CN113069547B - Application of Bap1 as tumor treatment target in preparation of drugs for preventing or treating tumors - Google Patents

Abstract

The invention provides an application of Bap1 as a tumor treatment target in preparation of a tumor prevention or treatment drug, and belongs to the technical field of tumor drugs. The deletion of the Bap1 protein in various tumor cells can enhance the anti-tumor immune function of an organism and obviously enhance the killing capability of various cell factors and immune cells to the tumor cells. Therefore, the invention provides the application of the reagent for inhibiting Bap1 in preparing the medicine for tumor immunotherapy. Experiments prove that the tumor cells lacking the Bap1 protein grow or eliminate tumors in a mouse with a normal immune system, meanwhile, the tumor cells lacking the Bap1 depend on CD8T cell mediated anti-tumor immune response and depend on tumor antigen presentation to realize tumor killing, and in addition, the deletion of the Bap1 can also reduce the expression level of PD-L1, so that the Bap1 serving as a tumor treatment target has wide application prospect in anti-tumor immunotherapy.

Description

Application of Bap1 as tumor treatment target in preparation of drugs for preventing or treating tumors

Technical Field

The invention belongs to the technical field of tumor drugs, and particularly relates to application of Bap1 as a tumor treatment target in preparation of a drug for preventing or treating tumors.

Background

Brca 1-associated protein 1 (Brca 1 associated protein 1), bap1, is named Bap1 in human genome, a member of the ubiquitin hydroxyl-terminal hydrolase family, whose essential function is to remove ubiquitination modification of substrate proteins. The Bap1 protein is involved in the regulation of various cellular functions such as cell proliferation, cell differentiation, programmed cell death, DNA loss repair, chromatin modification, and the like. BAP1 gene mutations occur frequently in uveal melanoma, malignant mesothelioma, and renal cell carcinoma, and most early studies suggest BAP1 as an anti-cancer gene. However, in recent years, it has been reported that BAP1 can promote the development of breast cancer by its deubiquitinating function.

Disclosure of Invention

In view of the above, the present invention aims to provide a new application of Bap1, namely an application of Bap1 as a tumor treatment target in preparing a drug for preventing or treating tumors.

The invention provides application of an agent for inhibiting expression or activity of Bap1 in preparation of a product with at least one function of the following (1) to (4);

(1) Preventing or treating tumors;

(2) Inhibiting tumor cell growth;

(3) Increasing killing power to tumor cells;

(4) The survival time of tumor organisms is prolonged;

(5) Increase the presentation of tumor cell surface antigens.

Preferably, the increased lethality to tumor cells comprises lethality of a cytokine or combination of cytokines to tumor cells and lethality of immune cells to tumor cells.

Preferably, the cytokine comprises FasL, TNF α, IFN γ, or IFN β; the cytokine combination comprises two or more of FasL, TNF α, IFN γ, and IFN β;

the immune cells comprise T cells; the T cells include CD8T cells.

Preferably, the inhibition of tumor cell growth includes promoting apoptosis of tumor cells, inhibiting tumor cell tumorigenesis, and eliminating tumor cells by the immune system.

The invention also provides application of the Bap 1-deficient tumor cells in preparation of a tumor immunotherapy medicament.

Preferably, the Bap1 deficient tumor cells are dependent on a CD8T cell mediated anti-tumor immune response.

Preferably, the agent that inhibits expression or activity of Bap1 includes an agent that inhibits expression of a Bap1 gene, inhibits expression of a Bap1 protein, or loses activity of a Bap1 protein.

Preferably, the inhibition of the expression of the Bap1 gene is a way of gene editing to cause base insertion mutation, base deletion mutation, non-synonymous base mutation or whole gene loss of the Bap1 gene.

Preferably, the agent that inhibits the expression of the Bap1 gene includes an RNA molecule that interferes with the Bap1 gene.

Preferably, the agent that inhibits expression of the Bap1 protein or loses activity of the Bap1 protein includes an antibody against the Bap1 protein or a small molecule inhibitor of the Bap1 protein.

Preferably, the tumor comprises one or more of uveal melanoma, testicular germ cell cancer, squamous cell carcinoma of lung, thyroid cancer, renal clear cell carcinoma, cutaneous melanoma, invasive breast cancer, brain low-grade glioma, prostate cancer, colon cancer, renal cancer and lung cancer.

The invention provides application of an agent for inhibiting expression or activity of Bap1 in preparing a product with at least one function of the following (1) to (4); (1) preventing or treating tumors; (2) inhibiting tumor cell growth; (3) increasing lethality to tumor cells; and (4) prolonging the survival time of tumor organisms. The invention takes Bap1 as a tumor treatment target, can enhance the anti-tumor immune function of an organism, remarkably enhance the killing capacity of various cytokines and T cells to the tumor cells, inhibit the growth or elimination of the tumor cells, promote the apoptosis of the tumor cells and prolong the survival time of the tumor organism by knocking out or inhibiting the function of a Bap1 gene or protein, thereby remarkably enhancing the tumor immune treatment effect by deleting the function of Bap1, and taking the Bap1 protein as the tumor treatment target has wide application prospect and extremely high medical value.

The invention provides application of a Bap 1-deficient tumor cell in preparation of a tumor immunotherapy drug. Experiments prove that the deletion of the Bap1 in the tumor cells can enable a mouse to generate long-term immunological memory capacity on the tumor cells, so that the tumor cells with the deletion of the same Bap1 can be rapidly eliminated by a mouse body, and the purpose of tumor immunotherapy is realized.

Meanwhile, the application provided by the invention has a treatment effect on various tumors. Experiments prove that the Bap1 gene is knocked out of various tumor cells such as melanoma, colon cancer, breast cancer, kidney cancer, lung cancer and the like, and the immunotherapy effect of corresponding tumors can be achieved.

Drawings

FIG. 1 shows the results of detection of abnormal expression of Bap1 protein in MC38 tumor cells with gene editing;

FIG. 2 is a graph showing the growth of tumor cells that are inhibited until they disappear after the tumor cells are injected subcutaneously into normal BALB/c mice after the deletion of Bap1 protein in CT26 tumor cells, and a graph showing the survival of the mice;

FIG. 3 is a graph showing the growth of tumors and the survival of mice after subcutaneous injection of Balb 1-deficient and wild-type 4T1 tumor cells in normal BALB/c mice;

FIG. 4 is a graph showing the growth of tumors and the survival of mice after subcutaneous injection of Balb 1-deficient and wild-type EMT6 tumor cells in normal BALB/c mice;

FIG. 5 is a graph showing the growth of tumor cells and the survival of mice after subcutaneous injection of Bap 1-deficient and wild-type MC38 tumor cells in normal C57BL/6 mice;

FIG. 6 is a graph of tumor growth and survival of mice following subcutaneous injection of Bap 1-deficient and wild-type B16.F10 tumor cells in normal C57BL/6 mice;

FIG. 7 shows that depletion of Bap1MC38 tumor cells can induce systemic immune memory, wherein A is the ability of wild type C57BL/6 mice to eliminate wild type MC38 cells 54 days after eliminating Bap1 depleted MC38 cells; b is CD8 which is depended on the memory killing of C57BL/6 mice to tumor cells ⁺ A T cell;

FIG. 8 statistics of apoptosis rate after treatment of Bap 1-deficient MC38 tumor cells with cytokines TNF α, IFN γ, or IFN β;

FIG. 9 is a graph showing the growth of tumors injected subcutaneously into various immunodeficient mice after the removal of the Bap1 protein from the tumor cells;

FIG. 10 is a graph showing that killing of tumor by CD8T lymphocytes depends on MHCI-mediated antigen presentation by knocking out B2m, tap gene and Fas gene in tumor cells;

FIG. 11 is a graph showing a comparison of the infiltration of immune cells in a Bap1 protein-deficient tumor and a Bap1 wild-type tumor, wherein the number of immune cells per gram of tumor sample is significantly increased in the Bap1 protein-deficient tumor;

FIG. 12 is CD8T cells with loss of Bap1 protein in tumor cells resulting in more tumor-specific killing in the tumor microenvironment of C57BL/6 mice;

FIG. 13 shows that the deletion of Bap1 tumor cells is more easily killed by T cells; wherein FIG. 13a is the results of a CAR-T cell in vivo killing assay; FIG. 13b shows the results of an in vivo OT-I T cell killing experiment;

FIG. 14 is a sample of TCGA database human tumor data for CD8 analysis in patients ⁺ And scoring the immune infiltration of immune cells such as T cells and activated cDC.

