CN113073082A

CN113073082A - TGF-beta 3 mesenchymal stem cell exosome and preparation method and application thereof

Info

Publication number: CN113073082A
Application number: CN202110373926.5A
Authority: CN
Inventors: 陈玉容; 周晗; 邵静; 邹衡芳; 廖勇
Original assignee: Guangzhou Yuanxiang Biotechnology Co ltd
Current assignee: Guangzhou Yuanxiang Biotechnology Co ltd
Priority date: 2021-03-19
Filing date: 2021-04-07
Publication date: 2021-07-06

Abstract

The invention relates to a TGF-beta 3 mesenchymal stem cell exosome and a preparation method and application thereof, wherein the TGF-beta 3 mesenchymal stem cell exosome is an exosome secreted by mesenchymal stem cells and can express TGF-beta 3 fusion protein on a mesenchymal stem cell membrane; the TGF-beta 3 fusion protein is sequentially an N-terminal signal peptide, a target TGF-beta 3 protein, a connecting peptide and a mesenchymal stem cell transmembrane region from the N terminal. The mesenchymal stem cell exosome capable of highly expressing TGF-beta 3 on the surface of the membrane, which is obtained by the invention, can play a role in promoting the proliferation and migration of epidermal cells; the TGF-beta 3 mesenchymal stem cell exosome can keep the regeneration promoting capability of mesenchymal stem cells, enhances the stability of TGF-beta 3, improves the specific targeting of the exosome reaching damaged cells of the skin, can inhibit the activation and proliferation of immune cells, shortens the wound healing time, reduces the scar formation and has good treatment effect on tissue injury.

Description

TGF-beta 3 mesenchymal stem cell exosome and preparation method and application thereof

Technical Field

The invention relates to the technical field of biological medicines, in particular to a TGF-beta 3 mesenchymal stem cell exosome and a preparation method and application thereof.

Background

Scars and fibrosis, which are the end result of surgical and non-surgical skin injuries, not only cause poor skin appearance but also impair skin function and sometimes cause undesirable psychological effects and pain, are associated with a number of factors, such as depth, size, location of injury, personal physical differences, age, etc. For example, burn wounds, trauma and certain surgical procedures leave severe scars on the skin from wound healing disorders. It has been found that animal embryonic wounds exhibit high levels of TGF-. beta.3 and low levels of TGF-. beta.1 and TGF-. beta.2 expression (Dev biol. 1991Sep; 147(1):207-15.doi:10.1016/s0012-1606(05) 80018-1). TGF-. beta.3 has also been shown in clinical trials to improve scarring of the skin (Lancet.2009Apr 11; 373(9671):1264-74.doi:10.1016/S0140-6736(09) 60322-6). TGF-beta 3 is one of members of transforming growth factor-beta (TGF-beta) superfamily, plays a key regulatory role in the process of tissue repair, promotes the proliferation and migration of wound edge epithelial cells and fibroblasts, inhibits the proliferation of immunocytes and the release of inflammatory factors, is related to the fibrotic healing of wounds, can accelerate the wound closure, avoids the delayed healing of inflammation, and has huge potential in the aspect of improving the scar formation. However, due to the low in vivo stability of growth factors, absorption by the skin around the wound is limited, elimination of exudation prior to reaching the wound area and other adverse side effects affect TGF- β 3 potency.

Mesenchymal stem cells have strong differentiation capacity and can replace damaged cells, and a plurality of articles report that the mesenchymal stem cells have good capacity of promoting tissue repair and regeneration, but the articles also indicate that the mesenchymal stem cells can cause excessive immune reaction and other side effects due to the characteristics of strong immunoregulatory capacity and the like. There is therefore a need to find alternative cell-free therapies that reduce the risk of cell therapy. The role of mesenchymal stem cells in tissue repair is mainly by paracrine factors, in which exosomes play an important role as paracrine mediators. Exosomes are bilayer lipid nanovesicles secreted by almost all cell types, communicating between cells by delivering lipids, proteins and nucleic acids to neighboring cells, with cell, tissue specificity and potent immunomodulation, and with low immunogenic and malignant potential. The exosome derived from the mesenchymal stem cell has partial characteristics of the mesenchymal stem cell, including immunosuppression, reduction of apoptosis, inhibition of inflammation and promotion of regeneration. The use of mesenchymal stem cell-derived exosomes for treating tissue damage is therefore considered to be a viable alternative to cell therapy. The cell therapy still has the defects of low transplantation survival rate, low specific differentiation rate, immunological rejection, thrombus and canceration risks at present, and the exosome serving as a vesicle with a lipid bilayer membrane structure can be frozen at the temperature of-80 ℃, is convenient to store and apply, and has strong stability, so that the exosome has a good application prospect in the aspect of disease treatment.

The exosome secreted by the mesenchymal stem cell can carry a plurality of contents, including TGF-beta 3, and after the exosome is delivered to the receptor cell, the exosome can release the contents carried by the mesenchymal stem cell to the receptor cell, so that the cell communication function is realized, the physiological function of the receptor cell is regulated, and the proliferation and migration of the cell are influenced. However, TGF-beta 3 is mainly expressed in the membranes of mesenchymal stem cells and exosomes secreted by the mesenchymal stem cells, and the content of the TGF-beta 3 is low, so that the TGF-beta 3 has the defect of poor targeting and cannot well play the regulation effect of the TGF-beta 3 in receptor cells. The method commonly used at present for increasing the expression level of the cytokine in the cell mainly comprises the step of incubating the cytokine with the cell, but actually, the method cannot obviously increase the expression level of the cytokine in an exosome secreted by the cell.

Through various researches, the structure of an N-terminal signal peptide and a transmembrane region of a TGF-beta 3 fusion protein is designed through the corresponding structure of a mesenchymal stem cell surface marker CD44, the TGF-beta 3 fusion protein is recombined into a TGF-beta 3 plasmid and applied to infected mesenchymal stem cells, TGF-beta 3 is successfully anchored on the cell membrane of the mesenchymal stem cells, and secreted exosomes of the TGF-beta 3 are also anchored on the membrane and highly express the TGF-beta 3. In vitro and in vivo experiments, the exosome from the high expression TGF-beta 3 mesenchymal stem cell is verified to be capable of promoting the proliferation and migration of epidermal cells, inhibiting the proliferation of immune cells, promoting the healing of skin wounds of mice and reducing the formation of scars.

Disclosure of Invention

One of the purposes of the invention is to provide a TGF-beta 3 mesenchymal stem cell exosome which not only can stably and highly express TGF-beta 3 protein, but also can be better applied to treating skin injury and chronic ulcer and inhibiting skin scar formation.

