue specimens obtained by operation are placed in liquid nitrogen for cooling and then are stored in a freezing refrigerator at the temperature of minus 80 ℃. After all liver cancer tissues and tissues beside the cancer are cut into pieces, Trizol (TaKaRa, A-79061) reagent is used for extracting total RNA of the tissues, and the total RNA is reversely transcribed into cDNA according to the operation of a kit instruction. Reaction conditions are as follows: pre-denaturation at 95 ℃, enzyme activation (30s), denaturation at 95 ℃ (5s), 60 ℃ (30s), 40 cycles. Beta actin is used as internal reference and 2^-ΔΔCtThe method calculates the relative expression quantity of the target gene NTNG1 mRNA. The upstream primer of NTNG1 is 5'-CTTGGAAGGAGTATCCCAAGC-3', and the downstream primer is 5'-TGTGGCATAATACTGATAGGGCT-3'; the beta-actin upstream primer is 5'-CACCATTGGCAATGAGCGGTTC-3', and the downstream primer is 5'-AGGTCTTTGCGGATGTCCACGT-3'. The experiment was repeated 3 times. The conclusion is shown in FIG. 1A.

Establishment of a Stable cell line with overexpression and knockdown of NTNG1

2.1 establishment of a Stable cell line overexpressing NTNG1

The lentiviral vector was digested with restriction enzymes EcoR I and BamHI, respectively, the product of the digestion of the vector was subjected to agarose gel electrophoresis (1% agarose gel, 230V, 30min), and the desired band was recovered to obtain a linearized vector (plasmid).

Here the sequences of the lentiviral vectors are as SED ID NO: 1, specifically as follows:

ATGTATTTGTCAAGATTCCTGTCGATTCATGCCCTTTGGGTTACGGTGTCCTCAGTGATGCAGCCCTACCCTTTGGTTTGGGGACATTATGATTTGTGTAAGACTCAGATTTACACGGAAGAAGGGAAAGTTTGGGATTACATGGCCTGCCAGCCGGAATCCACGGACATGACAAAATATCTGAAAGTGAAACTCGATCCTCCGGATATTACCTGTGGAGACCCTCCTGAGACGTTCTGTGCAATGGGCAATCCCTACATGTGCAATAATGAGTGTGATGCGAGTACCCCTGAGCTGGCACACCCCCCTGAGCTGATGTTTGATTTTGAAGGAAGACATCCCTCCACATTTTGGCAGTCTGCCACTTGGAAGGAGTATCCCAAGCCTCTCCAGGTTAACATCACTCTGTCTTGGAGCAAAACCATTGAGCTAACAGACAACATAGTTATTACCTTTGAATCTGGGCGTCCAGACCAAATGATCCTGGAGAAGTCTCTCGATTATGGACGAACATGGCAGCCCTATCAGTATTATGCCACAGACTGCTTAGATGCTTTTCACATGGATCCTAAATCCGTGAAGGATTTATCACAGCATACGGTCTTAGAAATCATTTGCACAGAAGAGTACTCAACAGGGTATACAACAAATAGCAAAATAATCCACTTTGAAATCAAAGACAGGTTCGCGTTTTTTGCTGGACCTCGCCTACGCAATATGGCTTCCCTCTACGGACAGCTGGATACAACCAAGAAACTCAGAGATTTCTTTACAGTCACAGACCTGAGGATAAGGCTGTTAAGACCAGCCGTTGGGGAAATATTTGTAGATGAGCTACACTTGGCACGCTACTTTTACGCGATCTCAGACATAAAGGTGCGAGGAAGGTGCAAGTGTAATCTCCATGCCACTGTATGTGTGTATGACAACAGCAAATTGACATGCGAATGTGAGCACAACACTACAGGTCCAGACTGTGGGAAATGCAAGAAGAATTATCAGGGCCGACCTTGGAGTCCAGGCTCCTATCTCCCCATCCCCAAAGGCACTGCAAATACCTGTATCCCCAGTATTTCCAGTATTGGTAATTGTGAATGCTTCGGCCACTCCAATCGATGCAGTTATATCGATCTGCTAAATACAGTCATTTGCGTGAGCTGTAAACACAACACTAGAGGGCAGCACTGTGAGTTATGCAGGCTGGGCTACTTCAGAAATGCTTCTGCACAACTGGACGATGAGAATGTGTGCATAGAGTGTTATTGTAACCCTTTGGGCTCAATCCATGATCGTTGTAATGGCTCAGGATTTTGTGAGTGTAAGACTGGAACAACAGGGCCTAAGTGTGATGAGTGTCTGCCGGGAAATTCCTGGCACTACGGCTGTCAACCGAATGTCTGCGACAACGAGCTCCTGCACTGCCAGAACGGAGGGACGTGCCACAACAACGTGCGCTGCCTGTGCCCGGCCGCATACACGGGCATCCTCTGCGAGAAGCTGCGGTGCGAGGAGGCTGGCAGCTGCGGCTCCGACTCTGGCCAGGGCGCGCCCCCGCACGGCTCCCCAGCGCTGCTGCTGCTGACCACGCTGCTGGGAACCGCCAGCCCCCTGGTGTTCTAG

the sequences of the vectors linearized herein are as SED ID NO: 2, the concrete steps are as follows:

ACGCGTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTAACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAATTCAAAATTTTATCGATACTAGTATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGCGAATTCGGATCCGCGGCCGCGAAGGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCCCAAGCTTACCCATATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGAAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGACTTTTGCAGAGACGGCCCAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTG

the total tissue RNA was extracted from fresh tissue specimens in the manner of step 1 in example 1, and the total tissue RNA was reverse transcribed into cDNA, and the reverse transcribed cDNA was amplified by PCR to obtain purified NTNG1 gene fragment, as follows:

the sequence of primer 1 here is: ctaccggactcagatctcgagGCCACCATGTATTTGTCAAGATTCCTGTCGA, respectively;

the sequence of primer 2 is: gtcatccttgtaatcgaattc GAACACCAGGGGGCTGGCG

The materials are added into a thin-wall tube, mixed evenly and placed into a PCR instrument after point separation, and proper annealing temperature and extension temperature are selected, so that PCR amplification can be started.

Here, the sequence of the NTNG1 gene fragment is as SED ID NO: 3, the concrete steps are as follows:

ATGTATTTGTCAAGATTCCTGTCGATTCATGCCCTTTGGGTTACGGTGTCCTCAGTGATGCAGCCCTACCCTTTGGTTTGGGGACATTATGATTTGTGTAAGACTCAGATTTACACGGAAGAAGGGAAAGTTTGGGATTACATGGCCTGCCAGCCGGAATCCACGGACATGACAAAATATCTGAAAGTGAAACTCGATCCTCCGGATATTACCTGTGGAGACCCTCCTGAGACGTTCTGTGCAATGGGCAATCCCTACATGTGCAATAATGAGTGTGATGCGAGTACCCCTGAGCTGGCACACCCCCCTGAGCTGATGTTTGATTTTGAAGGAAGACATCCCTCCACATTTTGGCAGTCTGCCACTTGGAAGGAGTATCCCAAGCCTCTCCAGGTTAACATCACTCTGTCTTGGAGCAAAACCATTGAGCTAACAGACAACATAGTTATTACCTTTGAATCTGGGCGTCCAGACCAAATGATCCTGGAGAAGTCTCTCGATTATGGACGAACATGGCAGCCCTATCAGTATTATGCCACAGACTGCTTAGATGCTTTTCACATGGATCCTAAATCCGTGAAGGATTTATCACAGCATACGGTCTTAGAAATCATTTGCACAGAAGAGTACTCAACAGGGTATACAACAAATAGCAAAATAATCCACTTTGAAATCAAAGACAGGTTCGCGTTTTTTGCTGGACCTCGCCTACGCAATATGGCTTCCCTCTACGGACAGCTGGATACAACCAAGAAACTCAGAGATTTCTTTACAGTCACAGACCTGAGGATAAGGCTGTTAAGACCAGCCGTTGGGGAAATATTTGTAGATGAGCTACACTTGGCACGCTACTTTTACGCGATCTCAGACATAAAGGTGCGAGGAAGGTGCAAGTGTAATCTCCATGCCACTGTATGTGTGTATGACAACAGCAAATTGACATGCGAATGTGAGCACAACACTACAGGTCCAGACTGTGGGAAATGCAAGAAGAATTATCAGGGCCGACCTTGGAGTCCAGGCTCCTATCTCCCCATCCCCAAAGGCACTGCAAATACCTGTATCCCCAGTATTTCCAGTATTGGTAATTGTGAATGCTTCGGCCACTCCAATCGATGCAGTTATATCGATCTGCTAAATACAGTCATTTGCGTGAGCTGTAAACACAACACTAGAGGGCAGCACTGTGAGTTATGCAGGCTGGGCTACTTCAGAAATGCTTCTGCACAACTGGACGATGAGAATGTGTGCATAGAGTGTTATTGTAACCCTTTGGGCTCAATCCATGATCGTTGTAATGGCTCAGGATTTTGTGAGTGTAAGACTGGAACAACAGGGCCTAAGTGTGATGAGTGTCTGCCGGGAAATTCCTGGCACTACGGCTGTCAACCGAATGTCTGCGACAACGAGCTCCTGCACTGCCAGAACGGAGGGACGTGCCACAACAACGTGCGCTGCCTGTGCCCGGCCGCATACACGGGCATCCTCTGCGAGAAGCTGCGGTGCGAGGAGGCTGGCAGCTGCGGCTCCGACTCTGGCCAGGGCGCGCCCCCGCACGGCTCCCCAGCGCTGCTGCTGCTGACCACGCTGCTGGGAACCGCCAGCCCCCTGGTGTTCTAG

connecting the NTNG1 gene fragment amplified and purified by PCR with the linearized vector (plasmid) after enzyme digestion by using DNA ligase (the conditions are: water bath at 37 ℃ for 30min, transformation, plate coating and single clone extraction of plasmid) to obtain the NTNG1 overexpression lentiviral vector, packaging the NTNG1 overexpression lentiviral vector into lentivirus (the conditions are: mixing uniformly at room temperature for 20min, transfection for 20h, virus collection), and obtaining the NTNG1 overexpression lentivirus.