Detailed Description

The invention provides application of an agent for inhibiting expression or activity of Bap1 in preparing a product with at least one function of the following (1) to (4);

(1) Preventing or treating tumors;

(2) Inhibiting tumor cell growth;

(3) Increase the killing power to tumor cells;

(4) The survival time of tumor organisms is prolonged;

(5) Increasing the presentation of tumor cell surface antigens.

In the present invention, the tumor includes one or more of uveal melanoma, testicular germ cell cancer, squamous cell lung cancer, thyroid cancer, clear cell renal cancer, cutaneous melanoma, invasive breast cancer, brain low-grade glioma, prostate cancer, colon cancer, renal cancer and lung cancer.

In the present invention, the agent inhibiting expression or activity of Bap1 preferably includes an agent inhibiting expression of a Bap1 gene, inhibiting expression of a Bap1 protein, or losing activity of a Bap1 protein. The agent that inhibits the expression of the Bap1 protein or loses the activity of the Bap1 protein preferably includes an antibody to the Bap1 protein or a small molecule inhibitor of the Bap1 protein. The inhibition of the expression of the Bap1 gene is preferably achieved by gene editing, which causes the Bap1 gene (SEQ ID NO: 1) to have base insertion mutation, base deletion mutation, non-synonymous base mutation or whole gene loss. According to the invention, cas9 and guide RNA (sgRNA) are delivered to the tumor cell, and the Bap1 gene in the tumor cell is edited in a targeted manner, so that the Bap1 protein of the tumor cell cannot be normally expressed. The agent for inhibiting expression of the Bap1 gene preferably includes an RNA molecule that interferes with the Bap1 gene, more preferably sgRNA. The sgRNA preferably includes two sets of gRNAs, wherein Bap1_ gRNA I includes Bap1_ gRNA _1F (TGGCAGCCGCTGGACAATA, SEQ ID NO: 2) and Bap1_ gRNA _1R (tattgccagcggctgcca, SEQ ID NO: 3); bap1_ gRNA II includes Bap1_ gRNA _2F (CCTTCATTCGGCTCAGCGT, SEQ ID NO: 4) and Bap1_ gRNA _2R (ACGCTGAGCGAATGAAGG, SEQ ID NO: 5). Gene editing was performed on a variety of tumor cells using two grnas, and the result of Bap1 gene editing on MC38 cells using Bap1_ gRNA _ I editing, MC38 Bap1 KO1, is shown in table 1.

TABLE 1MC38 Bap1 KO1 sequence after MCP 38 cell Bap1 Gene editing

Note: deleting the sequence, and thickening the sequence, namely inserting the sequence; bp is the size of the deleted fragment and bp is the size of the inserted fragment; initiation of mutation site: 5' to the nucleotide sequence of the Bap1 gene. The same is applied below.

Table 2 shows the result of Bap1 gene editing on MC38 cells by Bap1_ gRNA _ I, MC38 Bap1 KO 2.

TABLE 2 MC38 Bap1 KO2 sequences after MCP 38 cell Bap1 Gene editing

Table 3 shows the results of Bap1 gene editing on CT26 cells using Bap1_ gRNA _ I, CT26 Bap1 KO 2.

TABLE 3 CT26 cell post-Bap 1 Gene editing CT26 Bap1 KO1 sequence

Table 4 shows the results of Bap1 gene editing on CT26 cells using Bap1_ gRNA _ I, CT26 Bap1 KO 2.

TABLE 4 CT26 cell after editing of the Bap1 Gene CT26 Bap1 KO2 sequence

The result of Bap1 gene editing on MC38 cells using Bap1_ gRNA _ II, MC38 Bap1 KO3, is shown in table 5.

TABLE 5 MC38 Bap1 KO3 sequences after MCP 38 cell Bap1 Gene editing

Table 6 shows the result of Bap1 gene editing on the bp 16.F10 cells by Bap1_ gRNA _ II, b16.F10 Bap1 KO 1.

TABLE 6 B16F10 cell B16F10 Bap1 KO1 sequences after Bap1 gene editing

Table 7 shows the result of Bap1 gene editing on the bp 16.F10 cells by Bap1_ gRNA _ II, b16.F10 Bap1 KO 2.

Table 7b 16.F10 cell bp 1 KO2 sequences after Bap1 gene editing

Table 8 shows the results of Bap1 gene editing on 4T1 cells by Bap1_ gRNA _ II, b16.F10 Bap1 KO 1.

TABLE 8 T1 cells post-Bap1 Gene editing 4T1 Bap1 KO1 sequences

Table 9 shows the results of Bap1 gene editing on 4T1 cells by Bap1_ gRNA _ II, b16.F10 Bap1 KO 2.

TABLE 9 4T1 cells post-4 T1 Bap1 KO2 sequences editing Bap1 Gene

Table 10 shows the results of Bap1 gene editing on 4T1 cells by Bap1_ gRNA _ II, b16.F10 Bap1 KO 3.

TABLE 10 4T1 cells post-4 T1 Bap1 KO3 sequences editing Bap1 Gene

Table 11 shows the results of editing the Bap1 gene of EMT6 cells using Bap1_ gRNA _ II, and EMT6 Bap1 KO 1.

TABLE 11 EMT6 Bap1 KO1 sequences after EMT6 cell Bap1 Gene editing

Table 12 shows the results of editing the Bap1 gene of EMT6 cells using Bap1_ gRNA _ II, and EMT6 Bap1 KO 2.

TABLE 12 EMT6 cell Bap1 KO2 sequences after Bap1 Gene editing

The results of editing the Bap1 gene of EMT6 cells using Bap1_ gRNA _ II and EMT6 Bap1 KO3 are shown in table 13.

TABLE 13 EMT6 cell after Bap1 Gene editing EMT6 Bap1 KO3 sequences

The primer sequence required by the Bap1_ gRNA _ I edited cell by using a Sanger sequencing method is an upstream primer: 5 '(ACCTCCCACCCCTATTATTTT) -3' (SEQ ID NO: 39), downstream primer: 5 'GCAGCTAGGGAGGAAAGATAAC-3' (SEQ ID NO: 40); the primer sequences required for Bap1_ gRNA _ II edited cells by Sanger sequencing were the upstream primers: 5' GACTGGGTAAGACAAAGGAA-: 5 'GAGCAACACAACAAGAAAAGG-doped 3' (SEQ ID NO: 42).

In the invention, the tumor prevention or treatment is shown in that after the agent inhibits expression or loss of activity of a Bap1 gene or protein, in an organism, a cytokine and an immune cell have strong killing power on the tumor cell, inhibit growth of the tumor cell, promote apoptosis of the tumor cell, have the capacity of removing the tumor, and have long-term protection effect on the organism, thereby achieving the aim of resisting the tumor.

In the present invention, the improvement of the lethality to tumor cells preferably comprises the lethality of a cytokine or a combination of cytokines to tumor cells and the lethality of immune cells to tumor cells. The cytokine preferably comprises FasL, TNF α, IFN γ or IFN β; the cytokine combination preferably comprises two or more of FasL, TNF α, IFN γ and IFN β, more preferably an IFN γ + IFN β combination. Experiments show that the apoptosis level of the deleted Bap1 tumor cells is increased, which shows that the cytokines FasL, TNF alpha, IFN gamma, IFN beta, IFN gamma + IFN beta have higher lethality to the deleted Bap1 tumor cells compared with the contrast tumor cells, and the deletion of Bap1 enhances the sensitivity of the tumor to the cytokines. The loss of the Bap1 protein in tumor cells can generate more immune cells in mouse tumor microenvironment to specifically kill the tumor. The deletion of the tumor cell Bap1 protein can obviously improve the infiltration of immune cells of tumors in mice. The immune cells preferably comprise T cells. The T cells include CD8T cells. The Bap 1-deficient tumor cells are dependent on CD8T cell-mediated anti-tumor immune responses. Experiments show that the Bap 1-deficient tumor cells are more sensitive to CD8T cell killing. Deletion of Bap1 tumor cells depends on activation of a killing pathway of CD8T cells for removing the tumor cells in vivo by a Fas-FasL killing pathway, and does not depend on a killing pathway of perforin-granzyme.