The above object of the present invention is achieved by the following technical solutions:

a TGF-beta 3 mesenchymal stem cell exosome, which is an exosome secreted by mesenchymal stem cells and capable of expressing TGF-beta 3 fusion protein on the mesenchymal stem cell membrane.

In some of these embodiments, the TGF- β 3 fusion protein is, in order from the N-terminus, an N-terminal signal peptide, a TGF- β 3 protein of interest, a connecting peptide, and a mesenchymal stem cell transmembrane region.

In some of these embodiments, the N-terminal signal peptide is the signal peptide of the mesenchymal stem cell surface marker CD 44.

In some embodiments, the nucleotide sequence of the signal peptide is shown as SEQ ID No.1, or is shown as SEQ ID No.1, and one or more nucleotides are substituted, deleted and/or added, and the nucleotide sequence can encode the same functional protein.

In some embodiments, the nucleotide sequence of the TGF-beta 3 protein of interest is shown in SEQ ID NO.2, or in SEQ ID NO.2 with one or more nucleotides substituted, deleted and/or added, and can encode the same functional protein.

In some embodiments, the nucleotide sequence of the transmembrane region is shown as SEQ ID NO.4, or SEQ ID NO.4 with one or more nucleotides substituted, deleted and/or added, and can encode the same functional protein.

The linker peptide may be a linker sequence conventionally used to link polypeptides, which is capable of linking two polypeptides and folding them naturally into the desired structure, typically it is a short peptide with a length of hydrophobicity and some extensibility. The linker peptide may be flexible, in some embodiments a flexible linker peptide is advantageous that is capable of linking two proteins and retaining their respective activities and functions. The sequence shown in SEQ ID NO.3 is preferred in the invention.

Another purpose of the invention is to provide a preparation method of the TGF-beta 3 mesenchymal stem cell exosome.

The preparation method of the TGF-beta 3 mesenchymal stem cell exosome comprises the following steps:

constructing a lentivirus expression vector containing a TGF-beta 3 fusion protein gene;

infecting mesenchymal stem cells with the lentiviral expression vector;

the mesenchymal stem cells secrete TGF-beta 3 mesenchymal stem cell exosomes.

The inventor successfully obtains the TGF-beta 3 mesenchymal stem cell exosome by constructing a mode of expressing TGF-beta 3 on a mesenchymal stem cell exosome membrane, and the TGF-beta 3 mesenchymal stem cell exosome has the performance of stably expressing a large amount of growth factor TGF-beta 3 carried while keeping the wound healing promoting capacity of the exosome, so that the effects of inhibiting over-proliferated immune cells, obviously inhibiting the formation of scars and promoting the repair of skin wounds can be achieved. In-vitro experiments and animal experiments prove that the TGF-beta 3 mesenchymal stem cell exosome can promote proliferation and migration of epidermal cells, inhibit activation and proliferation of immune cells, shorten wound healing time, reduce scar formation and have a good treatment effect on tissue injury.

Another object of the present invention is to provide the use of the TGF-beta 3 mesenchymal stem cell exosome.

The technical scheme for achieving the purpose is as follows.

An application of TGF-beta 3 mesenchymal stem cell exosome in preparing a medicament or a product for promoting tissue damage and regeneration.

Use of a TGF-beta 3 mesenchymal stem cell exosome in the manufacture of a medicament or product for the treatment of tissue damage due to chronic inflammation.

Application of TGF-beta 3 mesenchymal stem cell exosomes in preparation of medicines or products for reducing scar formation.

The TGF-beta 3 mesenchymal stem cell exosome is applied to the preparation of immunosuppressive drugs.

The TGF-beta 3 mesenchymal stem cell exosome is applied to the preparation of a medicine or a product for promoting the migration of epidermal cells.

The TGF-beta 3 mesenchymal stem cell exosome is applied to the preparation of medicines or products for promoting the repair of skin wounds.

In some of these embodiments, it promotes skin wound repair by promoting growth factor release.

In some of these embodiments, it is by inhibiting an immune inflammatory response to promote skin wound repair.

Another object of the invention is a medicament or product for treating tissue trauma or promoting wound repair or reducing scarring.

A medicine or product for treating tissue trauma or promoting wound repair or reducing scar contains TGF-beta 3 mesenchymal stem cell exosome as active component and pharmaceutically acceptable auxiliary materials.

In some embodiments, the medicament or product is in the form of injection or transdermal preparation. The preparation can be injected or applied to wound to accelerate wound healing and reduce scar formation.

Preferably, the tissue is skin tissue.

In some of these embodiments, the product may be a medical, cosmetic, or cosmetology product. In some embodiments, the product is in the form of a liquid or cream or a gel or the like, as long as it is capable of being applied to the skin or subcutaneous tissue.

Compared with the prior art, the invention has the following advantages:

the inventor designs the structure of an N-terminal signal peptide and a transmembrane region of TGF-beta 3 fusion protein by adopting the corresponding structure of a mesenchymal stem cell surface marker CD44, recombines the structure into a TGF-beta 3 plasmid, infects umbilical cord mesenchymal stem cells, screens and obtains the mesenchymal stem cells which highly express TGF-beta 3 and anchor the TGF-beta 3 on a cell membrane, and successfully obtains exosomes of the highly expressed TGF-beta 3 on the membrane surface. In vitro experiments and animal experiments prove that the TGF-beta 3 mesenchymal stem cell exosome can play a role in promoting the proliferation and migration of epidermal cells, can promote tissue regeneration and reduce the formation of scars. In the invention, the TGF-beta 3 mesenchymal stem cell exosome can keep the regeneration promoting capability of mesenchymal stem cells, enhances the stability of TGF-beta 3, improves the specific targeting of the exosome to damaged cells of skin, further enhances the repairing effect of TGF-beta 3 to tissues, achieves the superposition effect on wound repair, has the performance of inhibiting the activation and proliferation of immune cells, and has larger application potential.

Drawings

FIG. 1 shows the structure of the constructed TGF-. beta.3 lentiviral plasmid.