Here NTNG1 overexpresses lentiviral sequences such as SED ID NO: 4, specifically:

ACGCGTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTAACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAATTCAAAATTTTATCGATACTAGTATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGCGAATTCGCCACCATGTATTTGTCAAGATTCCTGTCGATTCATGCCCTTTGGGTTACGGTGTCCTCAGTGATGCAGCCCTACCCTTTGGTTTGGGGACATTATGATTTGTGTAAGACTCAGATTTACACGGAAGAAGGGAAAGTTTGGGATTACATGGCCTGCCAGCCGGAATCCACGGACATGACAAAATATCTGAAAGTGAAACTCGATCCTCCGGATATTACCTGTGGAGACCCTCCTGAGACGTTCTGTGCAATGGGCAATCCCTACATGTGCAATAATGAGTGTGATGCGAGTACCCCTGAGCTGGCACACCCCCCTGAGCTGATGTTTGATTTTGAAGGAAGACATCCCTCCACATTTTGGCAGTCTGCCACTTGGAAGGAGTATCCCAAGCCTCTCCAGGTTAACATCACTCTGTCTTGGAGCAAAACCATTGAGCTAACAGACAACATAGTTATTACCTTTGAATCTGGGCGTCCAGACCAAATGATCCTGGAGAAGTCTCTCGATTATGGACGAACATGGCAGCCCTATCAGTATTATGCCACAGACTGCTTAGATGCTTTTCACATGGATCCTAAATCCGTGAAGGATTTATCACAGCATACGGTCTTAGAAATCATTTGCACAGAAGAGTACTCAACAGGGTATACAACAAATAGCAAAATAATCCACTTTGAAATCAAAGACAGGTTCGCGTTTTTTGCTGGACCTCGCCTACGCAATATGGCTTCCCTCTACGGACAGCTGGATACAACCAAGAAACTCAGAGATTTCTTTACAGTCACAGACCTGAGGATAAGGCTGTTAAGACCAGCCGTTGGGGAAATATTTGTAGATGAGCTACACTTGGCACGCTACTTTTACGCGATCTCAGACATAAAGGTGCGAGGAAGGTGCAAGTGTAATCTCCATGCCACTGTATGTGTGTATGACAACAGCAAATTGACATGCGAATGTGAGCACAACACTACAGGTCCAGACTGTGGGAAATGCAAGAAGAATTATCAGGGCCGACCTTGGAGTCCAGGCTCCTATCTCCCCATCCCCAAAGGCACTGCAAATACCTGTATCCCCAGTATTTCCAGTATTGGTAATTGTGAATGCTTCGGCCACTCCAATCGATGCAGTTATATCGATCTGCTAAATACAGTCATTTGCGTGAGCTGTAAACACAACACTAGAGGGCAGCACTGTGAGTTATGCAGGCTGGGCTACTTCAGAAATGCTTCTGCACAACTGGACGATGAGAATGTGTGCATAGAGTGTTATTGTAACCCTTTGGGCTCAATCCATGATCGTTGTAATGGCTCAGGATTTTGTGAGTGTAAGACTGGAACAACAGGGCCTAAGTGTGATGAGTGTCTGCCGGGAAATTCCTGGCACTACGGCTGTCAACCGAATGTCTGCGACAACGAGCTCCTGCACTGCCAGAACGGAGGGACGTGCCACAACAACGTGCGCTGCCTGTGCCCGGCCGCATACACGGGCATCCTCTGCGAGAAGCTGCGGTGCGAGGAGGCTGGCAGCTGCGGCTCCGACTCTGGCCAGGGCGCGCCCCCGCACGGCTCCCCAGCGCTGCTGCTGCTGACCACGCTGCTGGGAACCGCCAGCCCCCTGGTGTTCTAGGGATCCGCGGCCGCGAAGGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCCCAAGCTTACCCATATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGAAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGACTTTTGCAGAGACGGCCCAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTG

the resulting NTNG1 overexpressing lentivirus was infected into HepG2 and SMMC7721 cells.

Positive clones were selected with antibiotics (SMMC7721 and HepG2 cells at 2. mu.g/mL and 5. mu.g/mL, respectively) to establish 14-day stable cell lines: HepG2-NTNG1-OE, SMMC7721-NTNG1-OE cells.

The efficiency of overexpression of NTNG1 was tested by qRT-PCR and westemblot, and the results are shown in FIGS. 1C and 1D.

Wherein the lentiviral vector is Plvx-CMV-MCS-T2A-Blasticidin; the antibiotic is blasticidin.

2.2 establishment of a Stable cell line with knockdown of NTNG1

qRT-PCR was used for detection, and the sequencing results were analyzed by alignment with the sequence of NTGN 1. Landing on Public TRC Portal website, search NTNG1 and select verified and higher scoring shRNA interference sequences 5'-GCATAGAGTGTTATTGTAACC-3' and 5'-GCCTAAGTGTGATGAGTGTCT-3' of NTNG1 from the results, and compare by BLAST homology.

The synthesized shRNA template (nucleotide sequence shown as SED ID NO: 5, specifically GCCTAAGTGTGATGAGTGTCT; the specific synthesis process aims at the target gene sequence of the target gene, multiple RNA interference target point sequences are designed by using the RNA interference sequence design principle provided in a public website, evaluation and determination are carried out according to the design experience and design software, the target point with the best kinetic parameter is selected to enter the subsequent experimental process) is connected with the lentiviral vector (the target point is connected for 1h at the temperature of 22 ℃), and the NTNG1 interference lentiviral vector is obtained.

Packaging the obtained NTNG1 interference lentivirus vector to prepare NTNG1 interference lentivirus (conditions are: mixing evenly for 20min at room temperature, transfecting for 20h, collecting virus), and allowing NTNG1 interference lentivirus to infect HepG2 and SMMC7721 cells.

Positive clones were selected with antibiotics (SMMC7721 and HepG2 cells at 2. mu.g/mL and 5. mu.g/mL, respectively) to establish 14-day stable cell lines: HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD 2.

The efficiency of NTNG1 knockdown was detected by qRT-PCR and western blot, and was concluded as fig. 1E, 1F.

The lentiviral vector is Plvx-hU6-MCS-zsGreen 1-Puro; the antibiotic is puromycin.

Here lentiviral vector sequences such as SED ID NO: 6, specifically:

ACGCGTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTAACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAATTCAAAATTTTATTACAGGGACAGCAGAGATCCAGTTTATCGATCTGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAGGATCCGGACAAGCTTCGAATTCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCCTAACTCGAGTAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGCAAGCTGTGACCGGCGCCTACGCTAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGACTTTTGCAGAGACGGCCCAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTG

here NTNG1 interferes with lentiviral sequences such as SED ID NO: 7, specifically:

ACGCGTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTAACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAATTCAAAATTTTATTACAGGGACAGCAGAGATCCAGTTTATCGATCTGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAGGATCCGCCTAAGTGTGATGAGTGTCTTTCAAGAGAAGACACTCATCACACTTAGGCTTTTTTGAATTCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCCTAACTCGAGTAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGCAAGCTGTGACCGGCGCCTACGCTAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGACTTTTGCAGAGACGGCCCAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTG

2.3 establishment of NTNG1 control cell line

HepG2-NTNG1-NC and SMMC7721-NTNG1-NC cells were constructed in a similar manner to 2.1-2.2.

Western blot experiment

Total protein in cells was extracted with cell lysate and protein concentration was measured using BCA kit (Biyun day) following the protocol strictly. Adding 30-50 μ g of standardized protein sample into each well, performing constant-pressure electrophoresis of concentrated gel at 80V in a vertical electrophoresis tank filled with Tris-Glycine electrophoresis solution to separation gel interface, and adjusting to 120V to continue electrophoresis to the bottom of bromocyan separation gel. Transfer to poly PVDF membrane, designated primary antibody room temperature incubation for 2h or 4 degrees C were incubated overnight. TBST was washed for 3 times for 10min, and a secondary antibody was added and incubated for 1h at room temperature. Taking out the PVDF membrane, washing for 10min by TBST for 3 times; sucking the liquid on the film, adding ECL working solution on the clean preservative film, and reacting for 2-5 min; tabletting and developing in a dark room. The gray value of each band was measured by Image J software, and the expression level of NTNG1 protein in each group of cells was represented by the ratio of the gray value of the target band to the gray value of the β -actin band, as shown in FIG. 1B.

