CN113069547A - Application of Bap1 in preparation of drugs for preventing or treating tumors as tumor treatment target - Google Patents

Abstract

The invention provides application of Bap1 as a tumor treatment target in preparation of a medicine for preventing or treating tumors, and belongs to the technical field of tumor medicines. The deletion of the Bap1 protein in various tumor cells can enhance the anti-tumor immune function of an organism and obviously enhance the killing capability of various cell factors and immune cells to the tumor cells. Therefore, the invention provides the application of the reagent for inhibiting the Bap1 in preparing the medicine for tumor immunotherapy. Experiments prove that the tumor cells lacking the Bap1 protein grow or eliminate tumors in a mouse with a normal immune system, meanwhile, the tumor cells lacking the Bap1 rely on CD8T cell-mediated anti-tumor immune response and rely on tumor antigen presentation to kill the tumors, and in addition, the deletion of the Bap1 can also reduce the expression level of PD-L1, so that the Bap1 serving as a tumor treatment target has wide application prospects in anti-tumor immunotherapy.

Description

Application of Bap1 in preparation of drugs for preventing or treating tumors as tumor treatment target

Technical Field

The invention belongs to the technical field of tumor drugs, and particularly relates to application of Bap1 as a tumor treatment target in preparation of drugs for preventing or treating tumors.

Background

Brca 1-related protein 1(Brca1 associated protein 1), Bap1, is designated Bap1 in the human genome and is a member of the ubiquitin hydroxyl-terminal hydrolase family, whose essential function is to remove ubiquitination modifications of substrate proteins. The Bap1 protein is involved in the regulation of various cellular functions such as cell proliferation, cell differentiation, programmed cell death, DNA loss repair, and chromatin modification. Mutation of BAP1 gene occurs frequently in uveal melanoma, malignant mesothelioma and renal cell carcinoma, and most of the early studies suggest BAP1 as an anti-cancer gene. However, in recent years, it has been reported that BAP1 can promote the development of breast cancer through its deubiquitinating function.

Disclosure of Invention

In view of the above, the present invention aims to provide a new application of Bap1, namely an application of Bap1 as a tumor treatment target in preparing a drug for preventing or treating tumors.

The invention provides application of an agent for inhibiting expression or activity of Bap1 in preparation of a product with at least one function of the following (1) to (4);

(1) preventing or treating tumors;

(2) inhibiting tumor cell growth;

(3) increase the killing power to tumor cells;

(4) the survival time of tumor organisms is prolonged;

(5) increasing the presentation of tumor cell surface antigens.

Preferably, the increased lethality to tumor cells comprises lethality of a cytokine or combination of cytokines to tumor cells and lethality of immune cells to tumor cells.

Preferably, the cytokine comprises FasL, TNF α, IFN γ, or IFN β; the cytokine combination comprises two or more of FasL, TNF α, IFN γ, and IFN β;

the immune cells comprise T cells; the T cells include CD8T cells.

Preferably, the inhibition of tumor cell growth includes promoting apoptosis of tumor cells, inhibiting tumor cell tumorigenesis and tumor cell clearance by the immune system.

The invention also provides application of the tumor cells lacking Bap1 in preparation of drugs for tumor immunotherapy.

Preferably, the Bap 1-deficient tumor cells are dependent on CD8T cell-mediated anti-tumor immune responses.

Preferably, the agent that inhibits expression or activity of Bap1 includes an agent that inhibits expression of a Bap1 gene, inhibits expression of a Bap1 protein, or loses activity of a Bap1 protein.

Preferably, the inhibition of the expression of the Bap1 gene is achieved by gene editing, such that a base insertion mutation, a base deletion mutation, a non-synonymous base mutation or a whole gene loss occurs in the Bap1 gene.

Preferably, the agent that inhibits the expression of the Bap1 gene comprises an RNA molecule that interferes with the Bap1 gene.

Preferably, the agent for inhibiting expression of the Bap1 protein or losing activity of the Bap1 protein includes an antibody against the Bap1 protein or a small molecule inhibitor of the Bap1 protein.

Preferably, the tumor comprises one or more of uveal melanoma, testicular germ cell cancer, squamous cell carcinoma of lung, thyroid cancer, renal clear cell carcinoma, cutaneous melanoma, invasive breast cancer, brain low-grade glioma, prostate cancer, colon cancer, renal cancer and lung cancer.

The invention provides application of an agent for inhibiting expression or activity of Bap1 in preparation of a product with at least one function of the following (1) to (4); (1) preventing or treating tumors; (2) inhibiting tumor cell growth; (3) increasing killing power to tumor cells; (4) prolonging the survival time of tumor organism. The invention takes the Bap1 as a target point for tumor treatment, can enhance the anti-tumor immune function of an organism by knocking out or inhibiting the function of a Bap1 gene or protein, remarkably enhances the killing capacity of various cytokines and T cells to the tumor cells, inhibits the growth or the elimination of the tumor cells, promotes the apoptosis of the tumor cells and prolongs the survival time of the tumor organism, thereby remarkably enhancing the effect of the tumor immunotherapy by deleting the function of the Bap1, and taking the Bap1 protein as the target point for the tumor treatment has wide application prospect and extremely high medical value.

The invention provides application of a Bap 1-deficient tumor cell in preparation of a tumor immunotherapy drug. Experiments prove that the deletion of the Bap1 in the tumor cells can ensure that the mouse generates long-term immunological memory capacity for the tumor cells, so that the tumor cells with the deletion of the same Bap1 can be quickly eliminated by a mouse body, and the aim of tumor immunotherapy is fulfilled.

Meanwhile, the application provided by the invention has a treatment effect on various tumors. Experiments prove that the Bap1 gene is knocked out of various tumor cells such as melanoma, colon cancer, breast cancer, kidney cancer, lung cancer and the like, and the immunotherapy effect corresponding to tumors can be achieved.

Drawings

FIG. 1 shows the results of the detection of abnormal expression of Bap1 protein in MC38 tumor cells with gene editing;

FIG. 2 is a graph showing the growth of tumor cells which are suppressed until they disappear after injecting the tumor cells subcutaneously into normal BALB/c mice after knocking out the Bap1 protein in CT26 tumor cells, and a graph showing the survival of the mice;

FIG. 3 is a graph of tumor growth and mouse survival after subcutaneous injection of a deletion of Bap1 and wild-type 4T1 tumor cells in normal BALB/c mice;

FIG. 4 is a graph of growth of tumors and survival of mice following subcutaneous injection of a deletion of Bap1 and wild-type EMT6 tumor cells in normal BALB/c mice;

FIG. 5 is a graph showing the growth of a deletion of Bap1 and a wild-type MC38 tumor cell and the survival of a mouse after subcutaneous injection in a normal C57BL/6 mouse;

FIG. 6 is a graph of tumor growth and survival of mice following subcutaneous injection of Bap 1-deleted and wild-type B16.F10 tumor cells in normal C57BL/6 mice;

FIG. 7 shows that depletion of Bap1MC38 tumor cells can induce systemic immune memory, wherein A is the ability of wild type C57BL/6 mice to deplete Bap1 of MC38 cells for 54 days, while still clearing wild type MC38 cells; b is the memory killing of C57BL/6 mouse to tumor cell dependent on CD8⁺A T cell;

FIG. 8 is a statistical result of apoptosis rate after treatment of Bap 1-deleted MC38 tumor cells with cytokines TNF α, IFN γ, or IFN β;

FIG. 9 is a graph showing the growth of tumors injected subcutaneously into various immunodeficient mice after knocking out the Bap1 protein in the tumor cells;

FIG. 10 is a demonstration of MHCI-dependent antigen presentation of CD8T lymphocytes for killing tumors by knocking out B2m, Tap gene and Fas gene in tumor cells;

FIG. 11 is a graph comparing the infiltration of immune cells in tumors deficient in Bap1 protein and in tumors wild-type Bap1, the number of immune cells per gram of tumor sample is significantly increased in tumors deficient in Bap1 protein;

figure 12 is a CD8T cell in which loss of Bap1 protein in the tumor cell results in more tumor-specific killing in the tumor microenvironment of C57BL/6 mice;

FIG. 13 shows that the deletion of Bap1 tumor cells is more easily killed by T cells; wherein FIG. 13a is the results of a CAR-T cell in vivo killing assay; FIG. 13b shows the results of an in vivo OT-I T cell killing experiment;

FIG. 14 is a sample of TCGA database human tumor data for analyzing CD8 in patients⁺And scoring the immune infiltration of immune cells such as T cells and activated cDC.