FIG. 2 is a graph demonstrating the TGF-beta 3 expression of mesenchymal stem cells after different methods of treatment: FIG. 2A is a graph showing the results of using qPCR to verify whether mesenchymal stem cells (TGF-. beta.3 MSC) infected with a lentivirus incorporating a TGF-. beta.3 sequence highly express TGF-. beta.3 at the mRNA level as compared to mesenchymal stem cells (MSC + TGF-. beta.3) incubated with normal Mesenchymal Stem Cells (MSC) and a TGF-. beta.3 growth factor; FIG. 2B is a diagram of the collection of the culture medium supernatant of the mesenchymal stem cells, which is verified by ELISA method to find that the amount of TGF-beta 3 secreted by the mesenchymal stem cells (TGF-beta 3 MSC) infected with the integrated TGF-beta 3 sequence lentivirus is more than that of the mesenchymal stem cells (MSC + TGF-beta 3) incubated with the normal Mesenchymal Stem Cells (MSC) and the TGF-beta 3 growth factor; FIG. 2C is a graph showing that whether the expression level of TGF-. beta.3 can be increased by mesenchymal stem cells (TGF-. beta.3 MSC) infected with lentivirus integrating TGF-. beta.3 sequence was verified at the protein level by Western blotting. Fig. 3 is a representation of exosomes secreted by mesenchymal stem cells after different methods of treatment: FIG. 3A is a diagram of a Transmission Electron Microscope (TEM) method for verifying the morphology of exosomes and observing whether the morphology of exosomes is consistent with the morphological characteristics of exosomes, wherein the ruler is 100 nm; FIGS. 3B and 3C are Dynamic Light Scattering (DLS) and Zeta potential to verify the particle size distribution and potential of exosomes extracted from mesenchymal stem cells, and confirm that the particle size distribution range and Zeta potential range of exosomes (TGF-beta 3 MSC-Exo) secreted by mesenchymal stem cells after integrating TGF-beta 3 sequence lentivirus infection accord with the characteristics of exosomes; FIG. 3D shows that after exosomes of mesenchymal stem cells are extracted, total proteins are extracted after the cells are lysed, and compared with exosomes (TGF-beta 3) secreted by normal mesenchymal stem cells and exosomes (MSC + TGF-beta 3-Exo) secreted by mesenchymal stem cells after incubation of TGF-beta 3 growth factors, exosomes (TGF-beta 3 MSC-Exo) secreted by mesenchymal stem cells infected by lentiviruses with integrated TGF-beta 3 sequences can highly express TGF-beta 3 at the protein level, and all three exosomes can express an exosome-specific protein ALIX.

FIG. 4 shows the in vitro biological functions of TGF-beta 3 exosomes secreted by high expression TGF-beta 3 mesenchymal stem cells: FIG. 4A is a schematic diagram showing that human immortalized epidermal cell HaCaT cells are scratched after being laid on a 24-well plate to observe whether high-expression TGF-beta 3 exosomes can promote cell migration; FIG. 4B shows HaCaT cell 24h scratch mobility; FIG. 4C is a CCK-8 experiment used to see if TGF-. beta.3 exosomes are able to promote HaCaT cell proliferation; FIG. 4D is a PBMC proliferation assay to see if TGF-. beta.3 exosomes are able to inhibit immune cell proliferation.

Fig. 5 is a graph for establishing a mouse skin wound model, which is divided into a blank control group (Ctrl), a normal exosome group (MSC-Exo) derived from mesenchymal stem cells, and an exosome group (TGF- β 3 MSC-Exo) secreted by mesenchymal stem cells infected with TGF- β 3 lentivirus, different groups of drugs are administered by a tail vein injection method, and the effect of TGF- β 3 exosomes on promoting wound healing is observed: FIG. 5A is a graph of the area of a mouse wound, which visually demonstrates the shrinkage and healing of the mouse wound after molding and administration, comparing the effects of each group of drugs on chronic wounds; FIG. 5B is a graph of the change rate of the wound area calculated by Image J software after the wound area is detected according to the wound area of each group; FIG. 5C is a graph of HE and IHC used to demonstrate healing of mouse skin at the tissue level after drug treatment in groups of skin-injured mice; figure 5D is a graph demonstrating the expression of various inflammatory factors in the skin of mice using qPCR; fig. 5E shows the expression of inflammatory factors in blood of each group of mice, which was verified by ELISA.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The present invention will be described in further detail with reference to specific examples.

Cell culture: HEK 293T cells, umbilical cord-derived mesenchymal stem cells, human immortalized epidermal cells HaCaT were cultured in DMEM complete medium (containing 10% fetal bovine serum and 1% P/S diabody), human peripheral blood mononuclear cells PBMC were cultured in RPMI-1640 complete medium (containing 10% fetal bovine serum and 1% P/S diabody), and the cells were incubated at 37 ℃ and 5% CO₂The cell culture chamber of (2) for culturing.

EXAMPLE 1 construction of Lentiviral vectors

1. Designing a gene sequence of a fusion protein TGF-beta 3, wherein the fusion protein comprises an N-terminal signal peptide, a target gene TGF-beta 3, a connecting region and a transmembrane region according to specific requirements. The structure of the N-terminal signal peptide and the transmembrane region adopts the corresponding structure of a mesenchymal stem cell surface marker CD44, the connecting region is a flexible chain of 8 amino acids, and the sequences of all parts are as follows:

n-terminal signal peptide:

ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCG(SEQ ID NO.1)

the TGF-beta 3 gene of interest:

ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTCAGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTGGAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACGGTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTGGAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATACTATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTGGCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAGAAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGCTCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATTGCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTGTCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGTCTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAAAACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGCCGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTCATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGGGCTTTGGACACCAATTACTGCTTCCGCAACTTGGAGGAGAACTGCTGTGTGCGCCCCCTCTACATTGACTTCCGACAGGATCTGGGCTGGAAGTGGGTCCATGAACCTAAGGGCTACTATGCCAACTTCTGCTCAGGCCCTTGCCCATACCTCCGCAGTGCAGACACAACCCACAGCACGGTGCTGGGACTGTACAACACTCTGAACCCTGAAGCATCTGCCTCGCCTTGCTGCGTGCCCCAGGACCTGGAGCCCCTGACCATCCTGTACTATGTTGGGAGGACCCCCAAAGTGGAGCAGCTCTCCAACATGGTGGTGAAGTCTTGTAAATGTAGCTGA(SEQ ID NO.2)

a connecting region:

TCCGCTTGTTACTGTGAGCTTTCC(SEQ ID NO.3)

a transmembrane region:

TGGCTGATCATCTTGGCATCCCTCTTGGCCTTGGCTTTGATTCTTGCAGTTTGCATTGCAGTC(SEQ ID NO.4)

2. obtaining a gene sequence of the fusion protein, extracting mRNA from a cell line MM.1S expressing TGF-beta 3, carrying out reverse transcription to obtain cDNA, amplifying the obtained cDNA according to a designed PCR primer of the TGF-beta 3 to obtain the cDNA of the TGF-beta 3, and synthesizing a signal peptide, a flexible connecting chain and a transmembrane region at two ends of the cDNA of the TGF-beta 3 by a company after purifying the cDNA by gel electrophoresis.

The PCR primer sequences for TGF-beta 3 are as follows:

a forward primer F: 5' -ggatcttccagagatATGAAGATGCACTTGCAAAGGG (SEQ ID NO.5)

Reverse primer R: 5' -ctgccgttcgacgatTCAGCTACATTTACAAGACTTCACCA (SEQ ID NO. 6).