And (4) conclusion: expression of NTNG1 in liver cancer cell lines and normal liver cell lines

qRT-PCR and western blot are adopted to detect the expression conditions of NTNG1mRNA and protein in human liver cancer cell strains Huh7, SMMC7721, 97H, HepG2 and normal liver cell strain L-02.

The qRT-PCR assay found that mRNA of NTNG1 exhibited generally high expression in liver cancer cell lines compared to normal liver cells (L-02) (fig. 1A). Meanwhile, western blot assay found that NTNG1 protein exhibited generally high expression in hepatoma cell lines (Huh7, SMMC7721, 97H and HepG2) compared to normal hepatocytes (L-02) (fig. 1B).

1) The expression conditions of NTNG1mRNA and protein in liver cancer tissues and cancer adjacent tissues (1.5-2 cm away from cancer tissues) of 42 HCC patients after operation are detected by adopting qRT-qPCR and western blot.

qRT-PCR detection finds that: the NTNG1mRNA is expressed in liver cancer tissues and para-cancer tissues, and the expression level of the NTNG1mRNA in the cancer tissues is higher than that of the patients in the para-cancer tissues, which accounts for 64.29 percent (27/42); 11.90% of patients with para-cancerous tissue expression higher than that of cancerous tissue (5/42); 23.81% (10/42) patient NTNG1mRNA expression was not significantly different in cancer tissues from paracancerous tissues (FIG. 2A). The statistical result shows that the expression level of NTNG1mRNA in liver cancer tissue is 0.012420 + -0.019500, and in paracarcinoma tissue is 0.004611 + -0.004859, the expression level of NTNG1mRNA in liver cancer tissue is obviously higher than that in paracarcinoma tissue, and the difference has statistical significance (t is 2.79, P is less than 0.05, and figure 2B).

Western blot detection shows that NTNG1 protein is expressed in liver cancer tissues and para-carcinoma tissues, and the expression level of NTNG1 protein in the cancer tissues is higher than that of 59.53% (25/42) of patients in the para-carcinoma tissues; the expression level of the para-cancerous tissue is 30.95% higher than that of the patients with cancerous tissue (13/42); 9.52% (4/42) patient NTNG1mRNA expression was not significantly different in cancer tissues from paracancerous tissues (FIG. 2C). The statistical result shows that the expression level of the NTNG1 protein in the liver cancer tissue is 0.722390 +/-0.3015073, the expression level of the NTNG1 protein in the liver cancer tissue is 0.870212 +/-0.295557, the expression level of the NTNG1 protein in the liver cancer tissue is obviously higher than that of the liver cancer tissue, and the difference has statistical significance (P is less than 0.05, and figure 2D). The research result shows that NTNG1 presents high expression level in liver cancer tissues, and the NTNG1 is related to the occurrence of liver cancer.

2) The experimental group selects HepG2 and SMMC7721 cell strains, establishes the HepG2-NTNG1-OE and SMMC7721-NTNG1-OE cell strains with NTNG1 overexpression by repeated transfection by a recombinant plasmid liposome method, detects the overexpression efficiency of the NTNG1 by qRT-PCR and western blot, and shows that the mRNA and protein expression levels of the transfected cell strains NTNG1 are obviously increased (figures 1C and D, P is less than 0.05). The construction of stable transformants of HepG2 and SMMC7721 with over-expression of NTNG1 was suggested to be successful.

3) The NTNG1 interference lentivirus vector is used for transfecting HepG2 and SMMC7721 cells to establish a HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 cell strain which silence NTNG1, and the result shows that the expression level of NTNG1mRNA and protein in the HepG2 and SMMC7721 transfected cell strain is reduced (figure 1E and F, P is less than 0.05). The NTNG1 interference plasmid is successfully combined into HepG2 and SMMC7721 genomes, and the HepG2 and SMMC7721 stable transfer cell strains with the NTNG1 down-regulated are obtained. Can be used for carrying out subsequent functional tests.

Example 2

CCK-8 assay (cytotoxicity assay)

The CCK-8 experiment was carried out according to the manufacturer's standard protocol. Cells were diluted in serum-free medium and seeded at a density of 2000 cells/well in 96-well cell culture plates. The plates were kept at 37 ℃ with 5% CO₂An incubator. To measure the growth rate of the cells, 100. mu.L of spent medium was replaced with an equal volume of fresh medium containing 10% CCK-8. The cells were then incubated for a further 3 hours at 37 ℃. The absorbance of the cells was finally measured at 450nm using a microplate reader (5082Grodig, Tecan, Austria). The experiment was repeated 3 times and the results were recorded.

1. Plate clone formation experiment

Cells in the logarithmic growth phase were taken from the cells in the good growth state, trypsinized, resuspended in a medium, inoculated into six-well plates at 500 cells per well, and cultured normally for 1520 days. The cell culture fluid was aspirated, washed twice with Phosphate Buffered Saline (PBS), then fixed with methanol, stained with giemsa, observed under a microscope and the colony formation rate was counted. The number of clones was counted as one, counting more than 50 clones formed, and only viable cells were counted, and the formula was:

the clone formation rate (number of clones/number of seeded cells) × 100%. The experiment was repeated three times.

And (4) conclusion: NTNG1 promotes proliferation and growth of human liver cancer cell in vitro

CCK8 experiments and cloning and nodulation experiments are adopted to detect the proliferation capacity and the cloning and nodulation capacity of HepG2-NTNG1-OE, SMMC7721-NTNG1-OE, HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1, SMMC7721-NTNG1-KD2, control groups HepG2-NTNG1-NC and SMMC7721-NTNG1-NC cell strains.

CCk8 experiment results show that after the NTNG1 is over-expressed, the proliferation rates of HepG2-NTNG1-OE and SMMC7721-NTNG1-OE cell strains are respectively obviously higher than those of control groups of HepG2-NTNG-NC and SMMC7721-NTNG1-NC cell strains, and the differences have statistical significance (P is less than 0.001, and figure 3A).

When NTNG1 was knocked down, the proliferation rates of HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 cells were respectively significantly lower than those of the control group, the proliferation ability of the cells was reduced, and the differences were statistically significant (P < 0.0001, FIG. 3B).

The cloning experiment results show that: after the NTNG1 is over-expressed, compared with negative control groups HepG2-NTNG-NC and SMMC7721-NTNG1-NC, the colony forming rate of HepG2-NTNG1-OE and SMMC7721-NTNG1-OE cell strains is obviously increased, the cloning capacity is enhanced, and the differences have significance (P is less than 0.05, and figure 3C). It is suggested that NTNG1 may enhance the in vitro cloning and tumor-forming ability of human liver cancer cells HepG2 and SMMC 7721.

Meanwhile, after the NTNG1 is knocked down, compared with a negative control group, the cell clones of HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 are obviously reduced in formed number, smaller in clone sphere formation and lighter in staining (P is less than 0.05, and shown in a figure 3D). The experimental result shows that the NTNG1 can promote the proliferation and growth of human liver cancer cells in vitro.

Example 3

Flow cytometry

The 48h transfected groups of HepG2 and SMMC7721 cells were collected, digested with EDTA-free trypsin, washed twice with PBS, resuspended in 500 μ L binding buffer, added with 5 μ L annexin V-Fluorescein Isothiocyanate (FITC) and Propidium Iodide (PI), incubated for 15min at room temperature in the dark, and the apoptosis rate of each group of cells was determined on a flow cytometer (BD usa). Then, the cells were collected, fixed with 70% ethanol at 4 ℃ for 2 hours, treated with PI (50. mu.g/mL) and RNaseA I (100. mu.g/mL), incubated at 37 ℃ in the dark for 30min, and placed in a flow cytometer to analyze changes in DNA content at each stage of the cells. The experiment was repeated three times.

And (4) conclusion: NTNG1 inhibits human hepatoma cell apoptosis and regulates cell cycle progression

Uncontrolled proliferation of tumor cells due to apoptosis and cycle regulation disorders is the most common biological feature of malignancies. Flow cytometry was used to detect the apoptosis rate and cell cycle changes of HepG2-NTNG1-OE, SMMC7721-NTNG1-OE, HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1, SMMC7721-NTNG1-KD2, and control HepG2-NTNG1-NC, SMMC7721-NTNG1-NC cell lines.

The experiment results show that the up-regulation of NTNG1 leads to that the total number of apoptotic cells of HepG2-NTNG1-OE (p is 0.0022) and SMMC7721-NTNG1-OE cell lines (p is less than 0.0001) is obviously higher than that of control groups of HepG2-NTNG-NC and SMMC7721-NTNG1-NC cell lines (FIG. 4A).