Detailed Description

The invention provides application of an agent for inhibiting expression or activity of Bap1 in preparation of a product with at least one function of the following (1) to (4);

(1) preventing or treating tumors;

(2) inhibiting tumor cell growth;

(3) increase the killing power to tumor cells;

(4) the survival time of tumor organisms is prolonged;

(5) increasing the presentation of tumor cell surface antigens.

In the invention, the tumor comprises one or more of uveal melanoma, testicular germ cell cancer, squamous cell lung cancer, thyroid cancer, clear cell renal cancer, cutaneous melanoma, invasive breast cancer, brain low-grade glioma, prostate cancer, colon cancer, renal cancer and lung cancer.

In the present invention, the agent inhibiting expression or activity of Bap1 preferably includes an agent inhibiting expression of the Bap1 gene, inhibiting expression of the Bap1 protein, or losing the activity of the Bap1 protein. The agent for inhibiting the expression of the Bap1 protein or losing the activity of the Bap1 protein preferably comprises an antibody against the Bap1 protein or a small molecule inhibitor of the Bap1 protein. The inhibition of the expression of the Bap1 gene is preferably achieved by gene editing, such that the Bap1 gene (SEQ ID NO:1) has base insertion mutation, base deletion mutation, non-synonymous base mutation or whole gene loss. According to the invention, Cas9 and guide RNA (sgRNA) are delivered to the tumor cell, and the Bap1 gene in the tumor cell is targeted and edited, so that the Bap1 protein in the tumor cell cannot be normally expressed. The agent that inhibits the expression of the Bap1 gene preferably includes an RNA molecule that interferes with the Bap1 gene, more preferably a sgRNA. The sgRNA preferably includes two sets of gRNAs, wherein Bap1_ gRNA I includes Bap1_ gRNA _1F (TGGCAGCCGCTGGACAATA, SEQ ID NO:2) and Bap1_ gRNA _1R (tattgtccagcggctgcca, SEQ ID NO: 3); bap1_ gRNA II includes Bap1_ gRNA _2F (CCTTCATTCGGCTCAGCGT, SEQ ID NO:4) and Bap1_ gRNA _2R (ACGCTGAGCCGAATGAAGG, SEQ ID NO: 5). Gene editing was performed on a variety of tumor cells using two sets of grnas, and MC38 cell Bap1 gene editing results MC38 Bap1 KO1 using Bap1_ gRNA _ I editing were shown in table 1.

TABLE 1MC38 cell MC38 Bap1 KO1 sequences after Bap1 gene editing

Note: deleting the sequence, and thickening the sequence, namely inserting the sequence; -bp for deleted fragment size, + bp for inserted fragment size; initiation of mutation site: the distance from the 5' end of the nucleotide sequence of the Bap1 gene. The same applies below.

The result of gene editing of Bap1 of MC38 cells by Bap1_ gRNA _ I, MC38 Bap1 KO2, is shown in table 2.

TABLE 2 MC38 cell MC38 Bap1 KO2 sequences after Bap1 gene editing

Table 3 shows the results of editing the Bap1 gene of CT26 cells using Bap1_ gRNA _ I, CT26 Bap1 KO 2.

TABLE 3 CT26 cell after Bap1 Gene editing CT26 Bap1 KO1 sequence

Table 4 shows the results of editing the Bap1 gene of CT26 cells using Bap1_ gRNA _ I, CT26 Bap1 KO 2.

TABLE 4 CT26 cell after Bap1 Gene editing CT26 Bap1 KO2 sequence

The result of gene editing of Bap1 on MC38 cells using Bap1_ gRNA _ II, MC38 Bap1 KO3, is shown in table 5.

TABLE 5 MC38 cell MC38 Bap1 KO3 sequences after Bap1 gene editing

The result of gene editing of Bap1 of the b16.f10 cells using Bap1_ gRNA _ II, b16.f10 Bap1 KO1 is shown in table 6.

TABLE 6B 16F10 cell B16F10 Bap1 KO1 sequences after Bap1 gene editing

The result of gene editing of Bap1 of the b16.f10 cells using Bap1_ gRNA _ II, b16.f10 Bap1 KO2 is shown in table 7.

Table 7b 16.f10 cell bp 1 post gene editing b16.f10 bp 1 KO2 sequences

Table 8 shows the results of gene editing of Bap1 on 4T1 cells using Bap1_ gRNA _ II, b16.f10 Bap1 KO 1.

TABLE 84T 1 cell 4T1 Bap1 KO1 sequences after Bap1 gene editing

Table 9 shows the results of gene editing of Bap1 on 4T1 cells using Bap1_ gRNA _ II, b16.f10 Bap1 KO 2.

TABLE 94T 1 cells post Bap1 Gene editing 4T1 Bap1 KO2 sequences

Table 10 shows the results of gene editing of Bap1 on 4T1 cells using Bap1_ gRNA _ II, b16.f10 Bap1 KO 3.

TABLE 104T 1 cells post Bap1 Gene editing 4T1 Bap1 KO3 sequences

The results of gene editing of Bap1 of EMT6 cells using Bap1_ gRNA _ II, EMT6 Bap1 KO1, are shown in table 10.

TABLE 10 EMT6 cells EMT6 Bap1 KO1 sequences after Bap1 Gene editing

The results of gene editing of Bap1 of EMT6 cells using Bap1_ gRNA _ II, EMT6 Bap1 KO2, are shown in table 11.

TABLE 11 EMT6 cell after Bap1 Gene editing EMT6 Bap1 KO2 sequences

The results of gene editing of Bap1 of EMT6 cells using Bap1_ gRNA _ II, EMT6 Bap1 KO3, are shown in table 12.

TABLE 12 EMT6 cell after Bap1 Gene editing EMT6 Bap1 KO3 sequences

The primer sequence required by the Bap1_ gRNA _ I edited cell by the Sanger sequencing method is an upstream primer: 5'-ACCTCCCACCCCTATTATTTT-3' (SEQ ID NO:39), downstream primer: 5'-GCAGCTAGGGAGGAAGATAAC-3' (SEQ ID NO: 40); the primer sequences required for Bap1_ gRNA _ II edited cells using Sanger sequencing were the upstream primers: 5'-GACTGGGTAAGACAAAGGAA-3' (SEQ ID NO:41), downstream primer: 5'-GAGCAACACAACAGAAAAGG-3' (SEQ ID NO: 42).

In the invention, the tumor prevention or treatment is shown in that after the agent inhibits expression or loss of activity of a Bap1 gene or protein, in an organism, cytokines and immune cells have strong killing power on tumor cells, inhibit growth of the tumor cells, promote apoptosis of the tumor cells, have the capacity of removing tumors, and have long-term protection effect on the organism, thereby achieving the purpose of resisting tumors.

In the present invention, the improvement of the lethality to tumor cells preferably comprises the lethality of a cytokine or a combination of cytokines to tumor cells and the lethality of immune cells to tumor cells. The cytokine preferably comprises FasL, TNF α, IFN γ or IFN β; the cytokine combination preferably comprises two or more of FasL, TNF α, IFN γ and IFN β, more preferably an IFN γ + IFN β combination. Experiments show that the apoptosis level of the deletion Bap1 tumor cell is increased, which shows that the cytokines FasL, TNF alpha, IFN gamma, IFN beta, IFN gamma + IFN beta have higher lethality to the deletion Bap1 tumor cell compared with a control tumor cell, and the deletion of Bap1 enhances the sensitivity of the tumor to the cytokine. The loss of Bap1 protein in tumor cells can lead to the generation of more immune cells in the mouse tumor microenvironment that specifically kill the tumor. The deletion of the tumor cell Bap1 protein can obviously improve the infiltration of immune cells of tumors in mice. The immune cells preferably comprise T cells. The T cells include CD8T cells. The Bap 1-deficient tumor cells are dependent on CD8T cell-mediated anti-tumor immune responses. Experiments showed that the Bap 1-depleted tumor cells were more sensitive to killing by CD8T cells. Deletion of Bap1 tumor cells depends on the Fas-FasL killing pathway to activate the killing pathway of CD8T cells to clear tumor cells in vivo, and not on the perforin-granzyme killing pathway.

In the present invention, said inhibition of tumor cell growth preferably comprises promoting apoptosis of tumor cells, inhibiting tumorigenesis of tumor cells and elimination of tumor cells by the immune system. Experiments show that the growth of the Bap 1-deleted tumor cells is remarkably inhibited by an immune system in vivo until the tumor cells are eliminated, and the survival time of mice is prolonged. Meanwhile, the loss of the Bap1 protein in the tumor cells promotes the change of the phenotype of the tumor cells, and the expression of PD-L1 gene is reduced, thus suggesting that the loss of the Bap1 protein influences the expression of tumor immune brake molecule PD-L1. The growth of Bap 1-deficient tumor cells is significantly inhibited by the immune system in vivo until cleared, prolonging the survival time of mice.