3. Constructing a lentiviral vector containing the TGF-beta 3 fusion protein, taking pcDNA3.1 as a vector, selecting NheI and NotI on the vector as double enzyme cutting sites, cloning a gene fragment of the fusion protein on the vector by using a restriction endonuclease kit according to a designed primer, and purifying by gel electrophoresis to obtain the final lentiviral vector.

The primer sequences designed according to the gene sequence and the enzyme cutting site sequence of the cloned protein are as follows:

a forward primer F: 5' -tgaaccgtcagatccgctagcCGATGGACAAGTTTTGGTGGC (SEQ ID NO.7)

Reverse primer R: 5' -aactctagaggatccgcggccgcGACTGCAATGCAAACTGCAAGA (SEQ ID NO. 8).

Example 2 characterization of mesenchymal Stem cells after infection with TGF-beta 3 Virus

1. Infecting cells with lentivirus, adding 10ug of the desired plasmid into 950 μ L of 1 XHBS, gently mixing, and slowly adding 50 μ L CaCl dropwise₂Gently mixing, standing for 20min, adding into HEK 293T cell with density of 70%, gently mixing, placing at 37 deg.C and 5% CO₂After 12 hours, the cell culture box is changed to 10mL of 30% FBS complete culture medium for culture, and after 48 hours, cell supernatant is taken and centrifuged for 15min at the normal temperature of 4000 rpm. Adding the supernatant into mesenchymal stem cells with cell density of 50%, adding polybrene with final concentration of 8ug/ml, mixing, adding 5% CO at 37 deg.C₂The cell culture chamber of (1) was changed to 10% FBS complete medium after 12 hours.

2. And (3) successfully screening the mesenchymal stem cells with high expression of TGF-beta 3, adding puromycin with the final concentration of 2ug/ml into the infected mesenchymal stem cells for screening for 2-3 days, culturing and amplifying the screened cells, and further verifying whether the infection is successful.

3. TGF-beta 3 expression in mesenchymal stem cells is detected at the mRNA level. And (3) paving normal Mesenchymal Stem Cells (MSC) and the mesenchymal stem cells (TGF-beta 3 MSC) infected by the lentivirus integrating the TGF-beta 3 sequence in a 10cm culture dish, and culturing until the fusion degree reaches 80-90%. For mesenchymal stem cells that need to be co-incubated with TGF-. beta.3 growth factor, TGF-. beta.3 growth factor (5 ng/. mu.L) needs to be added to the complete medium added at the time of plating. After the cells were lysed by Trizol, RNA was extracted from the cells. After extracting RNA, the RNA was reverse transcribed using PrimeScript RT-PCR Kit (TaKaRa) to obtain cDNA, and the expression level of PD-L1 in each group of cells was determined by a fluorescence quantification method. Wherein, the fluorescent quantitative PCR detection takes beta-actin as an internal reference:

the PCR primer sequence for detecting the reference gene beta-actin by fluorescent quantitative PCR is as follows:

forward primer 5' -AGAAAATCTGGCACCACACC (SEQ ID NO.9)

Reverse primer 5' -AGAGGCGTACAGGGATAGCA (SEQ ID NO.10)

The PCR primer sequence for detecting TGF-beta 3 by fluorescent quantitative PCR is as follows:

forward primer 5' -ACTTGCACCACCTTGGACTTC (SEQ ID NO.11)

Reverse primer 5' -GGTCATCACCGTTGGCTCA (SEQ ID NO. 12).

As shown in fig. 2A, although the expression level of TGF- β 3 in the mesenchymal stem cells (MSC + TGF- β 3) incubated with the TGF- β 3 growth factor was significantly different from that of the normal Mesenchymal Stem Cells (MSC), and the expression level of TGF- β 3 was increased at the mRNA level, the expression level of TGF- β 3 in the mesenchymal stem cells (TGF- β 3 mesenchymal stem cell secretor, hereinafter abbreviated as TGF- β 3 MSC) infected with lentivirus having integrated TGF- β 3 sequence was significantly different from that of MSC + TGF- β 3, and the expression level of TGF- β 3 was increased to a greater extent at the mRNA level. This indicates that TGF- β 3MSC can significantly up-regulate the expression level of TGF- β 3 at the mRNA level compared to MSC and MSC + TGF- β 3, and that the method of infection with TGF- β 3 lentivirus can indeed increase the expression level of TGF- β 3 in mesenchymal stem cells.

4. The concentration of TGF-beta 3 in the culture supernatant of the mesenchymal stem cells is detected by using an ELISA method. MSC, MSC + TGF-beta 3 and TGF-beta 3MSC are firstly cultured to the same cell density, and then 500 mu L of culture medium supernatant of the three cells are extracted for centrifugation at 6000rpm for 5 min. The precipitate was discarded. A relative number of the plates coated with TGF-. beta.3 antibody were removed from the 4 ℃ freezer, 100. mu.L of centrifuged culture supernatant and standards were added to the plates, three wells per group, and the plates were sealed with sealing plates at 37 ℃ for 90 min. After incubation, Washing the plate for 5 times by using prepared Washing buffer working solution, wherein the plate is required to be clean. streptavidin-HRP working solution, 100. mu.L/well, was added to each well, and incubated with a cover plate membrane at 37 ℃ for 30 min. After incubation, the plate was washed 5 times, and the wells were thoroughly drained of liquid. TMB, 100. mu.L/well, 37 ℃ for 15min was added to each well. Finally, stop solution was added to each well to stop the reaction, 100. mu.L/well. Reading each group by using the detection wavelength of 450nm in a microplate reader, obtaining the OD value, drawing a standard curve, and calculating the corresponding concentration.

The results are shown in FIG. 2B, which illustrates that MSC + TGF-beta 3 is able to express and secrete more TGF-beta 3 than MSC, whereas TGF-beta 3MSC secretes more TGF-beta 3 than MSC + TGF-beta 3, with a greater difference in significance. This suggests that mesenchymal stem cells infected with TGF-. beta.3 lentivirus are able to secrete more TGF-. beta.3.