Meanwhile, when NTNG1 is knocked down, the total number of apoptotic cells of HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 cell lines is respectively obviously lower than that of a control group, the proliferation capacity of the cells is weakened, and the differences have statistical significance (P is less than 0.0001, and figure 4B).

Since cell viability and apoptosis are related to the cell cycle, the effect of NTNG1 on the progression of the cell cycle was examined using flow cytometry. The experimental result shows that after the NTNG1 is over-expressed, compared with the cells of a control group, the cell ratios of the HepG2-NTNG1-OE cell line and the SMMC7721-NTNG1-OE cell line G0/G1 are obviously reduced (p is less than 0.01), the cell ratios of the cells in the S phase are obviously increased (p is less than 0.01), and the cell ratios of the cells in the G2/M phase are not obviously changed (p is more than 0.05). Meanwhile, when NTNG1 is knocked down, compared with the cells of a control group, the cell proportion of the HepG2-KD1 cell strain G0/G1 is obviously increased (P is less than 0.001), and the cell proportion of the cell strain in S phase and G2/M phase is obviously reduced (P is less than 0.05); the cell proportion of HepG2-KD2 cells in G0/G1 phase is obviously increased (P < 0.001), the cell proportion in S phase is obviously reduced (P < 0.001), and the cell proportion in G2/M phase is not changed significantly (P > 0.05, FIG. 4C). Compared with control cells, the proportion of cells in the SMMC7721-KD1 cells in the G0/G1 phase is obviously increased (P < 0.05), and the proportion of cells in the S phase and the G2/M phase is not changed significantly (P > 0.05); the cell proportion of SMMC7721-KD2 cells in G0/G1 phase was significantly increased (P < 0.001), and the cell proportion in G2/M phase and S phase was significantly decreased (P < 0.01, FIG. 4D). The influence of NTNG1 on HepG2 and SMMC7721 cell cycles is mainly shown in the influence on G1/S switching points, the over-expression of NTNG1 causes the shortening of G0/G1 phase, the cells rapidly enter S phase, and the cell cycle process and the cell proliferation are accelerated.

Example 4

1Transwell cell assay

The Transwell chamber was placed in a 24-well plate prepared with an artificial basement membrane (Matrigel) Matrigel in advance, and placed in an environment at 37 ℃ for 30min, and a medium containing 10% fetal bovine serum was added to the lower chamber of the Transwell chamber. Upper chamber of Transwell Add serum-free DMEM high-sugar Medium to resuspend each group of cells, 5% CO₂And cultured at 37 ℃ under saturated humidity for 48 h. After 48h, the culture medium in the lower chamber was removed, the chamber was fixed in 4% paraformaldehyde for 15min, stained with 0.1% crystal violet solution for 10min, dehydrated with ethanol, and the polycarbonate membrane was placed on a slide glass, and the number of invading cells was counted under a high power microscope (x 200). The experiment was repeated 3 times.

2 cell scratch test

HepG2 and SMMC7721 cell lines knocked down and over expressing NTNG1 were collected and seeded into six-well plates and cells were cultured for 24h until the plates were confluent. The cell layer was then gently scraped along the central axis using a sterile pipette tip and washed with PBS. Photographs were taken with a phase contrast microscope (200 x) at 0h and 48h after scratching, respectively, and the corresponding percent scratch area was calculated with Image J software. The experiment was repeated three times.

And (4) conclusion: NTNG1 promotes invasion and migration of human liver cancer cell in vitro

The prognosis difference of the liver cancer is mainly closely related to invasion and metastasis of cancer cells of the liver cancer, so that invasion and migration capacities of HepG2-NTNG1-OE, SMMC7721-NTNG1-OE, HepG2-NTNG1-KD1, HepG2-NTNG1-KD2, SMMC7721-NTNG1-KD1, SMMC7721-NTNG1-KD2 and control groups of HepG2-NTNG1-NC and SMMC7721-NTNG1-NC cell strains are detected by using a Transwell invasion experiment and a cell scratch experiment.

CCK8 experiment results show that after NTNG1 is over-expressed, the cell numbers of HepG2-NTNG1-OE (P is 0.0015) and SMMC7721-NTNG1-OE (P is less than 0.0001) cell strains penetrating through the bottom of a membrane are respectively obviously higher than those of control groups of HepG2-NTNG-NC and SMMC7721-NTNG1-NC cell strains, the invasion capacity of the cells is enhanced, and the difference has statistical significance (figure 5A). Meanwhile, when NTNG1 was knocked down, HepG2-NTNG1-KD1 (P0.0012), HepG2-NTNG1-KD2 (P0.0001) and SMMC7721-NTNG1-KD1 (P0.0015) and SMMC7721-NTNG1-KD2 (P0.0264) cell lines penetrated through the membrane bottom, the cell numbers were significantly lower than those of the control group, the invasion ability of the cells was weakened, and the differences were statistically significant (FIG. 5B).

Cell scratching experiments show that after NTNG1 is over-expressed, compared with a negative control cell line, the cell lines of HepG2-NTNG1-OE (P ═ 0.0004) and SMMC7721-NTNG1-OE (P ═ 0.0004) have obviously narrowed scratching distance and obviously increased wound healing rate, and the difference has statistical significance (figure 5C). Meanwhile, after the NTNG1 was knocked down, compared with negative control cell lines, experimental groups HepG2-NTNG1-KD1(P ═ 0.0366), HepG2-NTNG1-KD2(P ═ 0.0104), SMMC7721-NTNG1-KD1(P ═ 0.0017) and SMMC7721-NTNG1-KD2(P ═ 0.0002) cell lines had a wider cross-sectional distance, a significantly decreased healing rate, and the differences were statistically significant (fig. 5D).

Therefore, the NTNG1 plays a key role in the occurrence and development of liver cancer.

Example 5

Construction of model of subcutaneous transplanted hepatoma cell

Collecting SMMC7721 cells 48h after virus transfection, adjusting cell count in cell suspension to 1 × 10⁷and/mL. 18 nude mice (4-6 weeks old, 18-22g) were randomly divided into 3 groups (6 per group). 0.2ml of SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 cells are implanted subcutaneously in the experimental group; the negative control group was subcutaneously seeded with 0.2ml of SMMC7721-NTNG1-NC cells. Growth was followed for 6 weeks in a human liver cancer transplantable tumor model and tumor volume was measured once a week using calipers as (tumor length x width)²)/2. After six weeks, mice were euthanized and their final tumor size and volume were measured. The study of mice was conducted strictly in accordance with the "guidelines for care and use of laboratory animals" and was approved by the animal care and use committee of the affiliated tumor hospital, Guangxi medical university.

And (4) conclusion: down-regulation of NTNG1 can inhibit the growth of subcutaneous transplanted tumor in nude mouse

In order to research the influence of the NTNG1 on the liver cancer, the cell strains of the control group SMMC7721-NTNG1-NC and the experimental groups SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 are injected into the subcutaneous tissues of nude mice to carry out the experiment of forming the tumor of the subcutaneous liver cancer cells of the nude mice.

The observation shows that compared with the control group, the volume growth difference of the transplanted tumor in 1-3 weeks of the nude mice of the experimental group and the control group is not obvious, and the tumor growth curve obviously shows a separation trend in 4 weeks along with the time extension. The growth of the transplanted tumor of the experimental group and the control group reaches the maximum value at the 6 th week of the nude mouse tumorigenesis, and the volume of the transplanted tumor of the control group SMMC7721-NTNG1-NC is (0.2521 +/-0.1039) cm³The experimental groups SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 are (0.1003 +/-0.0363) cm³And (0.0874. + -. 0.0476) cm³The difference was statistically significant (P < 0.05, FIGS. 6A, 6B). All groups of nude mice survived during the experiment, and the skin of the tumor area has no ulcer and necrosis, and the defecation and diet conditions are normal. After a nude mouse subcutaneous transplantation tumor model is established for 6 weeks, all nude mice are sacrificed by adopting a cervical dislocation method. The subcutaneous tumors were removed and their weight and volume were measured and counted (fig. 6C). The mass of the transplanted tumor of the experimental group SMMC7721-NTNG1-KD1 and the SMMC7721-NTNG1-KD2 are (0.0950 +/-0.0089) g and (0.0826 +/-0.0135) g respectively, the mass of the control group is SMMC7721-NTNG1-NC (0.2521 +/-0.04243) g, and the mass of the experimental group is lighter than that of the control group, and the differences are all the sameThere is significance (P ═ 0.0017, P ═ 0.0013, fig. 6D). The control group SMMC7721-NTNG1-NC has a volume of (0.2521 + -0.0424) cm³The volumes of the experimental groups SMMC7721-NTNG1-KD1 and SMMC7721-NTNG1-KD2 are (0.1003 +/-0.0148) cm³And (0.0874. + -. 0.0195) cm³The volume of the experimental group was smaller than that of the control group, and the differences were all statistically significant (P ═ 0.0070, P ═ 0.0055, fig. 6E). The results of in-vivo experiments of animals show that NTNG1 promotes the growth of subcutaneous transplanted tumor of SMMC7721 cells of human liver cancer.