The invention also provides application of the tumor cells lacking Bap1 in preparation of drugs for tumor immunotherapy. The deletion of the Bap1 protein in the preferred tumor cells can enable the mice to have long-term immunological memory capacity for the tumor cells. Experiments show that the tumor fine cells can help an organism to resist the formation of tumors of the same species after being cleared by an in vivo immune system, and the growth of tumor cells from different cell lines is not influenced.

In the present invention, the use of the agent for inhibiting expression or activity of Bap1 for the prevention or treatment of a tumor. The tumor cells lacking Bap1 are used in tumor immunotherapy. The reagent is a reagent which ensures that the gene of the Bap1 protein is edited by the gene editing technology so that the Bap1 protein is not expressed in the tumor cells any more; or an antibody that inactivates the Bap1 protein within tumor cells by binding the antibody to the Bap1 protein; or a small molecule inhibitor which inhibits the Bap1 protein through a small molecule to make the Bap1 protein in the tumor cell lose activity is the same, and the details are not repeated herein. The preparation method of the Bap 1-deleted tumor cell is preferably obtained by a gene editing method. The reagent adopted for gene editing is the sgRNA.

The experimental result shows that the deletion of the Bap1 protein in various tumor cells can obviously inhibit or eliminate the growth of the tumor cells in a mouse body with a normal immune system, and the invention has wide application prospect in anti-tumor immunotherapy.

The following examples are provided to illustrate the application of Bap1 provided by the present invention as a tumor therapeutic target in the preparation of drugs for preventing or treating tumors, but they should not be construed as limiting the scope of the present invention.

Example 1

Preparation of MC38-Cas9 cells

The plasmid with the number of 68343, which carries the Cas9 gene and the anti-Blasiticidin gene, was extracted by a large endotoxin-free plasmid kit. The vector 68343 is transferred to MC38 cells by lentivirus infection, and cultured in a culture medium containing Blasiticidin to kill MC38 cells which are not transferred to 68343, and the MC38-Cas9 cells can be obtained by continuous sterilization for about two weeks.

Preparation of BAP1 sgRNA

The primers for Bap1_ gRNA I gene editing were designed by a conventional method:

①Bap1_gRNA_1F:CACCTGGCAGCCGCTGGACAATA(SEQ ID NO:3)；

②Bap1_gRNA_1R:AAACTATTGTCCAGCGGCTGCCA(SEQ ID NO:4)；

wherein underlined bases are cleavage sites;

the primers for Bap1_ gRNA II gene editing were designed by a conventional method:

③Bap1_gRNA_2F：CCTTCATTCGGCTCAGCGT(SEQ ID NO:4)

④Bap1_gRNA_2R：ACGCTGAGCCGAATGAAGG(SEQ ID NO:5)。

1. synthesis of primers

①BAP1-gRNA-1F②BAP1-gRNA-1R

Operate according to the instructions of the workers

1) Centrifuging before uncovering, wherein the conditions are 4000rpm and 60 s;

2) slowly open the tube cap and add the appropriate amount of dd | H as specified₂0, diluting it to a concentration of 100 μm;

3) after covering the cover, fully shaking and mixing the mixture, and performing instantaneous centrifugation at 4000rpm for 1 min.

2. Phosphorylation and annealing of Single-stranded RNA (Single-stranded to double-stranded)

TABLE 13 preparation of the reaction System

BAP1-gRNA-1Foligo1(100μm)	1μl
		BAP1-gRNA-1ROligo2(100μm)	1μl
T4DNAligaseBuffer(10×)(NEB)	1μl
		ddH2O	6.5μl
T4PNK(NEB)	0.5μl
		Total of	10μl

1) Water bath at 37 deg.C for 30 min;

2) boiling with microwave water (high fire for 25min), and naturally and slowly cooling the sample in step 1) to room temperature by putting the sample in 95 deg.C boiling water;

3) taking 3 mu l +597 mu l ddH of the liquid in the step 2)₂O (1:200 dilution), mixing and centrifuging.

3. Cloning of plasmid vectors

TABLE 14 preparation of cloning systems

67974 linearized vector (28.4 ng/. mu.l Bpil cleavage product)	2μl
		Annealing double strand (3) 1:200 Diluent)	1μl
T4DNAligaseBuffer(10×)(NEB)	1μl
		ddH2O	6μl
T4DNALigase	1μl
		Total of	11μl

1) After vortex mixing, centrifuging;

2) water bath at 25 deg.C for 30min, and standing at room temperature.

3) Transformation of

(1) Taking competent cells;

(2) after melting into ice-water mixture for 3min on ice, adding 3ul of ligation product into 20 ul of competence, and standing on ice for 30 min;

(3) heat shock at 42 deg.C for 30s, and standing on ice for 2 min;

(4) adding 500. mu.l LB, placing into a shake flask, and shaking for 1h (37 ℃ 220 rpm);

(5) adding 100-150 mu l of bacteria into an AMP resistant culture plate, and shaking up for culture;

(6) placing the plate in an incubator at 37 ℃ for overnight culture;

(7) picking single clone in the morning of the next day, and culturing the single clone in LA culture medium containing AMP antibody;

(8) after 4-5 h, sending to an industrial sequencer;

(9) every other clone was analyzed by SeqMan and clones with sgRNA successfully ligated to 67974 vector were selected.

And thirdly, carrying out plasmid extraction, lentivirus packaging and lentivirus infection on the sgRNA obtained in the step to obtain a cell line expressed by Cas9, carrying out flow sorting on BFP positive monoclonal cells (the 67974 vector contains BFP blue fluorescent protein), carrying out cell amplification culture, and then carrying out industrial sequencing by using a Sanger method to analyze the result. The specific method comprises the following steps:

1. and (3) packaging the virus:

inoculating HEK293FT cells into a10 cm cell culture dish, and packaging lentivirus when the cell density reaches 70-80%; to 3mL of Opti-MEM were added 5.4. mu.g of recombinant plasmid, 5.4. mu.g of psPax2, 1.2. mu.g of pMD2.G, and 12. mu.L of PLUS (11514015, Invitrogen), and incubated at room temperature for 5 minutes; to this mixture was added 36. mu.L of Lipofectamine LTX (15338100, Invitrogen), mixed gently and incubated at room temperature for 30 minutes; after the culture medium of HEK293FT is replaced by 5mL of Opti-MEM, adding the incubated compound into a culture dish, incubating for 4-8 hours in a cell incubator, discarding the supernatant, and adding 10mL of complete culture medium; after 48 to 72 hours, the supernatant in the petri dish was aspirated by a10 mL syringe, filtered by a 0.45 μm filter (SLHV033RB, Millipore) into a centrifuge tube, and the filtered virus solution was stored at-80 ℃.

2. Viral infection:

take 1X 10⁶Putting each cell into a centrifuge tube, adding a proper amount of virus solution (MOI is less than 0.7) to resuspend the cells, and incubating for 30 minutes in an incubator; adding 3mL of culture medium into a 6-well plate, preheating in an incubator, and adding the cell virus mixed solution after incubation into the culture medium; and (5) carrying out cell passage after 48 hours.

3. Single cell sorting

And (3) performing virus packaging and virus infection on a cell line stably expressed by Cas9 by using the recombinant plasmid, wherein the method refers to the above, and performing single cell sorting 5-7 days after virus infection.

To improve the survival of single cells, 100. mu.L of 0.1% gelatin can be added to each well of a 96-well plate, incubated at room temperature for 1h, and washed 3 times with 100. mu.L of DPBS per well (optional steps); add 100. mu.L of 2% PS medium to a 96-well plate, seal the port with a sealing membrane, and sort on ice at 4 ℃ for use.

Culturing cells infected by the virus for 5-7 days in a T25 culture bottle, adding 1mL of 1 XDPBS for washing once, adding 500 mu L of 0.25% Trypsin for digestion for 1min, adding 1mL of a culture medium DMEM (DMEM) for terminating digestion, centrifuging for 350g and 3min, discarding supernatant, resuspending FACS (FACS) buffer solution, filtering by using a 200-mesh filter screen into a sterile flow tube, and storing on ice; because the recombinant plasmid expresses Blue Fluorescent Protein (BFP) (Addgene #67974), a sorting type flow cytometer is utilized to select BFP positive, the machine is used for sorting at 4 ℃, after sorting is finished, 100 mu L of DMEM culture medium is supplemented into a 96-well plate, and the 96-well plate is placed into an incubator for culture. For fragile cells, the liquid can be changed every 3-4 days, and monoclonal cells can be observed in a 96-well plate in about 10 days.