5. The expression level of TGF-beta 3 in the mesenchymal stem cells was detected by using the Western Blot method to confirm that the infected mesenchymal stem cells can highly express TGF-beta 3. MSC, MSC + TGF-beta 3 and TGF-beta 3MSC are cultured, total protein of cells is collected by RIPA lysate, and after the total protein is fully lysed on ice, the protein concentration is detected by using a BCA protein quantification method. 5 XLoading Buffer was added to the lysed protein for cooking at 100 ℃ for 20 min. The three groups of proteins were subjected to electrophoresis by loading 10% SDS-PAGE in the same amount. And (3) after the electrophoresis is finished, membrane switching is carried out, after the membrane switching is finished, the membrane is cut according to the size of the TGF-beta 3 protein and the size of the internal reference GAPDH, and the membrane is placed into a confining liquid for confining for 2 hours. After blocking was complete, the membranes were washed and incubated overnight with TGF-. beta.3 antibody and GAPDH antibody. And after the first antibody is incubated, washing the membrane, incubating for two hours by using the corresponding second antibody, washing the membrane, dripping chemiluminescence liquid on the membrane, incubating for several minutes, and exposing the membrane by using a chemiluminescence instrument.

As shown in 2C, it can be seen from the exposed band that the TGF-. beta.3 protein expression of MSC + TGF-. beta.3 is slightly higher than that of MSC, but the TGF-. beta.3 band of TGF-. beta.3 MSC is darker and the TGF-. beta.3 expression is significantly increased at the protein level. This suggests that infected mesenchymal stem cells are indeed capable of expressing TGF- β 3 at a high protein level.

The results prove that the mesenchymal stem cells with high expression of TGF-beta 3 can be successfully constructed, and compared with the conventional method of co-incubation by using growth factors, the expression level of TGF-beta 3 can be remarkably improved, which is beneficial to obtaining exosomes with high expression of TGF-beta 3.

Example 3 characterization of TGF-beta 3 exosomes secreted by mesenchymal stem cells following infection with TGF-beta 3 lentivirus

1. Extracting exosomes of normal mesenchymal stem cells, mesenchymal stem cells incubated by TGF-beta 3 growth factors and mesenchymal stem cells infected with TGF-beta 3 lentiviruses. After the cells were cultured until the confluency reached 50%, DMEM containing 0.5% fetal bovine serum without exosomes and 1% P/S was replaced for 48 h. After the culture is finished, collecting a cell culture medium, performing gradient centrifugation, and keeping the temperature at 4 ℃ in the whole process. 500 Xg, 10min, and the supernatant was collected. 2000 Xg, 20min, and the supernatant was collected. 10000 Xg, 40min, and taking the supernatant. The supernatant was centrifuged using an ultracentrifuge at 100000 Xg for 90min to obtain a precipitate. Resuspend the pellet in PBS, continue ultracentrifugation at 4 deg.C, 100000 Xg, 90min, and collect the pellet. The pellet was resuspended in 100. mu.L PBS and stored in a-80 ℃ freezer for subsequent experiments.

2. The morphology of the extracted exosomes was verified using Transmission Electron Microscopy (TEM). Dripping 10 mu L of exosome dissolved in PBS on a copper mesh special for a transmission electron microscope to be attached for 10min, then sucking redundant liquid along the edge of the copper mesh by using absorbent paper, dripping 10 mu L of uranium acetate on the copper mesh to carry out negative dyeing on the copper mesh for 10min, then sucking redundant liquid of the copper mesh by using the absorbent paper, dripping water on the copper mesh, washing twice, and washing for 5min each time. And (4) airing the copper mesh, and observing the form of the exosomes attached to the copper mesh by using a transmission electron microscope.

As shown in FIG. 3A, exosomes (MSC-Exo) extracted from normal mesenchymal stem cells, exosomes (MSC + TGF-. beta.3-Exo) extracted from TGF-. beta.3 growth factor-co-incubated mesenchymal stem cells, and exosomes (TGF-. beta.3 MSC-Exo) extracted from TGF-. beta.3 lentivirus-infected mesenchymal stem cells were all in the form of vesicles having a double lipid membrane structure, and had a particle size of about 100 nm.

3. The extracted exosomes were diluted with PBS, filtered with a 0.22um filter, and then added to a cuvette, which was examined for particle size distribution range and zeta potential using an instrument. As shown in FIGS. 3B and 3C, the particle size distributions of MSC-Exo, MSC + TGF-. beta.3-Exo and TGF-. beta.3 MSC-Exo were mainly concentrated at about 105nm, 95nm and 116nm (FIG. 3B), and the range of zeta potential was mainly concentrated at-10 to-20 mV (FIG. 3C).

4. The expression level of TGF-beta 3 protein in MSC-Exo, MSC + TGF-beta 3-Exo and TGF-beta 3MSC-Exo is tested by the method of Western Blot. And (3) cracking the exosome precipitate after ultracentrifugation by using a RIPA solution, and then detecting the protein concentration of the exosomes secreted by the two mesenchymal stem cells by using a BCA method. After the detection is finished, 5 XLoading Buffer is added into the exosome solution, and the sample is boiled at 100 ℃ for 20 min. Subsequently, 10% SDS-PAGE was performed, and these two groups of proteins were loaded with the same amount of protein. Electrophoresis was carried out at a voltage of 60mV, and after completion of electrophoresis, membrane transfer was carried out at a current of 330 mA. After the end of the membrane transfer, the membrane was cut and sealed for 2h, washed 3 times, and incubated overnight with TGF-. beta.3 antibody, the exosome marker protein ALIX antibody, and the internal control GAPDH antibody at 4 ℃ with slow shaking. After the primary antibody is incubated for the next day, the membrane is washed for 3 times by TBST, and then the secondary antibody is incubated for 2h with slow shaking, and the membrane is washed for 3 times by TBST. Dropping chemiluminescence liquid on the membrane, incubating for several minutes, and finally exposing the membrane by using a chemiluminescence instrument.

As shown in FIG. 3D, under the condition of consistent internal control GAPDH protein bands, ALIX can be expressed in MSC-Exo, MSC + TGF-beta 3-Exo and TGF-beta 3MSC-Exo, which indicates that the obtained exosomes are indeed obtained by extraction. TGF-beta 3 bands of MSC-Exo and MSC + TGF-beta 3-Exo are almost the same and have no significant difference, while TGF-beta 3 bands of TGF-beta 3MSC-Exo are thicker and darker compared with MSC-Exo and MSC + TGF-beta 3-Exo, and the expression level of TGF-beta 3 protein is higher.

The above results demonstrate that we extract exosomes from normal mesenchymal stem cells (MSC-Exo), exosomes from TGF- β 3 growth factor co-incubated mesenchymal stem cells (MSC + TGF- β 3-Exo), and exosomes from TGF- β 3 lentivirus infected mesenchymal stem cells (TGF- β 3 MSC-Exo) are characteristic of exosomes. In addition, it is proved that although the expression level of TGF-beta 3 can be slightly increased after the mesenchymal stem cells are incubated with the TGF-beta 3 biological factors, compared with the secreted exosomes MSC + TGF-beta 3-Exo and MSC-Exo, TGF-beta 3 has no difference in protein level. And compared with MSC-Exo and MSC + TGF-beta 3-Exo, the exosome TGF-beta 3MSC-Exo secreted by the mesenchymal stem cells infected by the TGF-beta 3 lentivirus can obviously increase the expression level of TGF-beta 3 on the protein level.