Although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Beam-Yang

<120> construction method and application of cell strain expressing NTNG1 gene

<130>2020

<141>2020-07-30

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>1620

<212>DNA

<213>artificial sequence

<400>1

atgtatttgt caagattcct gtcgattcat gccctttggg ttacggtgtc ctcagtgatg 60

cagccctacc ctttggtttg gggacattat gatttgtgta agactcagat ttacacggaa 120

gaagggaaag tttgggatta catggcctgc cagccggaat ccacggacat gacaaaatat 180

ctgaaagtga aactcgatcc tccggatatt acctgtggag accctcctga gacgttctgt 240

gcaatgggca atccctacat gtgcaataat gagtgtgatg cgagtacccc tgagctggca 300

cacccccctg agctgatgtt tgattttgaa ggaagacatc cctccacatt ttggcagtct 360

gccacttgga aggagtatcc caagcctctc caggttaaca tcactctgtc ttggagcaaa 420

accattgagc taacagacaa catagttatt acctttgaat ctgggcgtcc agaccaaatg 480

atcctggaga agtctctcga ttatggacga acatggcagc cctatcagta ttatgccaca 540

gactgcttag atgcttttca catggatcct aaatccgtga aggatttatc acagcatacg 600

gtcttagaaa tcatttgcac agaagagtac tcaacagggt atacaacaaa tagcaaaata 660

atccactttg aaatcaaaga caggttcgcg ttttttgctg gacctcgcct acgcaatatg 720

gcttccctct acggacagct ggatacaacc aagaaactca gagatttctt tacagtcaca 780

gacctgagga taaggctgtt aagaccagcc gttggggaaa tatttgtaga tgagctacac 840

ttggcacgct acttttacgc gatctcagac ataaaggtgc gaggaaggtg caagtgtaat 900

ctccatgcca ctgtatgtgt gtatgacaac agcaaattga catgcgaatg tgagcacaac 960

actacaggtc cagactgtgg gaaatgcaag aagaattatc agggccgacc ttggagtcca 1020

ggctcctatc tccccatccc caaaggcact gcaaatacct gtatccccag tatttccagt 1080

attggtaatt gtgaatgctt cggccactcc aatcgatgca gttatatcga tctgctaaat 1140

acagtcattt gcgtgagctg taaacacaac actagagggc agcactgtga gttatgcagg 1200

ctgggctact tcagaaatgc ttctgcacaa ctggacgatg agaatgtgtg catagagtgt 1260

tattgtaacc ctttgggctc aatccatgat cgttgtaatg gctcaggatt ttgtgagtgt 1320

aagactggaa caacagggcc taagtgtgat gagtgtctgc cgggaaattc ctggcactac 1380

ggctgtcaac cgaatgtctg cgacaacgag ctcctgcact gccagaacgg agggacgtgc 1440

cacaacaacg tgcgctgcct gtgcccggcc gcatacacgg gcatcctctg cgagaagctg 1500

cggtgcgagg aggctggcag ctgcggctcc gactctggcc agggcgcgcc cccgcacggc 1560

tccccagcgc tgctgctgct gaccacgctg ctgggaaccg ccagccccct ggtgttctag 1620

<210>2

<211>7176

<212>DNA

<213>artificial sequence

<400>2

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcggtt 1800

aacttttaaa agaaaagggg ggattggggg gtacagtgca ggggaaagaa tagtagacat 1860

aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa attacaaaat tcaaaatttt 1920