Sequencing by Sanger method

By utilizing Oligo primer design software, primers are designed before and after the sgRNA targeted gene sequence, and it is noted that the position of the primer is preferably more than 100bp away from a target point, and sequencing can cause inaccurate sequence results close to the primer. The primers were designed so that the length of the PCR product was 300. sup.Within-800 bp. ddH for primer₂O was dissolved to 10nM and stored at-20 ℃. A proper amount of monoclonal cells are taken from a 96-well plate, added into a 200 mu L PCR tube or a 96-well PCR plate, marked with a sample, added with 20 mu L DNA for lysis (added with 1% proteinase K solution provided in a kit) (MACHEREY-NAGEL cat # 73200.500), put into a PCR instrument, lysed for 3min at 25 ℃, and lysed for 5min at 95 ℃.

The PCR reaction system is shown in Table 15.

TABLE 15 PCR reaction System

Wherein the primer sequence edited by the Bap1_ gRNA _ I gene is an upstream primer:

5'-ACCTCCCACCCCTATTATTTT-3' (SEQ ID NO:39), downstream primer:

5'-GCAGCTAGGGAGGAAGATAAC-3' (SEQ ID NO: 40); the primer sequence edited by Bap1_ gRNA _ II is an upstream primer: 5'-GACTGGGTAAGACAAAGGAA-3' (SEQ ID NO:41), downstream primer:

5'-GAGCAACACAACAGAAAAGG-3'(SEQ ID NO:42)。

the PCR reaction conditions are shown in Table 16.

TABLE 16 PCR reaction conditions

The PCR product was electrophoresed on a 1.2% agarose gel, and a DNA fragment of the target size was recovered from the gel.

The DNA fragment was cloned into pMD19-T vector (6013, Takara) and the reaction system is shown in Table 17, resulting in a vector pMD19-T containing the DNA fragment.

TABLE 17 preparation of cloning systems

DNA fragment	2.25μL
		pMD19-T	0.25μL
SolutionI	2.5μL
		16℃	30min
4℃	hold

mu.L of competent cells (CD501, all-gold) were thawed on ice to ice-water mixture for about 2min, and 16. mu.L of competent cells were added to 3. mu.L of the pMD19-T vector ligated to the DNA fragment to be detected.

The conditions of the competence reactions are shown in Table 18.

TABLE 18 conditions of competence

Adding 10-20 flat coated glass beads (product code B529319-0025) into LA solid culture plate, adding 100 μ L or all of the bacteria into a 6 cm culture dish, shaking, coating, shaking, culturing at 37 deg.C in a thermostat, and standing overnight (note: the surface of LA solid culture medium is preferably in dry state after shaking); 0.5-1 mL LA liquid culture medium is added into a 1.5mL centrifuge tube, a single clone is picked up by a10 mu L tip and added into the 1.5mL centrifuge tube, the single clone is amplified and cultured at 37 ℃ and 200rpm, and the universal primer on a pMD19-T vector is selected and sent to the company for sequencing.

The Bap1 of MC38 cells and CT26 cells are subjected to gene editing by using Bap1_ gRNA _ I editing to obtain MC38 cells and CT26 cells of knocked-out Bap1, and the sequence change of the Bap1 genes of the knocked-out cells is specifically shown in tables 1-4.

The Bap1 genes of MC38 cells, B16.F10 cells, 4T1 cells and EMT6 cells are respectively edited by Bap1_ gRNA _ II to obtain MC38 cells, B16.F10 cells, 4T1 cells and EMT6 cells with knocked-out Bap1, and the sequence change of the Bap1 genes of the knocked-out cells is specifically shown in tables 5-13.

Example 2

Western-blot detection

1. Collecting the prepared MC38 tumor cells with Bap1 deletion, discarding supernatant of adherent cells, washing with 1 × PBS once, adding pancreatin to digest into single cells, adding complete culture medium to stop digestion, transferring to a centrifuge tube, centrifuging for 3min at 350g, and discarding supernatant. Adding 1 × PBS, re-suspending, washing, counting, taking 1 × 10⁶The cells were transferred to a 1.5mL centrifuge tube, centrifuged at 350g for 3min to remove the supernatant, and placed on ice.

2. Cell lysis: preparing RIPA lysate: taking out the RIPA (1 mL/tube) from refrigerator at-20 deg.C (Biyunyan, Cat. No. P0013B; Thermo Scientific, Cat. No. 89900), thawing at room temperature, adding 10 μ L protease inhibitor (Yazyme, Cat. No. CRF101) into 1mL RIPA, and preparing for use; 5 × loadingbuffer preparation: taking out prepared 5 xSDS-PAGE protein loading buffer solution (500. mu.L/tube) from 4 deg.C, adding 20. mu.L 2-mercaptoethanol (Gibco cat. No. 21985023) according to volume ratio of 5%, preparing room temperature, storing for 1 month, storing for a long time, and placing in 4 deg.C refrigerator; 1X 10 in step 1⁶Adding 80 μ L RIPA pipette containing protease inhibitor into each cell, mixing, performing lysis on ice for 10min, shaking for 5s, repeating for 2 times, performing lysis for 30min, adding 20 μ L5 × loading buffer containing 2-mercaptoethanol, shaking, mixing, heating in 100 deg.C metal bath for 5min, and storing at-20 deg.C.

3. Preparing glue: ddH₂O Wash glass plate, align and place on gel rack, invert to drain, and remove PAGE gel rapid preparation kit (7.5%) (Yazyme, cat # RG11 liter) from 4 deg.C refrigerator, and remove modifications from-20 deg.CMelting the type ammonium persulfate solution at room temperature, and shaking for 10s to accelerate melting and uniformly mixing when the type ammonium persulfate solution is quickly melted; the separation gel is prepared by adding 4mL of reagent A and 4mL of reagent B into 80 μ L of improved ammonium persulfate, shaking for 5s, mixing, adding into a glass plate, adding 2mL of ethanol, flattening, pouring out ethanol after about 20min, and waiting for the ethanol to volatilize; the concentrated glue is 2mL of reagent A, 2mL of reagent B, 40 mu L of improved ammonium persulfate, the mixture is shaken for 5s and mixed evenly, the mixture is added into a glass plate, a comb is inserted, the mixture is solidified for about 30min and then added into an electrophoresis tank, two pieces of glue can be simultaneously run in the electrophoresis tank, if one piece of glue is run, the other side is fixedly clamped by a plastic plate, 1 xSDS-PAGE electrophoresis buffer solution is added into the electrophoresis tank, and the liquid level between the two pieces of glue is ensured to be higher than the outside.

4. Sample adding: the sample adding sequence is protein Marker (Yazyme, cat number WJ101), the sample of the control group, the sample of the experimental group, and 14 samples at most on a 1.5mm comb, and the sample is added by 10 mu L of gun heads, and 10 mu L of sample is added in each hole. The sample is added without adding cell fragments into the wells, the middle of the gel plate is filled with 1 xSDS-PAGE electrophoresis buffer, the concentrated gel is run at 80V constant pressure, the concentrated gel is run under the concentrated gel, the separation gel is run at 120V constant pressure, the bromophenol blue is run to the edge of the gel plate, and the process is stopped.

5. Film transfer: 100mL of 10 × supernatant solution added with 700mL of ddH₂And adding 200mL of methanol into O to prepare 1 Xof membrane transfer liquid. About 50mL of 1 × spin solution was added to one cassette, and 50mL of methanol was added to the other cassette. Cutting off concentrated glue, cutting off bromophenol blue, cutting a corner mark at the left upper corner of the glue, measuring the length and width of the glue, soaking the glue in 1 multiplied film transfer liquid, cutting two pieces of thick filter paper and the glue with the same length and width, placing the filter paper and the glue with the same length and width in 1 multiplied film transfer liquid, soaking and activating the filter paper and the glue in methanol for 5min, placing the rotary frame with the anode below (transparent) and the cathode above (black), sequentially aligning plastic cotton, filter paper and PVDF film on the transparent surface, placing the glue (the corner is positioned at the upper right), filter paper and plastic cotton, keeping the wet glue film in the attention process, pouring 1 multiplied film transfer liquid to keep the wet glue film but not have bubbles, placing the glue film in a film transfer groove after clamping, placing the glue film in a blank position in an ice bath, 330V, and transferring the glue film for 1.5 h. One side of the PVDF film rubberizing faces upwards (the front side), a corner cut mark is arranged at the left upper corner of the film, and the film is cut according to the size of a target strip.