In the present invention, said inhibition of tumor cell growth preferably comprises promoting apoptosis of tumor cells, inhibiting tumor cell tumorigenesis and tumor cell clearance by the immune system. Experiments show that the growth of the Bap 1-deleted tumor cells is remarkably inhibited by an immune system in vivo until the tumor cells are eliminated, and the survival time of mice is prolonged. Meanwhile, the deletion of the Bap1 protein in the tumor cells promotes the change of the phenotype of the tumor cells and the down-regulation of the expression of the PD-L1 gene, which indicates that the deletion of the Bap1 protein influences the expression of the tumor immune brake molecule PD-L1. The growth of the Bap 1-deleted tumor cells is remarkably inhibited by an immune system in vivo until the growth is eliminated, so that the survival time of the mice is prolonged.

The invention also provides application of the tumor cells lacking Bap1 in preparation of drugs for tumor immunotherapy. The deletion of the Bap1 protein in the tumor cells preferably enables the mice to have long-term immunological memory capacity for the tumor cells. Experiments show that the tumor cells can help an organism to resist the formation of the same tumor after being removed by an in vivo immune system, and the growth of the tumor cells from different cell lines is not influenced.

In the present invention, the use of the agent for inhibiting expression or activity of Bap1 in the prevention or treatment of tumors. The tumor cell lacking Bap1 is applied to tumor immunotherapy. The kind of the reagent and the reagent which edits the gene of the Bap1 protein through a gene editing technology so that the Bap1 protein is not expressed in the tumor cells any more; or an antibody that inactivates the Bap1 protein in the tumor cell by binding the Bap1 protein to the antibody; or a small molecule inhibitor which inhibits the Bap1 protein through a small molecule to make the Bap1 protein in the tumor cell inactive is the same, and details are not repeated herein. The preparation method of the Bap 1-deleted tumor cell is preferably obtained by a gene editing method. The sgRNA is used as a reagent for gene editing.

The experimental result shows that the deletion of the Bap1 protein in various tumor cells can obviously inhibit or eliminate the growth of the tumor cells in a mouse body with a normal immune system, and the invention has wide application prospect in anti-tumor immunotherapy.

The following will describe in detail the application of Bap1 provided by the present invention as a tumor therapeutic target in the preparation of drugs for preventing or treating tumors, but they should not be construed as limiting the scope of the present invention.

Example 1

Preparation of MC38-Cas9 cells

The plasmid with the code 68343 carrying the Cas9 gene and the anti-Blasicidin gene was extracted by endotoxin-free plasmid master drawing kit. Vector 68343 is transferred to MC38 cells by lentivirus infection, and cultured in a medium containing Blasiticidin to kill MC38 cells that are not transferred to 68343, and the MC38-Cas9 cells are obtained by continuous sterilization for about two weeks.

Preparation of BAP1 sgRNA

A primer for Bap1_ gRNA I gene editing is designed by a conventional method:

①Bap1_gRNA_1F:CACCTGGCAGCCGCTGGACAATA(SEQ ID NO:3)；

②Bap1_gRNA_1R:AAACTATTGTCCAGCGGCTGCCA(SEQ ID NO:4)；

wherein underlined bases are cleavage sites;

the primers for Bap1_ gRNA II gene editing were designed by a conventional method:

③Bap1_gRNA_2F：CCTTCATTCGGCTCAGCGT(SEQ ID NO:4)

④Bap1_gRNA_2R：ACGCTGAGCCGAATGAAGG(SEQ ID NO:5)。

1. synthesis of primers

①BAP1-gRNA-1F②BAP1-gRNA-1R

Operate according to the manual

1) Centrifuging before uncovering, wherein the conditions are 4000rpm and 60s;

2) Slowly open the tube cap and add the appropriate amount of dd | H as specified ₂ 0, diluting it to a concentration of 100 μm;

3) After covering the cover, fully shaking and mixing the mixture, and performing instant centrifugation at 4000rpm for 1min.

2. Phosphorylation and annealing of Single-stranded RNA (Single-stranded to double-stranded)

TABLE 14 preparation of the reaction systems

BAP1-gRNA-1Foligo1(100μm)	1μl
		BAP1-gRNA-1ROligo2(100μm)	1μl
T4DNAligaseBuffer(10×)(NEB)	1μl
		ddH 2 O	6.5μl
T4PNK(NEB)	0.5μl
		Total of	10μl

1) Water bath at 37 deg.C for 30min;

2) Boiling with microwave water (high fire for about 25 min), and naturally and slowly cooling the sample in step 1) to room temperature by putting the sample in 95 ℃ boiled water;

3) Taking 3. Mu.l + 597. Mu.l ddH of the liquid in 2) ₂ O (1.

3. Cloning of plasmid vectors

TABLE 15 preparation of cloning systems

67974 linearized vector (28.4 ng/. Mu.l Bpil cleavage product)	2μl
		Annealing of double strand (3) 1	1μl
T4DNAligaseBuffer(10×)(NEB)	1μl
		ddH 2 O	6μl
T4DNALigase	1μl
		Total of	11μl

1) After vortex mixing, centrifuging;

2) Water bath at 25 deg.C for 30min, and standing at room temperature.

3) Transformation of

(1) Taking competent cells;

(2) After melting into ice-water mixture for 3min on ice, adding 3. Mu.l of ligation product into 20. Mu.l of competence, and standing on ice for 30min;

(3) Heat shock is carried out for 30s at 42 ℃, and the mixture is placed on ice for 2min;

(4) Adding 500. Mu.l LB, placing into a shake flask, and shaking for 1h (37 ℃ 220 rpm);

(5) Adding 100-150 mul of bacteria into a culture plate containing AMP resistance, and shaking up for culture;

(6) Placing the plate in an incubator at 37 ℃ for overnight culture;

(7) Picking single clone in the morning of the next day, and culturing the single clone in LA culture medium containing AMP antibody;

(8) After 4-5 h, sending to an industrial sequencing machine;

(9) Every other clone cells were analyzed by SeqMan, and clones in which sgrnas were successfully ligated to the 67974 vector were selected.

3. Plasmid extraction, lentivirus packaging and lentivirus infection of the sgRNA obtained in the steps are carried out on a cell line expressed by Cas9, flow-sorting of BFP positive monoclonal cells (the 67974 vector contains BFP blue fluorescent protein), after cell amplification culture, the cells are subjected to biological sequencing by a Sanger method, and results are analyzed. The specific method comprises the following steps:

1. and (3) packaging the virus:

inoculating HEK293FT cells into a10 cm cell culture dish, and packaging lentivirus when the cell density reaches 70-80%; to 3mL of Opti-MEM were added 5.4. Mu.g of recombinant plasmid, 5.4. Mu.g of psPax2, 1.2. Mu.g of pMD2.G, and 12. Mu.L of PLUS (11514015, invitrogen), and incubated at room temperature for 5 minutes; to this mixture was added 36. Mu.L of Lipofectamine LTX (15338100, invitrogen), gently mixed and incubated at room temperature for 30 minutes; after the culture medium of HEK293FT is changed into 5mL of Opti-MEM, the incubated compound is added into a culture dish, the cell culture box is incubated for 4 to 8 hours, then the supernatant is discarded, and 10mL of complete culture medium is added; after 48 to 72 hours, the supernatant in the petri dish was aspirated by a10 mL syringe, filtered by a 0.45 μm filter (SLHV 033RB, millipore) into a centrifuge tube, and the filtered virus solution was stored at-80 ℃.

2. Viral infection:

taking 1X 10 ⁶ Putting each cell into a centrifuge tube, adding a proper amount of virus solution (MOI is less than 0.7) to resuspend the cells, and incubating for 30 minutes in an incubator; adding 3mL of culture medium into a 6-well plate, preheating in an incubator, and adding the cell virus mixed solution after incubation into the culture medium; and (5) carrying out cell passage after 48 hours.

3. Single cell sorting

And (3) performing virus packaging and virus infection on a cell line stably expressed by Cas9 by using the recombinant plasmid, wherein the method refers to the above, and performing single cell sorting after 5-7 days of virus infection.

To improve the survival of single cells, 100. Mu.L of 0.1% gelatin can be added to each well of a 96-well plate, incubated at room temperature for 1h, and washed 3 times with 100. Mu.L of DPBS per well (optional steps); adding 100 μ L of the medium containing 2% PS to a 96-well plate, sealing the mouth with a sealing membrane, and sorting at 4 deg.C or on ice for use.