atcgatacta gtattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 1980

tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 2040

gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 2100

gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 2160

tgacgcaaat gggcggtagg cgtgtacggt gggaggttta tataagcaga gctcgtttag 2220

tgaaccgtca gatcgcctgg agacgccatc cacgctgttt tgacctccat agaagattct 2280

agagctagcg aattcggatc cgcggccgcg aaggatctgc gatcgctccg gtgcccgtca 2340

gtgggtaggg gaggcgcttt tcccaaggca gtctggagca tgcgctttag cagccccgct 2400

gggcacttgg cgctacacaa gtggcctctg gcctcgcaca cattccacat ccaccggtag 2460

gcgccaaccg gctccgttct ttggtggccc cttcgcgcca ccttctactc ctcccctagt 2520

caggaagttc ccccccgccc cgcagctcgc gtcgtgcagg acgtgacaaa tggaagtagc 2580

acgtctcact agtctcgtgc agatggacag caccgctgag caatggaagc gggtaggcct 2640

ttggggcagc ggccaatagc agctttgctc cttcgctttc tgggctcaga ggctgggaag 2700

gggtgggtcc gggggcgggc tcaggggcgg gctcaggggc ggggcgggcg cccgaaggtc 2760

ctccggaggc ccggcattct gcacgcttca aaagcgcacg tctgccgcgc tgttctcctc 2820

ttcctcatct ccgggccttt cgacctgcag cccaagctta cccatatggc caagcctttg 2880

tctcaagaag aatccaccct cattgaaaga gcaacggcta caatcaacag catccccatc 2940

tctgaagact acagcgtcgc cagcgcagct ctctctagcg acggccgcat cttcactggt 3000

gtcaatgtat atcattttac tgggggacct tgtgcagaac tcgtggtgct gggcactgct 3060

gctgctgcgg cagctggcaa cctgacttgt atcgtcgcga tcggaaatga gaacaggggc 3120

atcttgagcc cctgcggacg gtgccgacag gtgcttctcg atctgcatcc tgggatcaaa 3180

gccatagtga aggacagtga tggacagccg acggcagttg ggattcgtga attgctgccc 3240

tctggttatg tgtgggaggg ctaagtcgac aatcaacctc tggattacaa aatttgtgaa 3300

agattgactg gtattcttaactatgttgct ccttttacgc tatgtggata cgctgcttta 3360

atgcctttgt atcatgctat tgcttcccgt atggctttca ttttctcctc cttgtataaa 3420

tcctggttgc tgtctcttta tgaggagttg tggcccgttg tcaggcaacg tggcgtggtg 3480

tgcactgtgt ttgctgacgc aacccccact ggttggggca ttgccaccac ctgtcagctc 3540

ctttccggga ctttcgcttt ccccctccct attgccacgg cggaactcat cgccgcctgc 3600

cttgcccgct gctggacagg ggctcggctg ttgggcactg acaattccgt ggtgttgtcg 3660

gggaaatcat cgtcctttcc ttggctgctc gcctgtgttg ccacctggat tctgcgcggg 3720

acgtccttct gctacgtccc ttcggccctc aatccagcgg accttccttc ccgcggcctg 3780

ctgccggctc tgcggcctct tccgcgtctt cgccttcgcc ctcagacgag tcggatctcc 3840

ctttgggccg cctccccgcc tggtaccttt aagaccaatg acttacaagg cagctgtaga 3900

tcttagccac tttttaaaag aaaagggggg actggaaggg ctaattcact cccaacgaaa 3960

ataagatctg ctttttgctt gtactgggtc tctctggtta gaccagatct gagcctggga 4020

gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc cttgagtgct 4080

tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc tcagaccctt 4140

ttagtcagtg tggaaaatct ctagcagtag tagttcatgt catcttatta ttcagtattt 4200

ataacttgca aagaaatgaa tatcagagag tgagaggaac ttgtttattg cagcttataa 4260

tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca 4320

ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctggc tctagctatc 4380

ccgcccctaa ctccgcccag ttccgcccat tctccgcccc atggctgact aatttttttt 4440

atttatgcag aggccgaggc cgcctcggcc tctgagctat tccagaagta gtgaggaggc 4500

ttttttggag gcctagactt ttgcagagac ggcccaaatt cgtaatcatg gtcatagctg 4560

tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata 4620

aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca 4680

ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc 4740

gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg 4800

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 4860

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 4920

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 4980

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 5040

caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 5100

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt 5160

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 5220

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 5280

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 5340

ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta 5400

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 5460

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 5520

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 5580

tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 5640

tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 5700

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 5760

cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 5820

ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 5880

tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 5940

gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 6000

agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt 6060

atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 6120

tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 6180

gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 6240

agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 6300

cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact 6360

ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 6420

ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 6480

actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 6540

ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 6600

atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 6660

caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt 6720

attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt 6780

ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt 6840

ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg 6900

tgtcggggct ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 6960

cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ccattcgcca 7020

ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag 7080

ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg gttttcccag 7140

tcacgacgtt gtaaaacgac ggccagtgcc aagctg 7176

<210>3

<211>1620

<212>DNA

<213>artificial sequence

<400>3

atgtatttgt caagattcct gtcgattcat gccctttggg ttacggtgtc ctcagtgatg 60

cagccctacc ctttggtttg gggacattat gatttgtgta agactcagat ttacacggaa 120

gaagggaaag tttgggatta catggcctgc cagccggaat ccacggacat gacaaaatat 180

ctgaaagtga aactcgatcc tccggatatt acctgtggag accctcctga gacgttctgt 240

gcaatgggca atccctacat gtgcaataat gagtgtgatg cgagtacccc tgagctggca 300

cacccccctg agctgatgtt tgattttgaa ggaagacatc cctccacatt ttggcagtct 360

gccacttgga aggagtatcc caagcctctc caggttaaca tcactctgtc ttggagcaaa 420

accattgagc taacagacaa catagttatt acctttgaat ctgggcgtcc agaccaaatg 480

atcctggaga agtctctcga ttatggacga acatggcagc cctatcagta ttatgccaca 540

gactgcttag atgcttttca catggatcct aaatccgtga aggatttatc acagcatacg 600

gtcttagaaa tcatttgcac agaagagtac tcaacagggt atacaacaaa tagcaaaata 660

atccactttg aaatcaaaga caggttcgcg ttttttgctg gacctcgcct acgcaatatg 720

gcttccctct acggacagct ggatacaacc aagaaactca gagatttctt tacagtcaca 780

gacctgagga taaggctgtt aagaccagcc gttggggaaa tatttgtaga tgagctacac 840

ttggcacgct acttttacgc gatctcagac ataaaggtgc gaggaaggtg caagtgtaat 900

ctccatgcca ctgtatgtgt gtatgacaac agcaaattga catgcgaatg tgagcacaac 960

actacaggtc cagactgtgg gaaatgcaag aagaattatc agggccgacc ttggagtcca 1020

ggctcctatc tccccatccc caaaggcact gcaaatacct gtatccccag tatttccagt 1080

attggtaatt gtgaatgctt cggccactcc aatcgatgca gttatatcga tctgctaaat 1140

acagtcattt gcgtgagctg taaacacaac actagagggc agcactgtga gttatgcagg 1200

ctgggctact tcagaaatgc ttctgcacaa ctggacgatg agaatgtgtg catagagtgt 1260

tattgtaacc ctttgggctc aatccatgat cgttgtaatg gctcaggatt ttgtgagtgt 1320

aagactggaa caacagggcc taagtgtgat gagtgtctgc cgggaaattc ctggcactac 1380

ggctgtcaac cgaatgtctg cgacaacgag ctcctgcact gccagaacgg agggacgtgc 1440

cacaacaacg tgcgctgcct gtgcccggcc gcatacacgg gcatcctctg cgagaagctg 1500

cggtgcgagg aggctggcag ctgcggctcc gactctggcc agggcgcgcc cccgcacggc 1560

tccccagcgc tgctgctgct gaccacgctg ctgggaaccg ccagccccct ggtgttctag 1620

<210>4

<211>8802

<212>DNA

<213>artificial sequence

<400>4

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtaggtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcggtt 1800

aacttttaaa agaaaagggg ggattggggg gtacagtgca ggggaaagaa tagtagacat 1860

aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa attacaaaat tcaaaatttt 1920

atcgatacta gtattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 1980

tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 2040

gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 2100

gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 2160

tgacgcaaat gggcggtagg cgtgtacggt gggaggttta tataagcaga gctcgtttag 2220

tgaaccgtca gatcgcctgg agacgccatc cacgctgttt tgacctccat agaagattct 2280

agagctagcg aattcgccac catgtatttg tcaagattcc tgtcgattca tgccctttgg 2340

gttacggtgt cctcagtgat gcagccctac cctttggttt ggggacatta tgatttgtgt 2400

aagactcaga tttacacgga agaagggaaa gtttgggatt acatggcctg ccagccggaa 2460

tccacggaca tgacaaaata tctgaaagtg aaactcgatc ctccggatat tacctgtgga 2520

gaccctcctg agacgttctg tgcaatgggc aatccctaca tgtgcaataa tgagtgtgat 2580

gcgagtaccc ctgagctggc acacccccct gagctgatgt ttgattttga aggaagacat 2640

ccctccacat tttggcagtc tgccacttgg aaggagtatc ccaagcctct ccaggttaac 2700

atcactctgt cttggagcaa aaccattgag ctaacagaca acatagttat tacctttgaa 2760

tctgggcgtc cagaccaaat gatcctggag aagtctctcg attatggacg aacatggcag 2820

ccctatcagt attatgccac agactgctta gatgcttttc acatggatcc taaatccgtg 2880

aaggatttat cacagcatac ggtcttagaa atcatttgca cagaagagta ctcaacaggg 2940

tatacaacaa atagcaaaat aatccacttt gaaatcaaag acaggttcgc gttttttgct 3000

ggacctcgcc tacgcaatat ggcttccctc tacggacagc tggatacaac caagaaactc 3060

agagatttct ttacagtcac agacctgagg ataaggctgt taagaccagc cgttggggaa 3120

atatttgtag atgagctaca cttggcacgc tacttttacg cgatctcaga cataaaggtg 3180

cgaggaaggt gcaagtgtaa tctccatgcc actgtatgtg tgtatgacaa cagcaaattg 3240

acatgcgaat gtgagcacaa cactacaggt ccagactgtg ggaaatgcaa gaagaattat 3300

cagggccgac cttggagtcc aggctcctat ctccccatcc ccaaaggcac tgcaaatacc 3360

tgtatcccca gtatttccag tattggtaat tgtgaatgct tcggccactc caatcgatgc 3420

agttatatcg atctgctaaa tacagtcatt tgcgtgagct gtaaacacaa cactagaggg 3480

cagcactgtg agttatgcag gctgggctac ttcagaaatg cttctgcaca actggacgat 3540

gagaatgtgt gcatagagtg ttattgtaac cctttgggct caatccatga tcgttgtaat 3600

ggctcaggat tttgtgagtg taagactgga acaacagggc ctaagtgtga tgagtgtctg 3660

ccgggaaatt cctggcacta cggctgtcaa ccgaatgtct gcgacaacga gctcctgcac 3720

tgccagaacg gagggacgtg ccacaacaac gtgcgctgcc tgtgcccggc cgcatacacg 3780

ggcatcctct gcgagaagct gcggtgcgag gaggctggca gctgcggctc cgactctggc 3840

cagggcgcgc ccccgcacgg ctccccagcg ctgctgctgc tgaccacgct gctgggaacc 3900

gccagccccc tggtgttcta gggatccgcg gccgcgaagg atctgcgatc gctccggtgc 3960

ccgtcagtgg gtaggggagg cgcttttccc aaggcagtct ggagcatgcg ctttagcagc 4020

cccgctgggc acttggcgct acacaagtgg cctctggcct cgcacacatt ccacatccac 4080

cggtaggcgc caaccggctc cgttctttgg tggccccttc gcgccacctt ctactcctcc 4140

cctagtcagg aagttccccc ccgccccgca gctcgcgtcg tgcaggacgt gacaaatgga 4200

agtagcacgt ctcactagtc tcgtgcagat ggacagcacc gctgagcaat ggaagcgggt 4260

aggcctttgg ggcagcggcc aatagcagct ttgctccttc gctttctggg ctcagaggct 4320

gggaaggggt gggtccgggg gcgggctcag gggcgggctc aggggcgggg cgggcgcccg 4380

aaggtcctcc ggaggcccgg cattctgcac gcttcaaaag cgcacgtctg ccgcgctgtt 4440

ctcctcttcc tcatctccgg gcctttcgac ctgcagccca agcttaccca tatggccaag 4500

cctttgtctc aagaagaatc caccctcatt gaaagagcaa cggctacaat caacagcatc 4560

cccatctctg aagactacag cgtcgccagc gcagctctct ctagcgacgg ccgcatcttc 4620

actggtgtca atgtatatca ttttactggg ggaccttgtg cagaactcgt ggtgctgggc 4680

actgctgctg ctgcggcagc tggcaacctg acttgtatcg tcgcgatcgg aaatgagaac 4740

aggggcatct tgagcccctg cggacggtgc cgacaggtgc ttctcgatct gcatcctggg 4800

atcaaagcca tagtgaagga cagtgatgga cagccgacgg cagttgggat tcgtgaattg 4860

ctgccctctg gttatgtgtg ggagggctaa gtcgacaatc aacctctgga ttacaaaatt 4920

tgtgaaagat tgactggtat tcttaactat gttgctcctt ttacgctatg tggatacgct 4980

gctttaatgc ctttgtatca tgctattgct tcccgtatgg ctttcatttt ctcctccttg 5040

tataaatcct ggttgctgtc tctttatgag gagttgtggc ccgttgtcag gcaacgtggc 5100

gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc caccacctgt 5160

cagctccttt ccgggacttt cgctttcccc ctccctattg ccacggcgga actcatcgcc 5220

gcctgccttg cccgctgctg gacaggggct cggctgttgg gcactgacaa ttccgtggtg 5280

ttgtcgggga aatcatcgtc ctttccttgg ctgctcgcct gtgttgccac ctggattctg 5340

cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc cagcggacct tccttcccgc 5400