6. And (3) sealing: the PVDF membrane was blocked right side up for 2h with a 5% (TBST as solvent) skimmed Milk powder (full name Difco TMSkim Milk, company BD, cat # 232100) shaker at room temperature.

7. Antibody staining: 5% (TBST) skim milk powder, 1: bap1 antibody (CST, cat No. 13271S) formulated at 2000, 1: beta-tubulin antibody (CST, cat # 86298S) was formulated at 2000. Shaking overnight at 4 ℃.

8. Wash away non-specific binding-antibody: wash 3 times with TBST for 10 minutes each.

9. Incubation of secondary antibody: 5% (TBST) skim milk powder, anti-rabbit secondary antibody (CST cat # 7074S), anti-mouse secondary antibody (CST cat # 7076S), anti-goat secondary antibody (Abcam cat # ab6741) were mixed according to 1: the secondary antibody was added at 2000 ratio and shaken at room temperature for 2 h.

Washing off non-specifically bound secondary antibodies: TBST was washed 3 times for 10 minutes each.

11, imaging: mu.L of ECL Western blotting substrate (Thermo Scientific cat # 21232) was applied to the membrane and imaged using a Bio-rad chemiluminescent Imaging System (model ChemiDoc Imaging System).

The results are shown in FIG. 1. From the results, it was found that the expression of the Bap1 protein was absent in Bap 1-deficient tumors in Bap 1-deficient and control MC38 tumor cells. Among the pap 1-deleted and control MC38 tumor cells, the pap 1-deleted MC38 tumor cells failed to normally express mRNA, and the mRNA expression level after the gene editing site was significantly reduced.

Example 3

The Bap 1-deficient CT26 cells (CT26 Bap1 KO) and the wild-type CT26 cells (CT26 Bap1 WT) prepared above were subcutaneously injected into BALB/c mice, respectively, and after one million cells were injected, the growth of CT26 tumors in the Bap 1-deficient group and the control group was observed. Meanwhile, 4T1 cells lacking Bap1, EMT6 cells lacking Bap1 and wild-type cells thereof prepared above were injected subcutaneously to study whether the loss of Bap1 could inhibit the growth of tumor cell lines.

The results are shown in FIGS. 2 to 4. The results showed that CT26 tumor cells deleted for Bap1, EMT6 deleted for Bap1 and 4T1 cells deleted for Bap1 were significantly inhibited from growing and prolonged survival time in this group of mice.

Example 4

After injecting the prepared Bap 1-knocked-out MC38 cells (MC38 Bap1 KO) and wild-type MC38 cells (MC38 Bap1 WT) into C57BL6/J mice subcutaneously for one million cells, tumor growth of the Bap 1-deleted group and the control group was observed to investigate whether the Bap1 deletion can inhibit the growth of the tumor cell line.

The results are shown in FIG. 5. The results indicate that Bap 1-deficient MC38 tumor cell growth was significantly inhibited and the survival time of this group of mice was prolonged.

Example 5

After injecting one million cells into C57BL6/J mice subcutaneously with the Bap 1-knocked-out b16.f10 cells (b16.f10 Bap1 KO) and wild-type b16.f10 cells (b16.f10 Bap1 WT), respectively, prepared as described above, tumor growth of the Bap 1-deleted group and the control group was observed to investigate whether the Bap1 deletion could inhibit growth of the tumor cell line.

The results are shown in FIG. 6. The results show that Bap 1-deficient b16.f10 tumor cell growth was significantly inhibited and the survival time of this group of mice was prolonged. The result shows that the growth of the tumor cells lacking Bap1 is remarkably inhibited or eliminated by the immune system in vivo, and the survival time of the mice is prolonged.

Example 6

After the Bap1 KO MC38 tumor cells in the mice are completely eliminated by the body, the wild MC38 cells and the B16.F10 cells are injected into the mice subcutaneously respectively, and the MC38 cells are found to be inhibited in growth and eliminated, while the B16.F10 cells can form tumors and cannot be eliminated, which indicates that the immune memory is generated in the mice and only the tumor antigens of the same type are recognized; in addition, CD8 in mice with acquired immune memory was knocked out by anti-CD8 antibody (YTS169.4, BioXcell)⁺After T cells, the same wild type tumor cells were injected again, and their growth was not inhibited (see fig. 7). These results indicate that depletion of Bap1MC38 tumor cells can elicit systemic immune memory.

Example 7

The prepared Bap1 deletion MC38 tumor cells and wild type MC38 tumor cells are respectively cultured, 20ng/mL LTNF alpha, 100ng/mL LIFN gamma, 1000U/mL LIFN beta +100ng/mL IFN gamma are respectively adopted for stimulation during the culture period, after 72 hours of stimulation, the cells are subjected to flow staining by an ANNEXIN V-FITC/PI apoptosis detection kit, and the result shows that the Bap1 deletion and the wild type MC38 tumor cell apoptosis level in each group are detected.

The results are shown in FIG. 8. Compared with wild MC38 tumor cells, the Bap1 deletion MC38 tumor cells have increased apoptosis level of Bap1 deletion MC38 tumor cells 72 hours after stimulation of IFN gamma, IFN beta and IFN beta + IFN gamma; and the apoptosis level of the MC38 tumor cells with Bap1 deletion is increased after 72 hours of TNF alpha stimulation of the MC38 tumor cells with Bap1 deletion.

Example 8

Injecting the Bap 1-knocked-out MC38 tumor cell into immunodeficient mouse (such as Rag2 lacking mature T, B cell)^-/-Mouse, Tcra^-/-Mouse, Batf3^-/-Mouse) or eliminating CD4 in the mouse by injecting antibody into the abdominal cavity⁺T cells and CD19⁺B and CD8⁺T cells, a growth curve is plotted in which the tumor cells are not completely eliminated by the immune system due to the absence of T cells and DC cells.

The results are shown in FIG. 9. The main reason why the Bap 1-deleted tumor cells can be eliminated by mice is the CD8 mediated by dendritic cells⁺Specific killing effect of T lymphocyte on liver cancer cell.

Example 9

The pathway of killing tumor by CD8T lymphocyte was verified by knocking out B2m, Tap gene and Fas gene in tumor cells.

According to the gene knockout method described in example 1, B2m (B2m sgRNA1 CACCGTATACTCACGCCACCCAC, SEQ ID NO:43) and Bap1 in MC38 tumor cells are subjected to double gene knockout, a double-gene knockout tumor cell (denoted as B2M Bap1 DKO) is obtained through screening and verification, Tap (Tap sgRNA1 CACCCTAGGACTAGGGGTCCG CG, SEQ ID NO:44) and Bap1 in MC38 tumor cells are subjected to double gene knockout, a double-gene knockout tumor cell (denoted as Tap Bap1 DKO) is obtained through screening and verification, Fas gene (Fas sgRNA1 CACCCTCCGAGAGTTTAAAGCTG, SEQ ID NO:45) and Bap1 gene in MC38 tumor cells are subjected to double gene knockout, and a double-gene knockout tumor cell (denoted as Fas Bap1 DKO) is obtained through screening and verification.

The prepared three double-gene knocked-out tumor cells are respectively injected into a C57BL6/J mouse subcutaneously, and after one million cells are injected, the growth conditions of the tumors with three groups of double-gene deletion are observed and counted.

The results are shown in FIG. 10. When the tumor cell lines of the Bap1 and Tap1, Bap1 and B2m knockout genes are injected into C57BL/6 mice subcutaneously, the growth of the tumor is found to be recovered, which indicates that the MHCI-mediated antigen presentation effect is very important for the body to generate immune response. Bap1 Fas DKO tumor cells were injected into C57BL/6 and showed that depletion of Bap1 tumor cells was dependent on the Fas-FasL killing pathway and not on the perforin-granzyme killing pathway.

Example 10

Flow cytometry analysis of immune cells of tumor microenvironment

C57BL/6 mouse subcutaneous MC38 tumor cells grow for 6-14 days, and the tumor is separated. Tumors were dissociated into single cells using a tumor dissociation kit (Miltenyi Biotec Cat. No. 130-096-730), and red blood cells were removed using a red blood cell lysate (Gibco Cat. No. A10492-01). Dead cells were removed from tumor cells using a dead cell removal kit (Miltenyi Biotec Cat. No. 130-090-101) and CD45 was used⁺Cell enrichment kit (Miltenyi Biotec Cat. No. 130-⁺The cells of (1), performing antibody staining. Tumor lymph nodes were ground with a syringe, cells were filtered through a 70 mesh screen, the screen and the ground dish were rinsed with Facs buffer, and antibody staining was performed after lysis of erythrocytes with ACK.