Culturing cells infected by the virus for 5-7 days in a T25 culture flask, adding 1mL of 1 XDPBS for washing once, adding 500 mu L of 0.25% Trypsin for digestion for 1min, adding 1mL of a culture medium DMEM medium for termination of digestion, 350g,3min for centrifugation, discarding supernatant, resuspending FACS buffer solution, filtering by a 200-mesh filter screen into a sterile flow tube, and storing on ice; because the recombinant plasmid expresses Blue Fluorescent Protein (BFP) (Addgene # 67974), a sorting type flow cytometer is utilized to select BFP positive, the machine is used for sorting at 4 ℃, and after sorting is finished, 100 mu L of DMEM culture medium is supplemented into a 96-well plate and then the 96-well plate is placed into an incubator for culture. For fragile cells, the cells were replaced every 3 to 4 days, and monoclonal cells were observed in a 96-well plate for about 10 days.

Sequencing by Sanger method

By utilizing Oligo primer design software, primers are designed before and after the sgRNA targeted gene sequence, and it needs to be noted that the position of the primer is preferably more than 100bp away from a target point, and sequencing can cause inaccurate sequence results close to the primer. The designed primer ensures that the length of the PCR product is within 300-800 bp. ddH for primer ₂ O was dissolved to 10nM and stored at-20 ℃. An appropriate amount of monoclonal cells were taken from a 96-well plate, added to a 200. Mu.L PCR tube or a 96-well PCR plate, labeled with a sample, lysed by adding 20. Mu.L of DNA (added with 1% proteinase K solution, provided in the kit) (MACHEREY-NAGEL cat # 73200.500), placed in a PCR instrument, lysed at 25 ℃ for 3min, and lysed at 95 ℃ for 5min.

The PCR reaction system is shown in Table 16.

TABLE 16 PCR reaction System

Wherein the primer sequence edited by the Bap1_ gRNA _ I gene is an upstream primer:

5 '(ACCTCCCACCCCTATTATTTT) -3' (SEQ ID NO: 39), downstream primer:

5 'GCAGCTAGGGAGGAAAGATAAC-3' (SEQ ID NO: 40); the primer sequence edited by Bap1_ gRNA _ II is an upstream primer: 5 'GACTGGGTAAGACAAAGGAA-3' (SEQ ID NO: 41), downstream primer:

5'-GAGCAACACAACAGAAAAGG-3'(SEQ ID NO:42)。

the PCR conditions are shown in Table 17.

TABLE 17 PCR reaction conditions

The PCR product was electrophoresed on a 1.2% agarose gel, and a DNA fragment of a target size was recovered from the gel.

The DNA fragment was cloned into pMD19-T vector (6013, takara) in the reaction system shown in Table 18, to form a vector containing pMD19-T of the DNA fragment.

TABLE 18 preparation of cloning System

DNA fragment	2.25μL
		pMD19-T	0.25μL
SolutionI	2.5μL
		16℃	30min
4℃	hold

mu.L of competent cells (CD 501, all-gold) were thawed on ice to an ice-water mixture state for about 2min, and 16. Mu.L of competent cells were added to 3. Mu.L of pMD19-T vector ligated to the DNA fragment to be detected.

The conditions of the competence reactions are shown in Table 19.

TABLE 19 conditions of competence

Adding 10-20 flat coated glass beads (product code B529319-0025) into LA solid culture plate, adding 100 μ L or all of the bacteria into a 6 cm culture dish, shaking, coating, shaking, culturing at 37 deg.C in a thermostat, and standing overnight (note: the surface of LA solid culture medium is preferably in dry state after shaking); 0.5-1 mL LA liquid culture medium is added into a 1.5mL centrifuge tube, a single clone is picked up by a10 mu L tip and added into the 1.5mL centrifuge tube, the single clone is amplified and cultured at 37 ℃ and 200rpm, and the universal primer on the pMD19-T vector is selected and sent to the company for sequencing.

Bap1_ gRNA _ I editing is utilized to carry out gene editing on Bap1 of the MC38 cell and the CT26 cell respectively to obtain the MC38 cell and the CT26 cell with the Bap1 knocked out, and the sequence change of the Bap1 gene of the knocked-out cell is specifically shown in tables 1-4.

Bap1 of MC38 cells, b16.F10 cells, 4T1 cells and EMT6 cells was subjected to gene editing using Bap1_ gRNA _ II editing to obtain Bap 1-knocked-out MC38 cells, b16.F10 cells, 4T1 cells and EMT6 cells, and the Bap1 gene sequence changes of the knocked-out cells are specifically shown in tables 5 to 13.

Example 2

Western-blot detection

1. Taking the prepared Bap 1-deleted MC38 tumor cells, discarding supernatant of adherent cells, washing with 1 × PBS, adding pancreatin to digest into single cells, adding complete culture medium to stop digestion, transferring to a centrifuge tube, carrying out 350g, centrifuging at 3min, and discarding supernatant. Adding 1 XPBS, re-suspending, washing, counting, taking 1X 10 ⁶ The cells were transferred to a 1.5mL centrifuge tube, 350g, and centrifuged at 3min to remove the supernatant, which was then placed on ice.

2. Cell lysis: preparation of RIPA lysatePreparing: taking out the RIPA (1 mL/tube) from refrigerator at-20 deg.C (Biyunyan, cat. No. P0013B; thermo Scientific, cat. No. 89900), thawing at room temperature, adding 10 μ L protease inhibitor (Yazyme, cat. No. CRF 101) into 1mL RIPA, and preparing for use; 5 × loadingbuffer preparation: taking out prepared 5 xSDS-PAGE protein loading buffer solution (500. Mu.L/tube) from 4 deg.C, adding 20. Mu.L 2-mercaptoethanol (Gibco product No. 21985023) at volume ratio of 5%, preparing to room temperature, storing for 1 month, storing for a long time, and placing in 4 deg.C refrigerator; 1X 10 in step 1 ⁶ Adding 80 μ L of RIPA pipette containing protease inhibitor into each cell, mixing, cracking on ice for 10min, shaking for 5s, repeating for 2 times, cracking for 30min, adding 20 μ L of 5 × loading buffer containing 2-mercaptoethanol, mixing, heating in 100 deg.C metal bath for 5min, and storing at-20 deg.C.

3. Preparing glue: ddH ₂ Cleaning a glass plate, placing the glass plate on a gel making frame in an aligned mode, inverting and drying the glass plate, taking out a PAGE gel rapid preparation kit (7.5%) (Yazyme, product number RG11 upgrading) from a refrigerator at 4 ℃, taking out an improved ammonium persulfate solution from-20 ℃ to melt at room temperature, and vibrating the improved ammonium persulfate solution for 10 seconds to accelerate melting and uniformly mixing the solution; separating gel is prepared by adding 4mL of reagent A and 4mL of reagent B into improved ammonium persulfate of 80 μ L, shaking for 5s, mixing, adding into glass plate, adding 2mL of ethanol, flattening, pouring out ethanol after 20min, and waiting for ethanol volatilization; concentrating gel into 2mL of reagent A, adding reagent B2 mL, adding modified ammonium persulfate 40 μ L, shaking for 5s, mixing, adding into a glass plate, inserting into a comb, coagulating for about 30min, adding into an electrophoresis tank, running two gels in the electrophoresis tank simultaneously, fixing and clamping the other side with a plastic plate, adding 1 xSDS-PAGE electrophoresis buffer solution into the electrophoresis tank, and ensuring that the liquid level between the two gels is higher than the outside.

4. Sample adding: the sample sequence was protein Marker (Yazyme, cat # WJ 101), control sample, experimental sample, up to 14 samples on a 1.5mm comb, loaded with 10. Mu.L pipette tips per well. The sample is added without adding cell fragments into the wells, the middle of the gel plate is filled with 1 xSDS-PAGE electrophoresis buffer, the concentrated gel is run at 80V constant pressure, the concentrated gel is run under the concentrated gel, the separation gel is run at 120V constant pressure, the bromophenol blue is run to the edge of the gel plate, and the process is stopped.