ggcctgctgc cggctctgcg gcctcttccg cgtcttcgcc ttcgccctca gacgagtcgg 5460

atctcccttt gggccgcctc cccgcctggt acctttaaga ccaatgactt acaaggcagc 5520

tgtagatctt agccactttt taaaagaaaa ggggggactg gaagggctaa ttcactccca 5580

acgaaaataa gatctgcttt ttgcttgtac tgggtctctc tggttagacc agatctgagc 5640

ctgggagctc tctggctaac tagggaaccc actgcttaag cctcaataaa gcttgccttg 5700

agtgcttcaa gtagtgtgtg cccgtctgtt gtgtgactct ggtaactaga gatccctcag 5760

acccttttag tcagtgtgga aaatctctag cagtagtagt tcatgtcatc ttattattca 5820

gtatttataacttgcaaaga aatgaatatc agagagtgag aggaacttgt ttattgcagc 5880

ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc 5940

actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg tctggctcta 6000

gctatcccgc ccctaactcc gcccagttcc gcccattctc cgccccatgg ctgactaatt 6060

ttttttattt atgcagaggc cgaggccgcc tcggcctctg agctattcca gaagtagtga 6120

ggaggctttt ttggaggcct agacttttgc agagacggcc caaattcgta atcatggtca 6180

tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga 6240

agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg 6300

cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 6360

caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 6420

tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 6480

cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 6540

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 6600

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 6660

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 6720

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 6780

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 6840

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 6900

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 6960

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 7020

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 7080

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 7140

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 7200

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 7260

ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 7320

taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 7380

ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 7440

ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 7500

gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 7560

ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 7620

gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 7680

tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 7740

atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 7800

gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 7860

tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 7920

atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc 7980

agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 8040

ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 8100

tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 8160

aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 8220

tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 8280

aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa 8340

accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtctc 8400

gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca 8460

gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt 8520

ggcgggtgtc ggggctggct taactatgcg gcatcagagc agattgtact gagagtgcac 8580

catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgccat 8640

tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc ttcgctatta 8700

cgccagctgg cgaaaggggg atgtgctgca aggcgattaa gttgggtaac gccagggttt 8760

tcccagtcac gacgttgtaa aacgacggcc agtgccaagc tg 8802

<210>5

<211>21

<212>DNA

<213>artificial sequence

<400>5

gcctaagtgt gatgagtgtc t21

<210>6

<211>8592

<212>DNA

<213>artificial sequence

<400>6

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcggtt 1800

aacttttaaa agaaaagggg ggattggggg gtacagtgca ggggaaagaa tagtagacat 1860

aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa attacaaaat tcaaaatttt 1920

attacaggga cagcagagat ccagtttatc gatctgggca ggaagagggc ctatttccca 1980

tgattccttc atatttgcat atacgataca aggctgttag agagataatt agaattaatt 2040

tgactgtaaa cacaaagata ttagtacaaa atacgtgacg tagaaagtaa taatttcttg 2100

ggtagtttgc agttttaaaa ttatgtttta aaatggacta tcatatgctt accgtaactt 2160

gaaagtattt cgatttcttg gctttatata tcttgtggaa aggacgagga tccggacaag 2220

cttcgaattc tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 2280

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 2340

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 2400

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 2460

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 2520

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 2580

tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 2640

actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 2700

aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 2760

gtaggcgtgt acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc 2820

gctagcgcta ccggtcgcca ccatggccca gtccaagcac ggcctgacca aggagatgac 2880

catgaagtac cgcatggagg gctgcgtgga cggccacaag ttcgtgatca ccggcgaggg 2940

catcggctac cccttcaagg gcaagcaggc catcaacctg tgcgtggtgg agggcggccc 3000

cttgcccttc gccgaggaca tcttgtccgc cgccttcatg tacggcaacc gcgtgttcac 3060

cgagtacccc caggacatcg tcgactactt caagaactcc tgccccgccg gctacacctg 3120

ggaccgctcc ttcctgttcg aggacggcgc cgtgtgcatc tgcaacgccg acatcaccgt 3180

gagcgtggag gagaactgca tgtaccacga gtccaagttc tacggcgtga acttccccgc 3240

cgacggcccc gtgatgaaga agatgaccga caactgggag ccctcctgcg agaagatcat 3300

ccccgtgccc aagcagggca tcttgaaggg cgacgtgagc atgtacctgc tgctgaagga 3360

cggtggccgc ttgcgctgcc agttcgacac cgtgtacaag gccaagtccg tgccccgcaa 3420

gatgcccgac tggcacttca tccagcacaa gctgacccgc gaggaccgca gcgacgccaa 3480

gaaccagaag tggcacctga ccgagcacgc catcgcctcc ggctccgcct tgccctaact 3540

cgagtaattc taccgggtag gggaggcgct tttcccaagg cagtctggag catgcgcttt 3600

agcagccccg ctgggcactt ggcgctacac aagtggcctc tggcctcgca cacattccac 3660

atccaccggt aggcgccaac cggctccgtt ctttggtggc cccttcgcgc caccttctac 3720

tcctccccta gtcaggaagt tcccccccgc cccgcagctc gcgtcgtgca ggacgtgaca 3780

aatggaagta gcacgtctca ctagtctcgt gcagatggac agcaccgctg agcaatggaa 3840

gcgggtaggc ctttggggca gcggccaata gcagctttgc tccttcgctt tctgggctca 3900

gaggctggga aggggtgggt ccgggggcgg gctcaggggc gggctcaggg gcggggcggg 3960

cgcccgaagg tcctccggag gcccggcatt ctgcacgctt caaaagcgca cgtctgccgc 4020

gctgttctcc tcttcctcat ctccgggcct ttcgcaagctgtgaccggcg cctacgctag 4080

atgaccgagt acaagcccac ggtgcgcctc gccacccgcg acgacgtccc cagggccgta 4140

cgcaccctcg ccgccgcgtt cgccgactac cccgccacgc gccacaccgt cgatccggac 4200

cgccacatcg agcgggtcac cgagctgcaa gaactcttcc tcacgcgcgt cgggctcgac 4260

atcggcaagg tgtgggtcgc ggacgacggc gccgcggtgg cggtctggac cacgccggag 4320

agcgtcgaag cgggggcggt gttcgccgag atcggcccgc gcatggccga gttgagcggt 4380

tcccggctgg ccgcgcagca acagatggaa ggcctcctgg cgccgcaccg gcccaaggag 4440

cccgcgtggt tcctggccac cgtcggcgtc tcgcccgacc accagggcaa gggtctgggc 4500

agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg ccggggtgcc cgccttcctg 4560

gagacctccg cgccccgcaa cctccccttc tacgagcggc tcggcttcac cgtcaccgcc 4620

gacgtcgagg tgcccgaagg accgcgcacc tggtgcatga cccgcaagcc cggtgcctga 4680

gtcgacaatc aacctctgga ttacaaaatt tgtgaaagat tgactggtat tcttaactat 4740

gttgctcctt ttacgctatg tggatacgct gctttaatgc ctttgtatca tgctattgct 4800

tcccgtatgg ctttcatttt ctcctccttg tataaatcct ggttgctgtc tctttatgag 4860

gagttgtggc ccgttgtcag gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc 4920

cccactggtt ggggcattgc caccacctgt cagctccttt ccgggacttt cgctttcccc 4980

ctccctattg ccacggcgga actcatcgcc gcctgccttg cccgctgctg gacaggggct 5040

cggctgttgg gcactgacaa ttccgtggtg ttgtcgggga aatcatcgtc ctttccttgg 5100

ctgctcgcct gtgttgccac ctggattctg cgcgggacgt ccttctgcta cgtcccttcg 5160

gccctcaatc cagcggacct tccttcccgc ggcctgctgc cggctctgcg gcctcttccg 5220

cgtcttcgcc ttcgccctca gacgagtcgg atctcccttt gggccgcctc cccgcctggt 5280

acctttaaga ccaatgactt acaaggcagc tgtagatctt agccactttt taaaagaaaa 5340

ggggggactg gaagggctaa ttcactccca acgaaaataa gatctgcttt ttgcttgtac 5400

tgggtctctc tggttagacc agatctgagc ctgggagctc tctggctaac tagggaaccc 5460

actgcttaag cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt 5520

gtgtgactct ggtaactaga gatccctcag acccttttag tcagtgtgga aaatctctag 5580

cagtagtagt tcatgtcatc ttattattca gtatttataa cttgcaaaga aatgaatatc 5640

agagagtgag aggaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat 5700

cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact 5760

catcaatgta tcttatcatg tctggctcta gctatcccgc ccctaactcc gcccagttcc 5820

gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc cgaggccgcc 5880

tcggcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct agacttttgc 5940

agagacggcc caaattcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg 6000

ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa 6060

tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac 6120

ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt 6180

gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga 6240

gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca 6300

ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg 6360

ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt 6420

cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc 6480

ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct 6540

tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc 6600

gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta 6660

tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca 6720

gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag 6780

tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag 6840

ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt 6900

agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 6960

gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg 7020

attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga 7080

agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta 7140

atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc 7200

cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg 7260

ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga 7320

agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt 7380

tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt 7440

gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc 7500

caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc 7560

ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca 7620

gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag 7680

tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg 7740

tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa 7800

cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa 7860

cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga 7920

gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga 7980

atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg 8040

agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt 8100

ccccgaaaag tgccacctga cgtctaagaa accattatta tcatgacatt aacctataaa 8160

aataggcgta tcacgaggcc ctttcgtctc gcgcgtttcg gtgatgacgg tgaaaacctc 8220

tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc cgggagcaga 8280

caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc ggggctggct taactatgcg 8340