A comparison of immune cell types infiltrated within tumors deficient in Bap1 protein and tumors expressed by wild-type Bap1 protein is shown in FIG. 11. As shown in fig. 11, the ratios of CD45 positive cells, CD4 positive T cells, CD8 positive T cells, and γ δ T cells were significantly increased in Bap 1-deficient tumors, and the increase of CD8 positive T cells was the greatest, compared to wild-type tumor cells. This indicates that loss of Bap1 protein enhances immune cell infiltration in the tumor microenvironment, especially with the increase in CD8 positive T cells being most pronounced.

Example 11

The deletion of the Bap1 protein in the tumor cells can generate more CD8 for specifically killing the tumor in the tumor microenvironment of the C57BL/6 mouse⁺T cells

The deleted Bap1MC38 tumor cell (MC38 Bap1 KO) and the wild type MC38 tumor cell (MC38 Bap1 WT) prepared in the above way are respectively used for expressing OVA genes, and the deleted Bap1MC38 tumor cell (Bap1 KO-MC38-OVA) and the wild type MC38 tumor cell (Bap1 WT-MC38-OVA) for expressing OVA proteins are respectively obtained. OVA-expressing tumor cells were transplanted subcutaneously into C57BL/6 mice and Batf3, respectively^-/-Whether deletion of Bap1 promoted the production of anti-OVA-specific CD8 in mice was analyzed subcutaneously using OVA Tetramer-SIINFEKL⁺T cells.

The results are shown in FIG. 12. The results are shown in Batf3^-/-In vivo recognition of SIINFEKL antigen-specific CD8⁺The proportion of T cells was low, whereas in C57BL/6, in the absence of Bap1 tumor cells, CD8 bound to the tumor epitope antigen SIINFEKL⁺The proportion of T cells increased significantly, indicating that the absence of Bap1 increased the presentation of antigen on the surface of tumor cells.

Example 12

Wild-type tumor cells expressing CD19 (MC38-WT (CD19)) and Bap 1-deficient tumor cells expressing CD19 (MC38-KO (CD19)) were injected into Rag2 respectively^-/-Mice were injected subcutaneously, on the third day after tumor injection, tail vein with activated CAR-T cells and tumor volume changes were counted. The results showed that the MC38-KO (CD19) group showed a significantly reduced tumor growth rate compared to the MC38-WT (CD19) group (FIG. 13 a).

Simultaneously injecting OVA-expressing tumor cells into Rag2^-/-Subcutaneous isolation of OT-I mice CD8⁺T cells, on the third day after tumor injection, activated OT-1T cells were injected into the tail vein, and the change of tumor volume was counted. The results showed that the MC38-KO (OVA) group showed a significantly reduced tumor growth rate compared to the Bap1 WT (OVA) group (FIG. 13b), indicating that the deletion of Bap1 tumor cells is more susceptible to CD8⁺T cell killing.

Example 13

mRNA expression profiling of 33 cancers in the TCGA dataset can be from the website cBIoPortal (http:// www.cbiop ortal. org /). All analyses and mapping were done using R software. The average mRNA expression levels of the genes GZMB and IFNG were used to measure T cell cytotoxicity. CD8 in patients was calculated using the calculation method xCell (https:// github. com/dv iraran/xCell)⁺Immune infiltration scores of T cells and activated cDC and the like immune cells were compared to the distribution of immune scores between the two groups using the Wilcoxon test.

The results are shown in FIG. 14, wherein the Chinese names and English names of the cancers in FIG. 14 are shown in Table 19.

TABLE 19 Chinese and English name correspondence table for each cancer

Note: -Log₁₀(P value)>2 is the grey dot section, -Log in FIG. 14₁₀(P value)<2 is a black dot portion in fig. 14.

Analysis of human tumor samples from the TCGA database revealed that expression levels of BAP1 in various tumors, such as uveal melanoma (UVM), testicular germ cell carcinoma (TGCT), and squamous cell carcinoma of the lung (lucc), were negatively correlated with T-cell toxicity (a in fig. 14). Expression levels of BAP1 in LUSC and BRCA, and T cell cytotoxicity, CD8⁺T cell infiltration, infiltration of activated cdcs are inversely related. This suggests that BAP1 function is associated with T cytotoxicity, CD8, in a variety of cancers⁺T cell infiltration, infiltration of activated cdcs.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be construed as the protection scope of the present invention.

Sequence listing

<110> affiliated first women and infants health care institute of Tongji university

Application of <120> Bap1 in preparation of drugs for preventing or treating tumors as tumor treatment target