5. Film transfer: 100mL 10Adding 700mL ddH into the x film transfer solution ₂ And adding 200mL of methanol into O to prepare 1 Xof membrane transfer liquid. About 50mL of 1 × spin solution was added to one cassette, and 50mL of methanol was added to the other cassette. Cutting off concentrated glue, cutting off bromophenol blue, cutting a corner mark at the left upper corner of the glue, measuring the length and width of the glue, soaking the glue in 1 x of film transfer liquid, cutting two pieces of thick filter paper and the glue with the same length and width, placing the filter paper and the glue in 1 x of film transfer liquid, cutting the PVDF film and the glue with the same length and width, placing the filter paper and the glue in methanol for soaking and activating for 5min, placing the rotating frame with the anode below (transparent), the cathode above (black), sequentially aligning plastic cotton, filter paper and the PVDF film on the transparent surface, placing the glue (the corner is positioned at the upper right), filter paper and plastic cotton, keeping the wet glue film in the attention process, pouring 1 x of film transfer liquid to keep the wet state but not having bubbles, placing the glue film in a film transfer groove after clamping, placing the glue in a blank position in an ice bath, and rotating the glue at 330V for 1.5h. And (3) making the adhesive surface of the PVDF film face upwards (the front surface), cutting a corner mark at the upper left corner of the film, and cutting the film according to the size of a target strip.

6. And (3) sealing: the PVDF membrane was blocked right side up for 2h with a 5% (TBST as solvent) skimmed Milk powder (full name Difco TMSkim Milk, company BD, cat # 232100) shaker at room temperature.

7. Antibody staining: 5% (TBST) skim milk powder, 1: bap1 antibody (CST, cat No. 13271S) was formulated 2000, 1: beta-tublin antibody (CST, cat No. 86298S) was formulated at 2000. Shaking overnight at 4 ℃.

8. Wash away non-specific binding-antibody: wash 3 times with TBST for 10 minutes each.

9. Incubation of secondary antibody: 5% (TBST) skim milk powder, anti-rabbit secondary antibody (CST cat # 7074S), anti-mouse secondary antibody (CST cat # 7076S), anti-goat secondary antibody (Abcam cat # ab 6741) were mixed according to 1: the secondary antibody was added at 2000 ratio and shaken at room temperature for 2h.

Washing off non-specifically bound secondary antibodies: TBST washing 3 times, each time 10 minutes.

11, imaging: mu.L of ECL Western blotting substrate (Thermo Scientific cat # 21232) was applied to the membrane and imaged using a Bio-rad chemiluminescent Imaging System (model ChemiDoc Imaging System).

The results are shown in FIG. 1. From the results, it was found that Bap 1-deficient tumors did not express Bap1 protein in the Bap 1-deficient tumors in the MC38 tumor cells of the control and the Bap 1-deficient tumors. Among the Bap 1-deleted and control MC38 tumor cells, bap 1-deleted MC38 tumor cells failed to normally express mRNA, and the mRNA expression level after the gene editing site was significantly reduced.

Example 3

The Bap 1-deficient CT26 cells (CT 26 Bap1 KO) and the wild-type CT26 cells (CT 26 Bap1 WT) prepared above were subcutaneously injected into BALB/c mice, respectively, and after one million cells were injected, the growth of CT26 tumors in the Bap 1-deficient group and the control group was observed. At the same time, the 4T1 cell lacking Bap1, the EMT6 cell lacking Bap1 and the wild-type cell thereof prepared above were injected subcutaneously into mice to investigate whether the Bap1 deletion could inhibit the growth of tumor cell lines.

The results are shown in FIGS. 2 to 4. The results showed that the growth of Bap 1-deficient CT26 tumor cells, bap 1-deficient EMT6 and Bap 1-deficient 4T1 cells was significantly inhibited and the survival time of this group of mice was prolonged.

Example 4

After one million cells were subcutaneously injected into C57BL6/J mice using the Bap 1-knocked-out MC38 cell (MC 38 Bap1 KO) and the wild-type MC38 cell (MC 38 Bap1 WT) prepared above, respectively, tumor growth was observed in the Bap 1-deleted group and the control group, to investigate whether the Bap1 deletion could inhibit the growth of the tumor cell line.

The results are shown in FIG. 5. The results indicate that Bap 1-deficient MC38 tumor cell growth was significantly inhibited and the survival time of this group of mice was prolonged.

Example 5

After injecting one million cells into C57BL6/J mice subcutaneously with Bap 1-knocked-out Bap 1-containing b16.F10 cells (b16. F10 Bap1 KO) and wild-type b16.F10 cells (b16. F10 Bap1 WT), respectively, prepared as described above, tumor growth was observed in the Bap 1-deleted group and the control group to investigate whether or not Bap1 deletion could inhibit tumor cell line growth.

The results are shown in FIG. 6. The results show that Bap 1-deficient b16.F10 tumor cell growth was significantly inhibited and the survival time of this group of mice was prolonged. The demonstration shows that the growth of the tumor cells lacking Bap1 is obviously inhibited or eliminated by the immune system in vivo, and the survival time of the mice is prolonged.

Example 6

When the Bap1 KO MC38 tumor cells in the mice are completely eliminated by the body, the wild type MC38 cells and the B16.F10 cells are injected into the mice subcutaneously again, and the growth of the MC38 cells is inhibited and eliminated, while the B16.F10 cells can form tumor and cannot be eliminated, which indicates that the immune memory is generated in the mice and only the same type of tumor antigen is recognized; in addition, CD8 was knocked out in mice that had acquired immune memory using anti-CD8 antibody (YTS 169.4, bioXcell) ⁺ After T cells, the same wild type tumor cells, whose growth was not inhibited, were injected again (see fig. 7). These results indicate that depletion of Bap1MC38 tumor cells can elicit systemic immune memory.

Example 7

The prepared Bap1 deletion MC38 tumor cells and wild type MC38 tumor cells are respectively cultured, 20ng/mLTNF alpha, 100ng/mLIFN gamma, 1000U/mLIFN beta and 1000U/mLIFN beta +100ng/mL IFN gamma are respectively adopted for stimulation during the culture period, after stimulation is carried out for 72 hours, the cells are subjected to flow staining by an ANNEXIN V-FITC/PI apoptosis detection kit, and the result shows that the apoptosis levels of the Bap1 deletion and wild type MC38 tumor cells in each group are detected.

The results are shown in FIG. 8. Compared with wild type MC38 tumor cells, the Bap1 deletion MC38 tumor cells have increased apoptosis level after IFN gamma, IFN beta and IFN beta + IFN gamma stimulation for 72 hours; and the apoptosis level of the Bap 1-deleted MC38 tumor cells is increased 72 hours after TNF alpha stimulation.

Example 8

Injecting Bap 1-knocked-out MC38 tumor cells subcutaneously into immunodeficient mice (e.g., rag2 lacking mature T and B cells) ^-/- Mouse, tcra ^-/- Mouse, batf3 ^-/- Mouse) or eliminating CD4 in the body of the mouse by injecting the antibody into the abdominal cavity ⁺ T cells and CD19 ⁺ B and CD8 ⁺ T cells, growth curves were plotted in which the tumor cells were not completely eliminated by the immune system due to the absence of T cells and DC cells.

The results are shown in FIG. 9. The Bap 1-deficient tumor cells can be smallThe main reason for murine clearance is dendritic cell-mediated CD8 ⁺ Specific killing effect of T lymphocyte on liver cancer cell.

Example 9

The method for killing the tumor by the CD8T lymphocyte is verified by knocking out B2m, tap genes and Fas genes in the tumor cell.

According to the gene knockout method described in example 1, B2M (B2M sgRNA1 CACCGTATACTCACGCCCACCCAC AC, SEQ ID NO: 43) and Bap1 in MC38 tumor cells are subjected to double gene knockout, a double gene knockout tumor cell (denoted as B2M Bap1 DKO) is obtained through screening and verification, a double gene knockout tumor cell (denoted as Tap Bap1 DKO) is obtained through screening and verification, a double gene knockout tumor cell (DKO) is obtained through screening and verification, and a double gene knockout tumor cell (denoted as Tap Bap1 DKO) is obtained through screening and verification, and a double gene knockout tumor cell (denoted as Fas sgRNA1 CCTCCACCCGAGAGAGAGAGAGAGAGTGTTAAGCTG, SEQ ID NO: 45) and a Bap1 gene in MC38 tumor cells are subjected to double gene knockout, and screening and verification is obtained through screening and verification.

The prepared three tumor cells with double gene knockout are respectively injected to a C57BL6/J mouse subcutaneously, and after one million cells are injected, the growth conditions of the tumors with three groups of double gene deletion are observed and counted.