Example 4 in vitro biological function of TGF-. beta.3 exosomes

1. The scratch test is used for verifying the promotion of cell migration of the high-expression TGF-beta 3 exosome derived from the mesenchymal stem cells to skin cells. HaCaT cells were plated on two 24-well plates for culture until the cells grew to 70%. A200 μ L tip was used to draw a straight line in the middle of each well, compared to a ruler. The cell culture medium was removed and the dead cells or cell debris remaining in the wells were washed away with PBS. A negative control group (Ctrl), a normal mesenchymal stem cell-derived exosome group (MSC-Exo) and a TGF-beta 3 lentivirus-infected mesenchymal stem cell-secreted exosome group (TGF-beta 3 MSC-Exo) were set, and each group had three wells. Negative control group was added with fresh DMEM without FBS. The other two experimental groups were each supplemented with DMEM medium without FBS and containing exosomes (100ug/mL) secreted from mesenchymal stem cells. The cells immediately after the addition of the scratch to the medium were photographed, and the cells cultured for 24h were recorded and stored by photographing with a microscope, as shown in FIG. 4A. Measuring the scratch area by using Image J software, and calculating the migration rate of the HaCaT cells, wherein the formula is as follows: the cell migration rate was (0h scratch area-24 scratch area)/0 h scratch area × 100%, and the cell migration rate was plotted as shown in fig. 4B.

The experimental result shows that compared with a negative control group, the exosomes secreted by the two mesenchymal stem cells can promote the migration of the cells. Compared with MSC-Exo, TGF-beta 3MSC-Exo can promote migration of HaCaT cells. Therefore, TGF-beta 3MSC-Exo can indeed play a role in promoting proliferation and migration of damaged skin cells.

2. CCK-8 experiment method is used for detecting the influence of TGF-beta 3MSC-Exo on the proliferation of HaCaT cells. The cells were plated in 96-well plates, respectively, and when the degree of fusion of the cells reached 50%, exosomes derived from normal mesenchymal stem cells (MSC-Exo) (100ug/mL) and exosomes secreted from mesenchymal stem cells infected with TGF- β 3 lentivirus (TGF- β 3 MSC-Exo) (100ug/mL) were added to the cells. A blank control group (Negative Ctrl) and an experimental control group (Positive Ctrl) were set. The blank contained no cells and no drug, only cell culture medium. The experimental control group contained cells and cell culture medium. After 48h, 10 microliter of CCK-8 solution is added into each well, and after incubation for 1h, absorbance at the wavelength of 450nm is detected by a microplate reader. After the detection, the proliferation rate of the cells was calculated.

The experimental results are shown in fig. 4C, and both MSC-Exo and TGF- β 3MSC-Exo significantly increased cell proliferation compared to the control group. And TGF- β 3MSC-Exo has significant differences in proliferation of cells compared to MSC-Exo.

3. The inhibition of the TGF-beta 3MSC-Exo on the immune cells was verified by PBMC proliferation experiments. The 48-well plates were coated one day in advance with CD3 antibody and PBMCs were labeled with CFSE dye. PBMCs were then plated into 48-well plates with IL-2 added to each well at a ratio of 1: 1000. An experimental group and a control group are set, and MSC-Exo (100ug/mL) and TGF-beta 3MSC-Exo (100ug/mL) are added into the experimental group. The control component comprises a negative control group and a positive control group. PBMCs in the negative control group were cultured without drug treatment. The positive control group was CFSE stained without any treatment and immediately flow-based PBMC proliferation was detected (d 0). After the PBMC were placed in a cell culture chamber and cultured for 5 days, the cells were collected at 2000rpm for 5min, the cell pellet was resuspended with 500. mu.L PBS, and the proliferation of PBMC was directly examined by a flow meter.

The experimental results are shown in FIG. 4D, and compared with Ctrl (D5) and MSC-Exo, TGF-beta 3MSC-Exo can inhibit the proliferation of PBMC, and the TGF-beta 3MSC-Exo can really inhibit the activation and proliferation of immune cells.

In conclusion, the TGF-beta 3MSC-Exo can well promote the proliferation and migration of skin cells and inhibit the activation and proliferation of immune cells.

Example 5 Effect of mesenchymal Stem cell-derived TGF-beta 3 exosomes on skin wounds

1. The method for constructing the animal model comprises the following steps: male, 6-8 week old BALB/c mice were purchased from the center of laboratory animals at the eastern school district of the university of zhongshan, guangdong, and the mice were housed in an SPF sterile environment. The mice were anesthetized with 1% sodium pentobarbital, and then the anesthetized mice were depilated on the back with depilatory cream. A circle with a diameter of 0.8cm was drawn with a pen on the dorsal central spine of the mouse, the skin was carefully cut along the circle with sterilized scissors, and the dorsal skin-cut back was photographed after hemostasis with cotton.

2. Grouping situation and administration mode. Mice were divided into three groups, 5 each, a control group (Ctrl), an exosome group secreted by normal mesenchymal stem cells (MSC-Exo) and an exosome group secreted by mesenchymal stem cells stably highly expressing TGF- β 3 (TGF- β 3 MSC-Exo). Tail vein administration was performed daily for 7 days starting on the third day after the model of the traumatic injury was created. The mice in the control group were administered 100. mu.L of PBS through the tail vein, and the mice in the experimental group were administered exosomes (25mg/kg) through the tail vein. After the mice were continuously dosed to day10, the back wounds were photographed and sampled after anesthetizing the mice. The wound healing profile of the mice is shown in figure 5A. The wound areas of day10 and day 0 were measured using Image J, and the rate of change of the wound areas was calculated, as shown in fig. 5B. Compared with a control group, the MSC-Exo and the TGF-beta 3-MSC-Exo can better promote wound contraction. Compared with MSC-Exo, TGF-beta 3MSC-Exo can remarkably promote wound contraction and reduce scar formation.

3. And (5) pathological histological examination. Following continued treatment, mice were anesthetized with sodium pentobarbital at day10 and dissected for sampling. A portion of the dorsal skin of the mouse was cut and placed in a centrifuge tube containing 4% paraformaldehyde for fixation. After fixation, embedding, sectioning and subsequent HE staining were further performed using paraffin and immunohistochemistry using Ki67 antibody. HE and IHC results are shown in fig. 5C. As can be seen from the figure, compared with a control group, the MSC-Exo and the TGF-beta 3MSC-Exo can better complete wound epithelization and increase skin cell proliferation, the effect of the TGF-beta 3MSC-Exo is more obvious, inflammatory cell infiltration in skin wounds after the TGF-beta 3MSC-Exo treatment is less, and scar repair conditions are better.