<160> 42

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8530

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 1

gcctccgccc ccgccgttcg gccggcggaa gaccagcccc cgggttaggc tcgtcgtgtg 60

atgatgacgt tgtacgtccg gcgcgggcga gtgacgcggc gcggcccgtt gtctgtgcgg 120

ggctgagaag ccctaagggc ggtgggcgct cccggttggg ggcggcgcgg gtttagcagg 180

gcctggacat ggcgctgaga ggccgctccg cgggaagatg aataagggct ggctggagct 240

ggagagtgac ccaggtacgg aggggcctcg gcgggccggg ggctggggag gccggatggg 300

ccccggacgc acctgcatga caaatccctc ttcttgtcgt cccacccagg cctcttcacc 360

ctcctggtgg aagatttcgg taagaacccc gttacccacg accttcggtc cctggctggt 420

gtggatgtgg gggttggtcc ttgagttctc gcagcagagc ctgggactgc cctgccgacc 480

tctcctttcc tgatcgtagg tgtcaaaggg gtgcaagtgg aggagatcta tgaccttcag 540

agtaaatgcc aggggtgagt ggctgggacg cccccttacc tccggagggc cgagaaaggg 600

caggggaata gtaccccatt caagggaggc agtactagaa aacctgagct atataaaata 660

tcacataaga aagtgtcact ctttgtgggt gccctcttgg acttttcttt tcttctcagt 720

ctttcctcag tgtttctcct tagaaagctg tagccctcct tttaacccta agcactcgtg 780

gagtacagtt gagctgcctt tctggttttg cagccggaac cctccgttgc atagtgttgc 840

accttttttg taagtgtaca gtccattaat tacatcacca catgtgctgt gcctttaatc 900

accacacaac atttgtcctg accattagtg gcgctctcct ctagtcccaa tgcttgggag 960

gcagaggcag gcagatctct gagtttgagt ccaacctacg ctacttagtg agaccatgtg 1020

tcaacaaaac tgaacacagt tgtcctgtat tgattggtta gtgtgagaag gcctttttta 1080

ggtacctaaa ctcagagtct tgttttggaa atctatagaa tagaggcata gagaacctaa 1140

ctgcttccaa gggaaggaac tggtttggga gttcacgcac tatactcatt ttactaggac 1200

tggaggccga ggtccaccag tgagttggta cttaattctt catcaacgtt tttgtgcctt 1260

ttattgtgtc cctaccttgc tccatcctgg gccagcagtt ccagatttcc ttcttctctt 1320

gcctagacct catagaccga gtggggtttg agagcttcag gctcatactt gactgcctgt 1380

gataggcttc tggggtttga ggtctcagag ccatgttgga tacagtttgg ttaagagtga 1440

gggactcagt gcaagagcat ttcagtgcaa aggattaggg agagaaagaa ggggatgctg 1500

attgtcatct gcctcttgct tctctaggcc tgtgtatgga tttatcttcc tgttcaaatg 1560

gatcgaagag cgcaggtccc gccgcaaggt ttctacgttg gtggatgaca cgtctgtgat 1620

tgatgatgat attgtgaata acatgttctt tgctcaccag gtctgctgag ttctgcgctt 1680

gtttcgggcc aggatgctat ttttgtcttt gtttgtttct ggtattgtgt ggaaggtggc 1740

agtgggggag caggaagaag cgctagactg gaaccaagag aaactgttgc agaaaccctg 1800

tggcagacag acctaactct ttttcattag agggaatacc tctgtagttg gtggtgtttt 1860

agtacattct ccatgtccct agataggagg tattttagtt ggttcatgtt aaatgaataa 1920

agactgggta agacaaagga aactaaagga tgttgacatc tttcttttta gtcttcattc 1980

tcaataagtg tgggcatggg gatgtctggg gtaaagagta tatgaggtat atgagtgatt 2040

gtttttgatt tatagctgat tcccaactct tgtgccactc acgccttgct aagcgtgctt 2100

ctgaactgca gcaatgtgga tctggggccc acgctgagcc gaatgaagga tttcaccaaa 2160

ggcttcagtc ctgaggtacg ctgcagtacc ttagatcatg cttacagatg gctgggcaca 2220

tctgatcctc agagctattg gtaatgccac tgcatggtat ctggtatttt ttggtcattt 2280

ctttttcaaa tgtttactaa catctatttg actcataagt aatgtggaag gtagttgatt 2340

ttaggctttg ctgctaaatg agatgataga aggaaaagac ttaagtgatc tgggtcagac 2400

cttttctgtt gtgttgctcc ccagtagtca ctgatggctg tgcacggcca atatggccca 2460

tctctgtagg aaatcctaag caaggtctca tttgccacca ctgccctttc agaacggtca 2520

tctgtgctgc ttgggattcc tggaatgcct ctaagcctgc tttatggaac tcttccccta 2580

ttcagaggct cagctgagaa tctgtattta tgtagtcttc ttttattttt agagcaaagg 2640

atatgcaatt ggcaatgccc ctgaactggc caaggcacat aatagccatg ccaggtatgt 2700

gagagctatg gttgctgatg tggggtcggg gtggtggagg atgtctctga ttttgtcctt 2760

ttccaggcca gaaccacgtc accttcctga gaaacagaat ggcctcagtg cagtgcggac 2820

catggaggcg tttcattttg tcagctatgt gcctatcaca gggaggctct ttgaattgga 2880

tggattgaaa gtctacccaa ttgatcatgg taggccttct gaggaagggg cctgttgggt 2940

ttttcatgct tccttctgat tttctgggtc tcagggactt tagatccttg agatgtagga 3000

gcgtgagtgg ataccaggga catctaactc ttgccatggt ttcatcttat actgtttatg 3060

tgtctagctt gtagcttctc aaccacacga atctgttaac cctggcctac cccatctcag 3120

ggtttcccac ctgctgattc ctcatcttgg tcttccctag ggccctgggg agaggacgag 3180

gagtggacag ataaagctcg aagggtcatc atggagcgaa tcggtcttgc tactgcaggg 3240

taagaaccct tggttgtgtc cttctggagc tatgtcccct ttggggggaa agagagaagc 3300

gtaatgatct gtagattgta aggccccatg gtatctggca agatcaggct tggggtttgg 3360

gatttaaatt ttaggttgcc tgtggcctgc tctgggctgg gctggaggag ggacaagcct 3420

tgtgtgtgtg tgtgtgtgcg gggggcgtgt taagaagcac aggtgtgctg gcttacttcc 3480

tgacaagcct ctatcagagc tcatgggaag gtgtagctgg gtttcagatg tgtgtctggc 3540

tgctcgctgc ctattggagt ggagcctata cttagagcta cagatgtgac tgtgagagga 3600

gctctggcaa gacacttgcc tcagtcttaa cagcaggtca ggtctggggt gggaactcct 3660

ctcatggttg ccactgtgat tgcagggagc cctatcatga cattcgcttc aacctgatgg 3720

cagtggtgcc tgaccgcagg attaagtatg agaccaggct acatgtactg aaggtgaacc 3780

gacaaacagt cctggaggcc ctgcagcagg taagttgcct ggctttgcca acccagtgct 3840

ccctgtctct cctacatttt atttagtatc tgtctctaat tcccaaatca gtgtcttgta 3900

gattgaggct ttaactaacc atttctttcc tttgcttcct ttgtaagggt ggtagaactt 3960

aacttctaaa acgatgttgt ggcttggcct ttttattttc caataaataa ataaataaat 4020

aaataagcag gcaggcaggg tcaaggccct tagctatcta tggtggaaac ctggctctat 4080

ccttctctcc taagcttgag ttttgtttta agctgattag agtaacccag ccggagctga 4140

ttcagaccca caaatctcaa gagtcacagc tgcctgagga gagcaagcca gccagcagca 4200

agtcccccct tggactggag gcaggcagaa ccccagtggc ctctgagtgc actcagacag 4260

gtactagagg gacttgggca tcagccatcc atcgtagctt gacataggaa gcacaagcac 4320

ttcaagaagg tacttggtac aggggctcta gcaggaggcc tgaaatccca gtacctgaag 4380

ctttcccatt aaaacaggga gagtagagtg agattttcct aaaggatacg tgaaaaggac 4440

tatcatgacc ctagacccac acctctctgt attgggtggt ccatcccatc ccatacctcc 4500

cacccctatt attttatcta taggctgcct tcttgttgtg tcttgttttg ttttttgttt 4560

tttttttttt ttttcattgt gtgacttaga gcttacctgc ctatgctgtt tgctgtcttc 4620

actgggggaa acaactgtca caggattatg gactgtagct tttcttaagg acacagctga 4680

atgtcctatt tatactttgc cttgtctcag atggtgcaga ggaggtggct ggttcgtgcc 4740

cacaaactac aacccatagt cctcccagca aatgtaagct ggtggtgaag cctccaggga 4800

gcagcctcaa tggggttccc ccaaaccctg cccctattgt ccagcggctg ccagccttcc 4860

tagacaatca caattatgcc aaatccccta tgcaggtaag atggaagtac cctcaactga 4920

gaggccacaa tgttggttcc cagtgttatt ctttgactct ctgattggtt cttgatgacc 4980

aggctcctct agtactcata ggccccaaca gagcgcatgg ccttaaggtg gctaagagag 5040

ctgcttctct gacttttaag tccagttgcc tgccacacag ttgggtatac tccttggcac 5100

atgggaaagt ttctcctggt aactcaaaag tatgtggcaa ggcattctgt ttcttttaga 5160

agcacttcgc acagctaaga gcctagttat cttcctccct agctgcgata ccatgcctgg 5220

cttgggtgag ctctctcatt accgctcttg cctgccccag gaggaggaag acctggcggc 5280

aggagtgggt cgcagccgcg ttcccgtccg agcgccccag cagtactctg aagacgagga 5340

tgactacgag gatgaggacg aggacgtgca gaacaccaac cctgccatca ggtcagtcct 5400

gactcggaga cggtgtcaaa ctctgggtac ctcagatcct gttctcaata ttccaccctg 5460

cgtctgagag aacagtagac agaatgcagg ccctggagga ggctggcttg aggggctaac 5520

ccataagttt agggggaggt aaacatctta ccatgtatgt gtcagtacat tttgttgagg 5580

tgatctttca gcccgacctc aaagaattag ggtaggagaa gaggttggag agatgatttg 5640

ctgagtagga tggcactttt gttggaggat agagcactag aaggttagaa gtgagatagc 5700

tagagtagag gaggccacct gcctatactc tggcacttag gaagctcttg ctaagagatt 5760

gtttagacca agtgtaagag cttccatttg ggcttgggaa gaagatacta tatttgagcc 5820

attctggaca ctgctgggtg tggtcacctg gcccattccc tgtttttacc tcttattgga 5880

ccccacagat acaagcggaa ggggacaggg aagccaggat cgttgagcaa ttcttcagat 5940

gggcagctgt cagtgctgca gcccaacacc atcaatgtct taactgagaa gcttcaagag 6000

tctcagaaag acctttcagt tcctctgtcc atcaagacta gcagtggggc tgggagtcca 6060

gctgtggctg tgcccacaca ctcgcaacct tcacccaccc ctagcaatga gagcacggac 6120

acagcctctg agattggcag tgctttcaac tcacccttgc gctcgcccat ccgctcggcc 6180

aacccaacac ggccctctag ccctgtcacc tctcacatct ccaaggtgct ttttggagaa 6240

gatgacagcc tacttcgtgt tgactgcata cgctacaacc gtgctgtccg tgacctgggt 6300

cctgtcatta gcacgggcct gctgcacctt gctgaagatg gtgtactgag tcccctggca 6360

ctcacaggtg ggccttggac tccctcactg gtcacttggt gtacccaagg aggaggaggg 6420

aggtggcccg gtgactacag agtatcatgt actctgatgc acccttttat tcctctctag 6480

agggtgggaa gggttcctca ccttctacca gatcaagcca aggcagccag gggtccagtg 6540

gcctagagga gaaggaggtg gtggaagtca cagagagcag agacaagcct gggctgaaca 6600

ggtccagtga gcccttgagt ggagagaagt actcacccaa ggtgagtgtc tttcagcctt 6660

ctcctagcag gggaaggacc tgggccccta ctcccaggtt ttgggtactt gattggaatt 6720

ttggagtgaa agttggtggc taaagccagg gagctctttg ggattggatg gcattggtag 6780

ccccctggac tgtggctgtt cacccttgtt tctagttgct tcttagtaat ggagctttgg 6840

tgccagtcag gcccctaagg tatacaatgt tgggttgtgg caggagctgc tagcactgct 6900