The results are shown in FIG. 10. The tumor cell line with the knocked-out Bap1 and Tap1 and Bap1 and B2m genes is subcutaneously injected into a C57BL/6 mouse, and the growth of the tumor is found to be recovered, which indicates that the antigen presentation effect mediated by MHCI is very important for the body to generate immune response. The injection of Bap1 Fas DKO tumor cells into C57BL/6 showed that the deletion of elimination of Bap1 tumor cells depends on the Fas-FasL killing pathway and not on the perforin-granzyme killing pathway.

Example 10

Flow cytometry analysis of immune cells in tumor microenvironment

C57BL/6 mice subcutaneous MC38 tumor cells growth 6 ~ 14 days, separation of tumor. Tumors were dissociated into single cells using a tumor dissociation kit (Miltenyi Biotec, cat # 130-096-730), and red blood cells were removed using red blood cell lysate (Gibco, cat # A10492-01). Removal of tumor cells with a killed cell kit (Miltenyi Biotec, cat # 130-090-101)Dead cells of (2), using CD45 ⁺ Cell enrichment kit (Miltenyi Biotec, cat. No. 130-110-618) for enriching CD45 in tumor cells ⁺ The cells of (1), performing antibody staining. Tumor lymph nodes were ground with a syringe, cells were filtered through a 70 mesh screen, the screen and the ground dish were rinsed with Facs buffer, and antibody staining was performed after lysis of erythrocytes with ACK.

A comparison of the types of immune cells infiltrating inside a Bap1 protein-deficient tumor and a tumor expressing wild-type Bap1 protein is shown in FIG. 11. As shown in fig. 11, the ratios of CD 45-positive cells, CD 4-positive T cells, CD 8-positive T cells, and γ δ T cells were significantly increased, and the increase of CD 8-positive T cells was the greatest, in the Bap 1-deficient tumor, compared to the wild-type tumor cells. This indicates that deletion of the Bap1 protein enhances immune cell infiltration in the tumor microenvironment, especially with a significant increase in CD8 positive T cells.

Example 11

The deletion of the Bap1 protein in the tumor cells can enable the CD8 in the tumor microenvironment of the C57BL/6 mouse to generate more specific killing to the tumor ⁺ T cells

The above-prepared deletion Bap1MC38 tumor cells (MC 38 Bap1 KO) and wild-type MC38 tumor cells (MC 38 Bap1 WT) were expressed with OVA genes, respectively, to obtain deletion Bap1MC38 tumor cells (Bap 1 KO-MC 38-OVA) and wild-type MC38 tumor cells (Bap 1 WT-MC 38-OVA) expressing OVA proteins, respectively. OVA-expressing tumor cells were transplanted subcutaneously into C57BL/6 mice and into Batf3 mice, respectively ^-/- Whether deletion of Bap1 promotes mouse to produce anti-OVA-specific CD8 was analyzed subcutaneously using OVA Tetramer-SIINFEKL ⁺ T cells.

The results are shown in FIG. 12. The results are shown in Batf3 ^-/- In vivo recognition of SIINFEKL antigen-specific CD8 ⁺ The proportion of T cells is low, while in C57BL/6, in the deletion of Bap1 tumor cells, CD8 binding to the tumor epitope antigen SIINFEKL ⁺ The proportion of T cells increased significantly, indicating that the absence of Bap1 increased the presentation of tumor cell surface antigens.

Example 12

Respectively expressing the wild type of CD19Type tumor cells (MC 38-WT (CD 19)) and CD 19-expressing Bap 1-deficient tumor cells (MC 38-KO (CD 19)) were injected into Rag2 ^-/- Mice were injected subcutaneously, on the third day after tumor injection, tail vein with activated CAR-T cells and tumor volume changes were counted. The results showed that the MC38-KO (CD 19) group showed a significant decrease in tumor growth rate compared to the MC38-WT (CD 19) group (FIG. 13 a).

Simultaneously injecting OVA-expressing tumor cells into Rag2 ^-/- Subcutaneous isolation of CD8 from OT-I mice ⁺ T cells, on the third day after tumor injection, activated OT-1T cells were injected into the tail vein, and the change in tumor volume was counted. The results showed that the MC38-KO (OVA) group showed a significantly reduced tumor growth rate compared to the Bap1 WT (OVA) group (FIG. 13 b), indicating that the deletion of Bap1 tumor cells is more susceptible to CD8 ⁺ T cell killing.

Example 13

mRNA expression profiles for 33 cancers in the TCGA dataset were obtained from the website cBioPortal (http:// www. Cbioop ortal. Org /). All analyses and mapping were done using R software. The average mRNA expression levels of the genes GZMB and IFNG are used to measure T-cell cytotoxicity. CD8 in patients was calculated using the calculation method xCell (https:// github. Com/dv iraran/xCell) ⁺ Immune infiltration scores of T cells and immune cells such as activated cdcs were compared using the Wilcoxon test for immune score distribution between the two groups.

The results are shown in FIG. 14, wherein the Chinese names and English names of the cancers in FIG. 14 are shown in Table 20.

TABLE 20 Chinese and English name correspondence table for each cancer

Note: -Log ₁₀ (P value)>2 is the gray part, -Log in FIG. 14 ₁₀ (P value)<2 are black spots in fig. 14.

Analysis of human tumor samples from the TCGA database revealed that BAP1 expression levels in various tumors such as uveal melanoma (UVM), testicular germ cell carcinoma (TGCT), and squamous cell carcinoma of the lung (lucc) were negatively correlated with T cytotoxicity (fig. 14, a). Expression levels of BAP1 with T-cell toxicity, CD8 in LUSC and BRCA ⁺ T cell infiltration, infiltration of activated cdcs are inversely related. This suggests that BAP1 function is associated with T-cytotoxicity, CD8, in a variety of cancers ⁺ T cell infiltration, infiltration of activated cdcs.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Sequence listing

<110> affiliated first women and infants health care institute of Tongji university

Application of <120> Bap1 serving as tumor treatment target in preparation of drugs for preventing or treating tumors