4. When sampling mice after day10 anesthesia, a portion of the dorsal skin of the mice was cut off and stored at-80 ℃ for subsequent use in RNA extraction. The skin was removed from the freezer and the cut portion was placed in a centrifuge tube, 700 μ ltrlizoll lysate and milling beads were added to the centrifuge tube and milled using a tissue mill until no significant particulate matter was present. The beads were removed from the centrifuge tube, then 140 μ L chloroform was added and the solution was mixed until white. Centrifuge at 12000rpm for 10min, transfer the supernatant to a new centrifuge tube and add an equal volume of isopropanol. Centrifuging at 12000rpm for 10min, discarding the supernatant and retaining the precipitate. Add 700. mu.L of 75% ethanol to the centrifuge tube containing the pellet, centrifuge at 12000rpm for 5min, discard the supernatant, and repeat once. After centrifugation, the supernatant was discarded, the tube was placed in a fume hood, the precipitate was air-dried, a certain amount of DEPC water was added to dissolve the precipitate, and then RNA concentration was measured with Nanodrop. Reverse transcription is carried out on RNA according to the instructions of a reverse transcription kit, and then fluorescence quantitative PCR is carried out to detect the mRNA level of alpha-SMA and MMP9 in each group of skin, wherein the fluorescence quantitative PCR detection takes beta-actin as an internal reference gene.

The PCR primer sequence for detecting the beta-actin reference gene by fluorescent quantitative PCR is as follows:

a forward primer F: 5' -GGCTGTATTCCCCTCCATCG (SEQ ID NO.13)

Reverse primer R: 5' -CCAGTTGGTAACAATGCCATGT (SEQ ID NO.14)

The primer sequence for detecting the transcription level of the alpha-SMA by the fluorescent quantitative PCR is as follows:

a forward primer F: 5' -GGCACCACTGAACCCTAAGG (SEQ ID NO.15)

Reverse primer R: 5' -ACAATACCAGTTGTACGTCCAGA (SEQ ID NO.16)

Primers for detecting the transcription level of MMP9 by fluorescent quantitative PCR are as follows:

a forward primer F: 5' -GGACCCGAAGCGGACATTG (SEQ ID NO. 17);

reverse primer R: 5' -CGTCGTCGAAATGGGCATCT (SEQ ID NO. 18).

The fluorescent quantitative PCR result is shown in figure 5D, compared with the Ctrl group, the MSC-Exo group and the TGF-beta 3MSC-Exo group can obviously improve the expression of skin alpha-SMA and MMP9, which shows that the exosome derived from the mesenchymal stem cells can effectively promote the proliferation of the skin cells, reduce the generation of scars and promote the contraction of wounds, and the alpha-SMA and MMP9 expression amount of the TGF-beta 3MSC-Exo group is more, which shows that the high-expression TGF-beta 3 exosome derived from the mesenchymal stem cells can effectively promote the release of growth factors at wounds, promote the continuous proliferation of the skin cells and enable the wound healing speed to be faster.

5. Blood collection of the mouse heart was required after day10 anesthesia of the mouse. The collected blood was allowed to stand for 4 hours, and the blood was allowed to separate into layers. The tubes containing the blood were then centrifuged at 12000rpm for 10 min. After completion of the centrifugation, the supernatant was taken and used as an experimental sample. Three groups were set, a control group, an MSC-Exo group and a TGF-. beta.3 MSC-Exo group. The antibody-coated strips were removed from the freezer, 100 μ L of the experimental sample and standard were added to the strips, three wells per set, and the strips were sealed with a sealing plate of gummed paper and incubated at 37 ℃ for 90 min. Then Washing the plate strips for 5 times by using Washing buffer working solution, and draining the liquid in the holes. The biotinylated antibody working solution was added to each well in an amount of 50. mu.L/well, and the plate was covered with a sealing membrane and incubation continued at 37 ℃ for 90 min. The strips were washed 5 times with Washing buffer working solution. mu.L of strptavidin-HRP working solution was added to each well, the plate was covered with a sealing membrane, and incubation was continued at 37 ℃ for 30 min. After incubation the plate was washed 5 times. mu.L of TMB was added to each well at 37 ℃ for 15 min. Finally, 100. mu.L of stop solution was added to each well to stop the reaction. The OD value was measured at a wavelength of 450nm using a microplate reader, a standard curve was drawn, and the concentration was calculated. The experimental results are shown in fig. 5E, and compared to ctrl (control) and MSC-Exo groups, TGF- β 3 in the blood of mice in TGF- β 3MSC-Exo group was more abundant, indicating that TGF- β 3 levels in vivo could be significantly increased by intravenous injection of TGF- β 3 MSC-Exo.

In conclusion, we found that exosomes secreted by mesenchymal stem cells incubated with TGF-beta 3 growth factors did not significantly increase the expression level of TGF-beta 3 in exosomes. And the corresponding structure of the mesenchymal stem cell surface marker CD44 is adopted to design the TGF-beta 3 fusion protein, successfully anchors the TGF-beta 3 on the cell membrane of the mesenchymal stem cell, and successfully obtains the mesenchymal stem cell which is anchored on the membrane and highly expresses the TGF-beta 3. In addition, the expression level of TGF-beta 3 in exosomes secreted by TGF-beta 3 lentivirus-infected mesenchymal stem cells (TGF-beta 3 MSC-Exo) is significantly increased compared to exosomes secreted by mesenchymal stem cells incubated directly with TGF-beta 3 growth factors. The TGF-beta 3MSC-Exo is used in-vivo and in-vitro experiments to verify that the TGF-beta 3MSC-Exo has the effects of promoting the proliferation of skin cells and the contraction of skin wounds, inhibiting the activated proliferation of over-activated immune cells existing in the inflammatory phase of skin wounds, increasing the release of growth factors at skin lesions, effectively reducing the generation of scars and remarkably improving and accelerating the healing condition of the skin after the wounds. Therefore, TGF-beta 3MSC-Exo has good prospect in the treatment of skin wound repair.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou Yuanxiang Biotechnology Ltd

<120> TGF-beta 3 mesenchymal stem cell exosome and preparation method and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 60