aaagtgtgta gaagccgaga ttgcaaacta tgaggcctgt ctcaaggagg aggtggagaa 6960

aaggaagaag ttcaaggtgg gtgacccctc tactgcccaa ggacagctgc tctgagaaga 7020

tgggctggga tgccctcatg tgccttcttt ttcacagatt gatgaccagc gaaggaccca 7080

caactatgac gagtttatct gtaccttcat atccatgctg gctcaggaag gtgaggaggt 7140

gcctactatg tcttaattgt cctaccctct tgagggtcat gtacctcaaa ctcctccccc 7200

tccctccccc aagacttcac ctttggccga tgagactcaa gctcagggag ggctgtgaga 7260

gcctgggaga cagccaccta ctaaggagtt tcctgcttta cacaggaatg ctggccaacc 7320

tagtggaaca gaacatctca gtgcgccggc gccaaggggt cagcattggg cggcttcaca 7380

agcagcggaa gcctgaccgg cggaaacgct ctcgccccta caaggccaaa cgccagtgag 7440

aacctctggc cctgactctg cagcctctct tgccgcaagg ccctcatcag ggcccttcac 7500

tgtccctctt ttccaagtat tactgagtag ttcaacgaga gcccaggtcc tgggagtggg 7560

agtgacatgt attctgcact gtgctctggg gtctggcagg gacaaggcag ctcctcaatg 7620

ctcaggaagc agcagctgga actggagggc atccaccatg gcctccacag ccatctgagg 7680

agcagcagga cctggccttt ctgcctgggc agcaggatgt acattctacc tattggagat 7740

gtttaggttt tgggcttttg tccatcttgc cactgtatta acatggcagc ttcctgactc 7800

tgctgtctct cccagcagct gtcattctgc tgggccaggt ctcttagaat acatcacagt 7860

cccagctgag aaacacacca ccactagcct gtcctcgttg ggaagaagct tggcctacac 7920

ttcattcctc tgggagagca ccaaactcag ggacctggct gctgagctgg aatgggcatg 7980

gggtatccta ataggatgta cagcctatca gggtcccacg gctatagtgg agacaagtgt 8040

ttgaactgtc ccagtggcat gcagactgtc ctgttagtga gtcagagcaa ggctctgggg 8100

ctctttgcct tcagtgttgt ggccctggcc atgggtctgc cttaggctcc taatctctgt 8160

ctctggggcc caggggagcc tcgacctagc ccctcagtat taccatgtct tctcttagga 8220

atatcagagg cagggctgct tgaatggagc tggtactatt caattctccc gactgtgcca 8280

gcttccttgt cctcttgcaa ggtactcagg gtagggacag ggttgagagg agttagaact 8340

tctgtatccc catagggctt ggtagtaagt acagcactgc ttcaaaatcc agcccccaaa 8400

agccctgtac cctctgctag atacaggcga tccaagcagg ccccttatct gtacatagtg 8460

actgtagggg acccctctag tttctgtaaa tattgaatca gtgagtgaat aaaaatgtgc 8520

taataaatga 8530

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggcagccgc tggacaata 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tattgtccag cggctgcca 19

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccttcattcg gctcagcgt 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acgctgagcc gaatgaagg 19

<210> 6

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggttccccc aaaccctgcc cctattgtcc agcggctgcc agcct 45

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gggttccccc aaaccctgcc ccagcggctg ccagcct 37

<210> 8

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gggttccccc aaaccctgcc cctatttgtc cagcggctgc cagcct 46

<210> 9

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgaactgcag caatgtggat ctgggccgaa tgaagg 36

<210> 11

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 12

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gggttccccc aaaccctgcc cctattgtcc agcggctgcc agcctt 46

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gggttccccc aaaccctgcc agcctt 26

<210> 14

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gggttccccc aaaccctgcc cctatttgtc cagcggctgc cagcctt 47

<210> 15

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gggttccccc aaaccctgcc cctattgtcc agcggctgcc agcctt 46

<210> 16

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gggttccccc aaaccctgcc agcctt 26

<210> 17

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 18

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tgaactgcag caatgtggat ctggggccca cgactgagcc gaatgaagg 49

<210> 19

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 20

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 21

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tgaactgcag caatgtgagc cgaatgaagg 30

<210> 22

<211> 94

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tttgatttat agctgattcc caactcttgt gccactcacg ccttgctaag cgtgcttctg 60

aactgcagca atgtggatct ggggcccacg ctga 94

<210> 23

<211> 90

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tttgatttat agctgattcc caactcttgt gccactcacg ccttgctaag cgtgcttctg 60

aactgcagca atgtggatct ggggcccaca 90

<210> 24

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 25

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 26

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 27

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tgaactgcag caatgtggat ctggggccca cgccgaatga agg 43

<210> 28

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 29

<211> 113

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

tgattgtttt tgatttatag ctgattccca actcttgtgc cactcacgcc ttgctaagcg 60

tgcttctgaa ctgcagcaat gtggatctgg ggcccacgct gagccgaatg aag 113

<210> 30

<211> 90

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

tgattgtttt tgatttatag ctgattccca actcttgtgc cactcacgcc ttgctaagcg 60

tgcttctgaa ctgcagcaat gtggatctgg 90

<210> 31

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tcgaatgaag 10

<210> 32

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 33

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tgaactgcag caatgtggat ctggggccca atgaagg 37

<210> 34

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 35

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tgaactgcag caatgtggat ctggggccca cgaatgaagg 40

<210> 36

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tgaactgcag caatgtggat ctggggccga atgaagg 37

<210> 37

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

tgaactgcag caatgtggat ctggggccca cgctgagccg aatgaagg 48

<210> 38

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tgaactgcag caatgtggat ctggggcccc agaatgaagg 40

<210> 39

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

acctcccacc cctattattt t 21

<210> 40

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gcagctaggg aggaagataa c 21

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

gactgggtaa gacaaaggaa 20

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

gagcaacaca acagaaaagg 20

Claims (10)

1. Use of an agent that inhibits expression or activity of Bap1 for the preparation of a product having at least one of the following functions (1) to (4);

(1) preventing or treating tumors;

(2) inhibiting tumor cell growth;

(3) increase the killing power to tumor cells;

(4) the survival time of tumor organisms is prolonged;

(5) increasing the presentation of tumor cell surface antigens.

2. The use of claim 1, wherein the increased lethality to tumor cells comprises lethality of a cytokine or combination of cytokines to tumor cells and lethality of immune cells to tumor cells.

3. The use of claim 2, wherein the cytokine comprises FasL, TNF α, IFN γ, or IFN β; the cytokine combination comprises two or more of FasL, TNF α, IFN γ, and IFN β;

the immune cells comprise T cells; the T cells include CD8T cells.

4. The use of claim 1, wherein the inhibition of tumor cell growth comprises promoting apoptosis of tumor cells, inhibiting tumor cell tumorigenesis, and eliminating tumor cells by the immune system.

5. The application of the tumor cell lacking Bap1 in preparing the medicine for tumor immunotherapy.

6. The use of claim 5, wherein the Bap 1-deficient tumor cell is dependent on a CD8T cell-mediated anti-tumor immune response.

7. The use according to claims 1 to 6, wherein the agent that inhibits expression or activity of Bap1 comprises an agent that inhibits expression of Bap1 gene, expression of Bap1 protein or loss of Bap1 protein activity;

the inhibition of the expression of the Bap1 gene is realized by adopting a gene editing mode to cause the Bap1 gene to generate base insertion mutation, base deletion mutation, non-synonymous base mutation or whole gene loss.

8. The use of claim 7, wherein the agent that inhibits the expression of the Bap1 gene comprises an RNA molecule that interferes with the Bap1 gene.

9. The use according to claim 7, wherein the agent that inhibits the expression of the Bap1 protein or loses the activity of the Bap1 protein comprises a Bap1 protein antibody or a Bap1 protein small molecule inhibitor.

10. The use of any one of claims 1 to 6 and 8 to 9, wherein the tumour comprises one or more of uveal melanoma, testicular germ cell carcinoma, squamous carcinoma of the lung, thyroid carcinoma, clear cell carcinoma of the kidney, cutaneous melanoma, invasive breast carcinoma, brain low-grade glioma, prostate carcinoma, colon carcinoma, renal carcinoma, and lung carcinoma.

Images