<160> 42

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8530

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 1

gcctccgccc ccgccgttcg gccggcggaa gaccagcccc cgggttaggc tcgtcgtgtg 60

atgatgacgt tgtacgtccg gcgcgggcga gtgacgcggc gcggcccgtt gtctgtgcgg 120

ggctgagaag ccctaagggc ggtgggcgct cccggttggg ggcggcgcgg gtttagcagg 180

gcctggacat ggcgctgaga ggccgctccg cgggaagatg aataagggct ggctggagct 240

ggagagtgac ccaggtacgg aggggcctcg gcgggccggg ggctggggag gccggatggg 300

ccccggacgc acctgcatga caaatccctc ttcttgtcgt cccacccagg cctcttcacc 360

ctcctggtgg aagatttcgg taagaacccc gttacccacg accttcggtc cctggctggt 420

gtggatgtgg gggttggtcc ttgagttctc gcagcagagc ctgggactgc cctgccgacc 480

tctcctttcc tgatcgtagg tgtcaaaggg gtgcaagtgg aggagatcta tgaccttcag 540

agtaaatgcc aggggtgagt ggctgggacg cccccttacc tccggagggc cgagaaaggg 600

caggggaata gtaccccatt caagggaggc agtactagaa aacctgagct atataaaata 660

tcacataaga aagtgtcact ctttgtgggt gccctcttgg acttttcttt tcttctcagt 720

ctttcctcag tgtttctcct tagaaagctg tagccctcct tttaacccta agcactcgtg 780

gagtacagtt gagctgcctt tctggttttg cagccggaac cctccgttgc atagtgttgc 840

accttttttg taagtgtaca gtccattaat tacatcacca catgtgctgt gcctttaatc 900

accacacaac atttgtcctg accattagtg gcgctctcct ctagtcccaa tgcttgggag 960

gcagaggcag gcagatctct gagtttgagt ccaacctacg ctacttagtg agaccatgtg 1020

tcaacaaaac tgaacacagt tgtcctgtat tgattggtta gtgtgagaag gcctttttta 1080

ggtacctaaa ctcagagtct tgttttggaa atctatagaa tagaggcata gagaacctaa 1140

ctgcttccaa gggaaggaac tggtttggga gttcacgcac tatactcatt ttactaggac 1200

tggaggccga ggtccaccag tgagttggta cttaattctt catcaacgtt tttgtgcctt 1260

ttattgtgtc cctaccttgc tccatcctgg gccagcagtt ccagatttcc ttcttctctt 1320

gcctagacct catagaccga gtggggtttg agagcttcag gctcatactt gactgcctgt 1380

gataggcttc tggggtttga ggtctcagag ccatgttgga tacagtttgg ttaagagtga 1440

gggactcagt gcaagagcat ttcagtgcaa aggattaggg agagaaagaa ggggatgctg 1500

attgtcatct gcctcttgct tctctaggcc tgtgtatgga tttatcttcc tgttcaaatg 1560

gatcgaagag cgcaggtccc gccgcaaggt ttctacgttg gtggatgaca cgtctgtgat 1620

tgatgatgat attgtgaata acatgttctt tgctcaccag gtctgctgag ttctgcgctt 1680

gtttcgggcc aggatgctat ttttgtcttt gtttgtttct ggtattgtgt ggaaggtggc 1740

agtgggggag caggaagaag cgctagactg gaaccaagag aaactgttgc agaaaccctg 1800

tggcagacag acctaactct ttttcattag agggaatacc tctgtagttg gtggtgtttt 1860

agtacattct ccatgtccct agataggagg tattttagtt ggttcatgtt aaatgaataa 1920

agactgggta agacaaagga aactaaagga tgttgacatc tttcttttta gtcttcattc 1980

tcaataagtg tgggcatggg gatgtctggg gtaaagagta tatgaggtat atgagtgatt 2040

gtttttgatt tatagctgat tcccaactct tgtgccactc acgccttgct aagcgtgctt 2100

ctgaactgca gcaatgtgga tctggggccc acgctgagcc gaatgaagga tttcaccaaa 2160

ggcttcagtc ctgaggtacg ctgcagtacc ttagatcatg cttacagatg gctgggcaca 2220

tctgatcctc agagctattg gtaatgccac tgcatggtat ctggtatttt ttggtcattt 2280

ctttttcaaa tgtttactaa catctatttg actcataagt aatgtggaag gtagttgatt 2340

ttaggctttg ctgctaaatg agatgataga aggaaaagac ttaagtgatc tgggtcagac 2400

cttttctgtt gtgttgctcc ccagtagtca ctgatggctg tgcacggcca atatggccca 2460

tctctgtagg aaatcctaag caaggtctca tttgccacca ctgccctttc agaacggtca 2520

tctgtgctgc ttgggattcc tggaatgcct ctaagcctgc tttatggaac tcttccccta 2580

ttcagaggct cagctgagaa tctgtattta tgtagtcttc ttttattttt agagcaaagg 2640

atatgcaatt ggcaatgccc ctgaactggc caaggcacat aatagccatg ccaggtatgt 2700

gagagctatg gttgctgatg tggggtcggg gtggtggagg atgtctctga ttttgtcctt 2760

ttccaggcca gaaccacgtc accttcctga gaaacagaat ggcctcagtg cagtgcggac 2820

catggaggcg tttcattttg tcagctatgt gcctatcaca gggaggctct ttgaattgga 2880

tggattgaaa gtctacccaa ttgatcatgg taggccttct gaggaagggg cctgttgggt 2940

ttttcatgct tccttctgat tttctgggtc tcagggactt tagatccttg agatgtagga 3000

gcgtgagtgg ataccaggga catctaactc ttgccatggt ttcatcttat actgtttatg 3060

tgtctagctt gtagcttctc aaccacacga atctgttaac cctggcctac cccatctcag 3120

ggtttcccac ctgctgattc ctcatcttgg tcttccctag ggccctgggg agaggacgag 3180

gagtggacag ataaagctcg aagggtcatc atggagcgaa tcggtcttgc tactgcaggg 3240

taagaaccct tggttgtgtc cttctggagc tatgtcccct ttggggggaa agagagaagc 3300

gtaatgatct gtagattgta aggccccatg gtatctggca agatcaggct tggggtttgg 3360

gatttaaatt ttaggttgcc tgtggcctgc tctgggctgg gctggaggag ggacaagcct 3420

tgtgtgtgtg tgtgtgtgcg gggggcgtgt taagaagcac aggtgtgctg gcttacttcc 3480

tgacaagcct ctatcagagc tcatgggaag gtgtagctgg gtttcagatg tgtgtctggc 3540

tgctcgctgc ctattggagt ggagcctata cttagagcta cagatgtgac tgtgagagga 3600

gctctggcaa gacacttgcc tcagtcttaa cagcaggtca ggtctggggt gggaactcct 3660

ctcatggttg ccactgtgat tgcagggagc cctatcatga cattcgcttc aacctgatgg 3720

cagtggtgcc tgaccgcagg attaagtatg agaccaggct acatgtactg aaggtgaacc 3780

gacaaacagt cctggaggcc ctgcagcagg taagttgcct ggctttgcca acccagtgct 3840

ccctgtctct cctacatttt atttagtatc tgtctctaat tcccaaatca gtgtcttgta 3900

gattgaggct ttaactaacc atttctttcc tttgcttcct ttgtaagggt ggtagaactt 3960

aacttctaaa acgatgttgt ggcttggcct ttttattttc caataaataa ataaataaat 4020

aaataagcag gcaggcaggg tcaaggccct tagctatcta tggtggaaac ctggctctat 4080

ccttctctcc taagcttgag ttttgtttta agctgattag agtaacccag ccggagctga 4140

ttcagaccca caaatctcaa gagtcacagc tgcctgagga gagcaagcca gccagcagca 4200

agtcccccct tggactggag gcaggcagaa ccccagtggc ctctgagtgc actcagacag 4260

gtactagagg gacttgggca tcagccatcc atcgtagctt gacataggaa gcacaagcac 4320

ttcaagaagg tacttggtac aggggctcta gcaggaggcc tgaaatccca gtacctgaag 4380

ctttcccatt aaaacaggga gagtagagtg agattttcct aaaggatacg tgaaaaggac 4440

tatcatgacc ctagacccac acctctctgt attgggtggt ccatcccatc ccatacctcc 4500

cacccctatt attttatcta taggctgcct tcttgttgtg tcttgttttg ttttttgttt 4560

tttttttttt ttttcattgt gtgacttaga gcttacctgc ctatgctgtt tgctgtcttc 4620

actgggggaa acaactgtca caggattatg gactgtagct tttcttaagg acacagctga 4680

atgtcctatt tatactttgc cttgtctcag atggtgcaga ggaggtggct ggttcgtgcc 4740

cacaaactac aacccatagt cctcccagca aatgtaagct ggtggtgaag cctccaggga 4800

gcagcctcaa tggggttccc ccaaaccctg cccctattgt ccagcggctg ccagccttcc 4860

tagacaatca caattatgcc aaatccccta tgcaggtaag atggaagtac cctcaactga 4920

gaggccacaa tgttggttcc cagtgttatt ctttgactct ctgattggtt cttgatgacc 4980

aggctcctct agtactcata ggccccaaca gagcgcatgg ccttaaggtg gctaagagag 5040

ctgcttctct gacttttaag tccagttgcc tgccacacag ttgggtatac tccttggcac 5100

atgggaaagt ttctcctggt aactcaaaag tatgtggcaa ggcattctgt ttcttttaga 5160

agcacttcgc acagctaaga gcctagttat cttcctccct agctgcgata ccatgcctgg 5220

cttgggtgag ctctctcatt accgctcttg cctgccccag gaggaggaag acctggcggc 5280

aggagtgggt cgcagccgcg ttcccgtccg agcgccccag cagtactctg aagacgagga 5340

tgactacgag gatgaggacg aggacgtgca gaacaccaac cctgccatca ggtcagtcct 5400

gactcggaga cggtgtcaaa ctctgggtac ctcagatcct gttctcaata ttccaccctg 5460

cgtctgagag aacagtagac agaatgcagg ccctggagga ggctggcttg aggggctaac 5520

ccataagttt agggggaggt aaacatctta ccatgtatgt gtcagtacat tttgttgagg 5580

tgatctttca gcccgacctc aaagaattag ggtaggagaa gaggttggag agatgatttg 5640

ctgagtagga tggcactttt gttggaggat agagcactag aaggttagaa gtgagatagc 5700

tagagtagag gaggccacct gcctatactc tggcacttag gaagctcttg ctaagagatt 5760

gtttagacca agtgtaagag cttccatttg ggcttgggaa gaagatacta tatttgagcc 5820

attctggaca ctgctgggtg tggtcacctg gcccattccc tgtttttacc tcttattgga 5880

ccccacagat acaagcggaa ggggacaggg aagccaggat cgttgagcaa ttcttcagat 5940

gggcagctgt cagtgctgca gcccaacacc atcaatgtct taactgagaa gcttcaagag 6000

tctcagaaag acctttcagt tcctctgtcc atcaagacta gcagtggggc tgggagtcca 6060

gctgtggctg tgcccacaca ctcgcaacct tcacccaccc ctagcaatga gagcacggac 6120