<212> DNA

<213> Artificial Sequence

<400> 1

atggacaagt tttggtggca cgcagcctgg ggactctgcc tcgtgccgct gagcctggcg 60

<210> 2

<211> 1173

<212> DNA

<213> Artificial Sequence

<400> 2

atgaagatgc acttgcaaag ggctctggtg gtcctggccc tgctgaactt tgccacggtc 60

agcctctctc tgtccacttg caccaccttg gacttcggcc acatcaagaa gaagagggtg 120

gaagccatta ggggacagat cttgagcaag ctcaggctca ccagcccccc tgagccaacg 180

gtgatgaccc acgtccccta tcaggtcctg gccctttaca acagcacccg ggagctgctg 240

gaggagatgc atggggagag ggaggaaggc tgcacccagg aaaacaccga gtcggaatac 300

tatgccaaag aaatccataa attcgacatg atccaggggc tggcggagca caacgaactg 360

gctgtctgcc ctaaaggaat tacctccaag gttttccgct tcaatgtgtc ctcagtggag 420

aaaaatagaa ccaacctatt ccgagcagaa ttccgggtct tgcgggtgcc caaccccagc 480

tctaagcgga atgagcagag gatcgagctc ttccagatcc ttcggccaga tgagcacatt 540

gccaaacagc gctatatcgg tggcaagaat ctgcccacac ggggcactgc cgagtggctg 600

tcctttgatg tcactgacac tgtgcgtgag tggctgttga gaagagagtc caacttaggt 660

ctagaaatca gcattcactg tccatgtcac acctttcagc ccaatggaga tatcctggaa 720

aacattcacg aggtgatgga aatcaaattc aaaggcgtgg acaatgagga tgaccatggc 780

cgtggagatc tggggcgcct caagaagcag aaggatcacc acaaccctca tctaatcctc 840

atgatgattc ccccacaccg gctcgacaac ccgggccagg ggggtcagag gaagaagcgg 900

gctttggaca ccaattactg cttccgcaac ttggaggaga actgctgtgt gcgccccctc 960

tacattgact tccgacagga tctgggctgg aagtgggtcc atgaacctaa gggctactat 1020

gccaacttct gctcaggccc ttgcccatac ctccgcagtg cagacacaac ccacagcacg 1080

gtgctgggac tgtacaacac tctgaaccct gaagcatctg cctcgccttg ctgcgtgccc 1140

caggacctgg agcccctgac catcctgtac tatgttggga ggacccccaa agtggagcag 1200

ctctccaaca tggtggtgaa gtcttgtaaa tgtagctga 1239

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 3

tccgcttgtt actgtgagct ttcc 24

<210> 4

<211> 63

<212> DNA

<213> Artificial Sequence

<400> 4

tggctgatca tcttggcatc cctcttggcc ttggctttga ttcttgcagt ttgcattgca 60

gtc 63

<210> 5

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 5

ggatcttcca gagatatgaa gatgcacttg caaaggg 37

<210> 6

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 6

ctgccgttcg acgattcagc tacatttaca agacttcacc a 41

<210> 7

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 7

tgaaccgtca gatccgctag ccgatggaca agttttggtg gc 42

<210> 8

<211> 45

<212> DNA

<213> Artificial Sequence

<400> 8

aactctagag gatccgcggc cgcgactgca atgcaaactg caaga 45

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

agaaaatctg gcaccacacc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

agaggcgtac agggatagca 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

acttgcacca ccttggactt c 21

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

ggtcatcacc gttggctca 19

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

ggctgtattc ccctccatcg 20

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 14

ccagttggta acaatgccat gt 22

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

ggcaccactg aaccctaagg 20

<210> 16

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 16

acaataccag ttgtacgtcc aga 23

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 17

ggacccgaag cggacattg 19

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 18

cgtcgtcgaa atgggcatct 20

Claims

1. A TGF-beta 3 mesenchymal stem cell exosome, which is an exosome secreted by mesenchymal stem cells and can express TGF-beta 3 fusion protein on a mesenchymal stem cell membrane; the TGF-beta 3 fusion protein is sequentially an N-terminal signal peptide, a target TGF-beta 3 protein, a connecting peptide and a mesenchymal stem cell transmembrane region from the N terminal.

2. TGF- β 3 mesenchymal stem cell exosomes according to claim 1, wherein the N-terminal signal peptide is the signal peptide of the mesenchymal stem cell surface marker CD 44.

3. TGF- β 3 mesenchymal stem cell exosome according to claim 2, wherein the nucleotide sequence of the signal peptide is as shown in SEQ ID No.1, or is as shown in SEQ ID No.1 with one or more nucleotides substituted, deleted and/or added, and is capable of encoding a nucleotide sequence of the same functional protein.

4. TGF- β 3 mesenchymal stem cell exosome according to claim 2, wherein the nucleotide sequence of the TGF- β 3 protein of interest is as shown in SEQ ID No.2, or in SEQ ID No.2 with one or more nucleotides substituted, deleted and/or added, and is capable of encoding a nucleotide sequence of the same functional protein.

5. TGF- β 3 mesenchymal stem cell exosome according to any one of claims 2-4, wherein the nucleotide sequence of the transmembrane region is as shown in SEQ ID No.4, or SEQ ID No.4 with one or more nucleotides substituted, deleted and/or added and is capable of encoding a nucleotide sequence of the same functional protein.

6. A method of producing a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1 to 5, comprising the steps of:

constructing a lentiviral expression vector containing a gene for a TGF- β 3 fusion protein according to any one of claims 1 to 5;

infecting mesenchymal stem cells with the lentiviral expression vector;

the mesenchymal stem cells secrete TGF-beta 3 mesenchymal stem cell exosomes.

7. Use of a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1 to 5 in the manufacture of a medicament or product for promoting tissue damage and regeneration.

8. Use of a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1 to 5 in the manufacture of a medicament or product for the treatment of tissue damage due to chronic inflammation.

9. Use of a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1 to 5 in the manufacture of a medicament or product for reducing scarring.

10. Use of a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1-5 in the preparation of an immunosuppressive medicament.

11. Use of a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1 to 5 in the manufacture of a medicament or product for promoting epidermal cell migration.

12. Use of a TGF- β 3 mesenchymal stem cell exosome according to any one of claims 1 to 5 in the manufacture of a medicament or product for promoting skin wound repair.

13. A medicament or product for treating tissue trauma or promoting wound repair or scar reduction, comprising an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient comprises TGF-beta 3 mesenchymal stem cell exosomes.

14. The medicament or product for treating tissue wounds or promoting wound repair or reducing scarring according to claim 13, wherein the medicament or product is in the form of an injection or a transdermal preparation.

15. The medicament or product for treating tissue trauma or promoting wound repair or reducing scarring according to claim 13, wherein the product is a medical, cosmetic, or cosmetology product.

16. A medicament or product for treating tissue trauma or promoting wound repair or reducing scarring according to claim 15, characterised in that the product is a liquid formulation or a cream or a gel.

17. A medicament or product for use in traumatizing tissue or promoting wound repair or reducing scarring according to any one of claims 13 to 16, wherein the tissue is skin tissue.