gcatcagagc agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc 8400

gtaaggagaa aataccgcat caggcgccat tcgccattca ggctgcgcaa ctgttgggaa 8460

gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg cgaaaggggg atgtgctgca 8520

aggcgattaa gttgggtaac gccagggttt tcccagtcac gacgttgtaa aacgacggcc 8580

agtgccaagc tg 8592

<210>7

<211>8638

<212>DNA

<213>artificial sequence

<400>7

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcggtt 1800

aacttttaaa agaaaagggg ggattggggg gtacagtgca ggggaaagaa tagtagacat 1860

aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa attacaaaat tcaaaatttt 1920

attacaggga cagcagagat ccagtttatc gatctgggca ggaagagggc ctatttccca 1980

tgattccttc atatttgcat atacgataca aggctgttag agagataatt agaattaatt 2040

tgactgtaaa cacaaagata ttagtacaaa atacgtgacg tagaaagtaa taatttcttg 2100

ggtagtttgc agttttaaaa ttatgtttta aaatggacta tcatatgctt accgtaactt 2160

gaaagtattt cgatttcttg gctttatata tcttgtggaa aggacgagga tccgcctaag 2220

tgtgatgagt gtctttcaag agaagacact catcacactt aggctttttt gaattctagt 2280

tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga gttccgcgtt 2340

acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg 2400

tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg 2460

gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt 2520

acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg 2580

accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg 2640

gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 2700

ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa tcaacgggac 2760

tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg 2820

tgggaggtct atataagcag agctggttta gtgaaccgtc agatccgcta gcgctaccgg 2880

tcgccaccat ggcccagtcc aagcacggcc tgaccaagga gatgaccatg aagtaccgca 2940

tggagggctg cgtggacggc cacaagttcg tgatcaccgg cgagggcatc ggctacccct 3000

tcaagggcaa gcaggccatc aacctgtgcg tggtggaggg cggccccttg cccttcgccg 3060

aggacatctt gtccgccgcc ttcatgtacg gcaaccgcgt gttcaccgag tacccccagg 3120

acatcgtcga ctacttcaag aactcctgcc ccgccggcta cacctgggac cgctccttcc 3180

tgttcgagga cggcgccgtg tgcatctgca acgccgacat caccgtgagc gtggaggaga 3240

actgcatgta ccacgagtcc aagttctacg gcgtgaactt ccccgccgac ggccccgtga 3300

tgaagaagat gaccgacaac tgggagccct cctgcgagaa gatcatcccc gtgcccaagc 3360

agggcatctt gaagggcgac gtgagcatgt acctgctgct gaaggacggt ggccgcttgc 3420

gctgccagtt cgacaccgtg tacaaggcca agtccgtgcc ccgcaagatg cccgactggc 3480

acttcatcca gcacaagctg acccgcgagg accgcagcga cgccaagaac cagaagtggc 3540

acctgaccga gcacgccatc gcctccggct ccgccttgcc ctaactcgag taattctacc 3600

gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg 3660

gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc accggtaggc 3720

gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct cccctagtca 3780

ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac 3840

gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg gtaggccttt 3900

ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg ctgggaaggg 3960

gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct 4020

ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt 4080

cctcatctcc gggcctttcg caagctgtga ccggcgccta cgctagatga ccgagtacaa 4140

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 4200

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 4260

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 4320

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 4380

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 4440

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 4500

ggccaccgtc ggcgtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 4560

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 4620

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 4680

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgagtcg acaatcaacc 4740

tctggattac aaaatttgtg aaagattgac tggtattctt aactatgttg ctccttttac 4800

gctatgtgga tacgctgctt taatgccttt gtatcatgct attgcttccc gtatggcttt 4860

cattttctcc tccttgtata aatcctggtt gctgtctctt tatgaggagt tgtggcccgt 4920

tgtcaggcaa cgtggcgtgg tgtgcactgt gtttgctgac gcaaccccca ctggttgggg 4980

cattgccacc acctgtcagc tcctttccgg gactttcgct ttccccctcc ctattgccac 5040

ggcggaactc atcgccgcct gccttgcccg ctgctggaca ggggctcggc tgttgggcac 5100

tgacaattcc gtggtgttgt cggggaaatc atcgtccttt ccttggctgc tcgcctgtgt 5160

tgccacctgg attctgcgcg ggacgtcctt ctgctacgtc ccttcggccc tcaatccagc 5220

ggaccttcct tcccgcggcc tgctgccggc tctgcggcct cttccgcgtc ttcgccttcg 5280

ccctcagacg agtcggatct ccctttgggc cgcctccccg cctggtacct ttaagaccaa 5340

tgacttacaa ggcagctgta gatcttagcc actttttaaa agaaaagggg ggactggaag 5400

ggctaattca ctcccaacga aaataagatc tgctttttgc ttgtactggg tctctctggt 5460

tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg cttaagcctc 5520

aataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt gactctggta 5580

actagagatc cctcagaccc ttttagtcag tgtggaaaat ctctagcagt agtagttcat 5640

gtcatcttat tattcagtat ttataacttg caaagaaatg aatatcagag agtgagagga 5700

acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa 5760

ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt 5820

atcatgtctg gctctagcta tcccgcccct aactccgccc agttccgccc attctccgcc 5880

ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct 5940

attccagaag tagtgaggag gcttttttgg aggcctagac ttttgcagag acggcccaaa 6000

ttcgtaatca tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca 6060

caacatacga gccggaagca taaagtgtaa agcctggggt gcctaatgag tgagctaact 6120

cacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct 6180

gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc 6240

ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 6300

ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 6360

agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 6420

taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 6480

cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 6540

tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 6600

gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 6660

gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 6720

tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 6780

gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 6840

cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 6900

aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 6960

tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 7020

ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag 7080

attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat 7140

ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc 7200

tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 7260

aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 7320

acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag 7380

aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag 7440

agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt 7500

ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg 7560

agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt 7620

tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc 7680

tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc 7740

attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa 7800

taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg 7860

aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc 7920

caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag7980

gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt 8040

cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt 8100

tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc 8160

acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac 8220

gaggcccttt cgtctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct 8280

cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg 8340

cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac tatgcggcat cagagcagat 8400

tgtactgaga gtgcaccata tgcggtgtga aataccgcac agatgcgtaa ggagaaaata 8460

ccgcatcagg cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 8520

ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 8580

ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg ccaagctg 8638

Claims (8)

1. A molecular marker of hepatocellular carcinoma, which is an expression product of NTNG1 gene or NTNG1 gene.

2. A cell line stably overexpressing NTNG1 gene, wherein the cell line is targeted by liver cancer cells through a sequence such as SEDID NO: 4, infecting with the NTNG1 overexpression lentivirus to obtain the liver cancer cell stably overexpressing the NTNG1 gene.

3. A construction method of a cell strain for stably over-expressing NTNG1 gene is characterized by comprising the following steps:

(a) the sequences were cut with restriction enzymes EcoR I and BamH I, respectively, as SED ID NO: 1, electrophoresing to obtain a sequence such as SED ID NO: 2, a linearized support;

(b) extracting total RNA from fresh tissue specimen, reverse transcribing to cDNA, PCR amplifying to obtain the sequence such as SED IDNO: 3, a fragment of the NTNG1 gene;

(c) connecting the linearized vector with an NTNG1 gene fragment by using DNA ligase to obtain an NTNG1 overexpression lentiviral vector;

(d) sequences such as SED ID NO: NTNG1 shown in fig. 4 overexpresses lentiviruses; the NTNG1 overexpression lentivirus infects liver cancer cell strain, and the antibiotic is used for drug screening to obtain the cell strain which stably overexpresses the NTNG1 gene.

4. The method of claim 3, wherein the lentiviral vector is Plvx-CMV-MCS-T2A-blisticin; the antibiotic is blasticidin.

5. A cell line for stably knocking down NTNG1 gene is characterized in that the cell line takes liver cancer cells as a target system and is expressed by a sequence such as SED ID NO: 7, the NTNG1 interferes with the lentivirus infection to obtain the liver cancer cell with the stably knocked-down NTNG1 gene.

6. A construction method for stably knocking down an NTNG1 gene cell strain is characterized by comprising the following steps:

(1) nucleotide sequences as described by SED ID NO: shRNA templates shown in 5 were ligated to sequences such as SED ID NO: 6 to obtain NTNG1 interference lentivirus vector;

(2) sequences prepared using NTNG1 to interfere with lentiviral vector packaging such as SED ID NO: NTNG1 shown in fig. 7 interferes with lentiviruses; the NTNG1 interferes the slow virus to infect the liver cancer cell strain, the transfected cells are cultured and screened by antibiotics, and the cell strain with the NTNG1 gene stably knocked down is obtained.

7. The method of claim 6, wherein the lentiviral vector is Plvx-hU6-MCS-ZsGreen 1-Puro; the antibiotic is puromycin.

8. Use of at least one of the cell line stably overexpressing NTNG1 gene according to claim 2 or the cell line stably knocking down NTNG1 gene according to claim 5 in the content evaluation of NTNG1 gene inside and outside the cell of organism.

Images