acagcctctg agattggcag tgctttcaac tcacccttgc gctcgcccat ccgctcggcc 6180

aacccaacac ggccctctag ccctgtcacc tctcacatct ccaaggtgct ttttggagaa 6240

gatgacagcc tacttcgtgt tgactgcata cgctacaacc gtgctgtccg tgacctgggt 6300

cctgtcatta gcacgggcct gctgcacctt gctgaagatg gtgtactgag tcccctggca 6360

ctcacaggtg ggccttggac tccctcactg gtcacttggt gtacccaagg aggaggaggg 6420

aggtggcccg gtgactacag agtatcatgt actctgatgc acccttttat tcctctctag 6480

agggtgggaa gggttcctca ccttctacca gatcaagcca aggcagccag gggtccagtg 6540

gcctagagga gaaggaggtg gtggaagtca cagagagcag agacaagcct gggctgaaca 6600

ggtccagtga gcccttgagt ggagagaagt actcacccaa ggtgagtgtc tttcagcctt 6660

ctcctagcag gggaaggacc tgggccccta ctcccaggtt ttgggtactt gattggaatt 6720

ttggagtgaa agttggtggc taaagccagg gagctctttg ggattggatg gcattggtag 6780

ccccctggac tgtggctgtt cacccttgtt tctagttgct tcttagtaat ggagctttgg 6840

tgccagtcag gcccctaagg tatacaatgt tgggttgtgg caggagctgc tagcactgct 6900

aaagtgtgta gaagccgaga ttgcaaacta tgaggcctgt ctcaaggagg aggtggagaa 6960

aaggaagaag ttcaaggtgg gtgacccctc tactgcccaa ggacagctgc tctgagaaga 7020

tgggctggga tgccctcatg tgccttcttt ttcacagatt gatgaccagc gaaggaccca 7080

caactatgac gagtttatct gtaccttcat atccatgctg gctcaggaag gtgaggaggt 7140

gcctactatg tcttaattgt cctaccctct tgagggtcat gtacctcaaa ctcctccccc 7200

tccctccccc aagacttcac ctttggccga tgagactcaa gctcagggag ggctgtgaga 7260

gcctgggaga cagccaccta ctaaggagtt tcctgcttta cacaggaatg ctggccaacc 7320

tagtggaaca gaacatctca gtgcgccggc gccaaggggt cagcattggg cggcttcaca 7380

agcagcggaa gcctgaccgg cggaaacgct ctcgccccta caaggccaaa cgccagtgag 7440

aacctctggc cctgactctg cagcctctct tgccgcaagg ccctcatcag ggcccttcac 7500

tgtccctctt ttccaagtat tactgagtag ttcaacgaga gcccaggtcc tgggagtggg 7560

agtgacatgt attctgcact gtgctctggg gtctggcagg gacaaggcag ctcctcaatg 7620

ctcaggaagc agcagctgga actggagggc atccaccatg gcctccacag ccatctgagg 7680

agcagcagga cctggccttt ctgcctgggc agcaggatgt acattctacc tattggagat 7740

gtttaggttt tgggcttttg tccatcttgc cactgtatta acatggcagc ttcctgactc 7800

tgctgtctct cccagcagct gtcattctgc tgggccaggt ctcttagaat acatcacagt 7860

cccagctgag aaacacacca ccactagcct gtcctcgttg ggaagaagct tggcctacac 7920

ttcattcctc tgggagagca ccaaactcag ggacctggct gctgagctgg aatgggcatg 7980

gggtatccta ataggatgta cagcctatca gggtcccacg gctatagtgg agacaagtgt 8040

ttgaactgtc ccagtggcat gcagactgtc ctgttagtga gtcagagcaa ggctctgggg 8100

ctctttgcct tcagtgttgt ggccctggcc atgggtctgc cttaggctcc taatctctgt 8160

ctctggggcc caggggagcc tcgacctagc ccctcagtat taccatgtct tctcttagga 8220

atatcagagg cagggctgct tgaatggagc tggtactatt caattctccc gactgtgcca 8280

gcttccttgt cctcttgcaa ggtactcagg gtagggacag ggttgagagg agttagaact 8340

tctgtatccc catagggctt ggtagtaagt acagcactgc ttcaaaatcc agcccccaaa 8400

agccctgtac cctctgctag atacaggcga tccaagcagg ccccttatct gtacatagtg 8460

actgtagggg acccctctag tttctgtaaa tattgaatca gtgagtgaat aaaaatgtgc 8520

taataaatga 8530

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggcagccgc tggacaata 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tattgtccag cggctgcca 19

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccttcattcg gctcagcgt 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acgctgagcc gaatgaagg 19

<210> 6

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggttccccc aaaccctgcc cctattgtcc agcggctgcc agcct 45

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gggttccccc aaaccctgcc ccagcggctg ccagcct 37

<210> 8

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gggttccccc aaaccctgcc cctatttgtc cagcggctgc cagcct 46

<210> 9

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgaactgcag caatgtggat ctgggccgaa tgaagg 36

<210> 11

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 12

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gggttccccc aaaccctgcc cctattgtcc agcggctgcc agcctt 46

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gggttccccc aaaccctgcc agcctt 26

<210> 14

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gggttccccc aaaccctgcc cctatttgtc cagcggctgc cagcctt 47

<210> 15

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gggttccccc aaaccctgcc cctattgtcc agcggctgcc agcctt 46

<210> 16

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gggttccccc aaaccctgcc agcctt 26

<210> 17

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 18

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tgaactgcag caatgtggat ctggggccca cgactgagcc gaatgaagg 49

<210> 19

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 20

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 21

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tgaactgcag caatgtgagc cgaatgaagg 30

<210> 22

<211> 94

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tttgatttat agctgattcc caactcttgt gccactcacg ccttgctaag cgtgcttctg 60

aactgcagca atgtggatct ggggcccacg ctga 94

<210> 23

<211> 90

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tttgatttat agctgattcc caactcttgt gccactcacg ccttgctaag cgtgcttctg 60

aactgcagca atgtggatct ggggcccaca 90

<210> 24

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 25

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 26

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 27

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tgaactgcag caatgtggat ctggggccca cgccgaatga agg 43

<210> 28

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 29

<211> 113

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

tgattgtttt tgatttatag ctgattccca actcttgtgc cactcacgcc ttgctaagcg 60

tgcttctgaa ctgcagcaat gtggatctgg ggcccacgct gagccgaatg aag 113

<210> 30

<211> 90

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

tgattgtttt tgatttatag ctgattccca actcttgtgc cactcacgcc ttgctaagcg 60

tgcttctgaa ctgcagcaat gtggatctgg 90

<210> 31

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tcgaatgaag 10

<210> 32

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 33

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tgaactgcag caatgtggat ctggggccca atgaagg 37

<210> 34

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 35

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tgaactgcag caatgtggat ctggggccca cgaatgaagg 40

<210> 36

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 37

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 38

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tgaactgcag caatgtggat ctggggcccc agaatgaagg 40

<210> 39

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

acctcccacc cctattattt t 21

<210> 40

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gcagctaggg aggaagataa c 21

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

gactgggtaa gacaaaggaa 20

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

gagcaacaca acagaaaagg 20

Claims (4)

1. Application of the colon cancer cell lacking Bap1 in preparing a medicament for immunotherapy of colon cancer.

2. The use of claim 1, wherein the Bap1 deficient colon cancer cells are dependent on a CD8T cell mediated anti-tumor immune response.

3. The use according to claim 1 or 2, wherein the agent for deleting expression of Bap1 is an agent that inhibits expression of a Bap1 gene;

the inhibition of the expression of the Bap1 gene is to adopt a gene editing mode to cause the Bap1 gene to generate base insertion mutation, base deletion mutation, non-synonymous base mutation or whole gene loss.

4. The use of claim 3, wherein the agent that inhibits the expression of the Bap1 gene comprises an RNA molecule that interferes with the Bap1 gene.

Images