CN113063835A - cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof - Google Patents
cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof Download PDFInfo
- Publication number
- CN113063835A CN113063835A CN202110297939.9A CN202110297939A CN113063835A CN 113063835 A CN113063835 A CN 113063835A CN 202110297939 A CN202110297939 A CN 202110297939A CN 113063835 A CN113063835 A CN 113063835A
- Authority
- CN
- China
- Prior art keywords
- cfdna
- dna
- probe
- metal probe
- metal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/62—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating the ionisation of gases, e.g. aerosols; by investigating electric discharges, e.g. emission of cathode
Abstract
The invention provides a metal probe and a method for detecting cfDNA based on ICP-MS. According to the invention, a compound containing rare earth metal is used for marking DNA to prepare a metal probe, base interaction and a sandwich model are used for marking free nucleic acid cfDNA of a specific sequence, and the marked target sequence quantifies rare earth metal ions on the metal probe through ICP-MS, so that indirect quantification of the target cfDNA is realized. The method can detect the specific fragment of the cfDNA extracted from the plasma or the effusion, greatly reduces the detection limit on the basis of the existing method, can accurately quantify the cfDNA to ng/L level, and has simpler and more efficient detection method and more accurate detection result.
Description
Technical Field
The invention belongs to the field of biotechnology. And more particularly, to a metal probe and an ICP-MS based method for detecting cfDNA thereof.
Background
Extracellular free nucleic acid (cfDNA) is a molecular marker of autoimmune diseases, which is crucial for the study of rheumatoid arthritis diseases. cfDNA is present in very low levels (200ug/L) in the plasma of organisms, but at significantly higher concentrations in the effusion of rheumatoid arthritis patients. The conventional biomarker detection methods at present include: PCR, fluorescent dye method, fluorescence spectroscopy, electrochemistry, and the like. The detection limit of the traditional method can only reach mg/L, but the accurate quantification of the detection limit level cannot be achieved in the practical application process. Therefore, samples are often detected only by enrichment or PCR treatment, for example, chinese patent application CN201910180935.5 discloses a method for detecting global methylation of cfDNA in plasma, which requires PCR amplification after carrying out enrichment methylation experiments, and then carries out subsequent detection. However, excessive pretreatment may cause a deviation in quantitative results. In conclusion, the development and research of more demanding analytical detection methods are one of the trends in the development of cfDNA quantification methods.
Therefore, it is highly desirable to provide an analysis method of cfDNA, which has simple pretreatment, simple and efficient detection method, and accurate result.
Disclosure of Invention
The invention aims to overcome the defects and shortcomings of the prior art and provides a metal probe and a method for detecting cfDNA based on ICP-MS. The metal probe can be used for detecting specific fragments of cfDNA extracted from plasma or effusion, and can be combined with ICP-MS detection with a large linear range to realize simultaneous detection of samples with large concentration difference and simultaneous detection of various nucleic acids to be detected, so that the method is simple and efficient, and the detection result is accurate.
The invention aims to provide a preparation method of a metal probe.
The above purpose of the invention is realized by the following technical scheme:
a metal probe, in the said metal probe DNA-SH at the end-SH with chelating agent connection, chelating agent chelate rare earth metal ion;
wherein the DNA sequence in the metal probe is 5'-CGGACAAACTTCTTGGCGTAAA-3'.
The invention utilizes the compound labeled DNA containing rare earth metal to prepare the metal probe, utilizes base interaction and a sandwich model to label the free nucleic acid (cfDNA) with a specific sequence, and has simple principle and convenient operation. And quantifying the metal by the marked target sequence through ICP-MS to realize indirect quantification of the cfDNA. The invention can also detect a plurality of nucleic acid fragments to be detected, and the nucleic acid fragments can be combined randomly as long as the corresponding characteristic fragments exist.
The preparation method of the metal probe comprises the following steps:
s1-1, reacting the DNA modified by sulfydryl with tris (2-chloroethyl) phosphate, and reducing a disulfide bond to obtain DNA-SH;
s1-2, adding a chelating agent DOTA for reaction to obtain a chelated DNA-DOTA solution;
s1-3, adding a rare earth metal ion solution, and carrying out chelation reaction with the chelated DNA-DOTA solution to obtain a metal probe;
the structure of the chelating agent DOTA is shown as the formula (I):
the chelating agent DOTA shown in the formula (I) is a bifunctional chelate, rare earth metal can form a stable complex in a polycyclic ring, and maleimide at the other end can react with DNA modified by sulfydryl.
Preferably, in step S1-3, the rare earth metal is terbium, lanthanum, cerium or gadolinium.
More preferably, in step S1-3, the rare earth metal is terbium.
Preferably, in the step S1-2, the molar ratio of the chelating agent DOTA to the DNA-SH is 10-20: 1.
More preferably, in step S1-2, the molar ratio of the chelating agent DOTA to DNA-SH is 20: 1.
preferably, in step S1-3, the molar ratio of the rare earth metal to the thiol-modified DNA is 30-40: 1.
More preferably, in step S1-3, the molar ratio of the rare earth metal to the thiol-modified DNA is 40: 1.
Preferably, the prepared metal probe is further purified by eluting through a column by using high performance liquid chromatography, and freeze-drying the product obtained after elution.
The invention also protects the application of the metal probe or the preparation method in detecting the cfDNA content.
A method for detecting cfDNA content comprises the following steps:
s2-1, adding cfDNA to be tested, a metal probe and a capture probe, and carrying out hybridization reaction to obtain a 'Sanming Zhi model';
s2-2, adding the sandwich model into a 96-well plate coated with streptomycin, fixing cfDNA, and washing;
s2-3, adding nitric acid, heating at 80-90 ℃, performing constant volume, performing ICP-MS detection, and determining the cfDNA content according to a standard curve;
wherein the DNA sequence in the capture probe is 5'-TTATGTGTCTGCCACTGGTGC-3'.
Inductively coupled plasma mass spectrometry (ICP-MS) is used as a trace multi-element analysis means, the advantages of ICP-MS can be fully utilized when the ICP-MS is detected by an element marking strategy, elements which do not exist in organisms, do not interfere with the detection of the ICP-MS and have high sensitivity are marked on the biomacromolecules, and the marked elements are detected by the ICP-MS, so that the qualitative and quantitative analysis of the biomacromolecules is realized. The method has the advantages that (1) the element labeling does not need the probe to have the characteristics of optics, electrochemistry and the like, and the labeled element can be directly detected by ICP-MS; (2) the content of rare earth elements in organisms is low, the matrix effect is small, and the interference factors are few; (3) the ICP-MS has low detection limit and high sensitivity; (4) and realizing multi-element labeling aiming at different fragment DNAs.
The invention uses the base matching of DNA, and the metal probe, the target DNA (cfDNA) and the capture probe marked by biotin carry out hybridization reaction according to a sandwich model. Capturing a product after the hybridization reaction by using streptomycin, realizing the fixation of cfDNA by reacting biotin with the streptomycin, washing off redundant metal probes, releasing rare earth metal ions in a nitric acid digestion mode, carrying out quantitative analysis on the rare earth metal ions by ICP-MS, and then quantifying the DNA by using the rare earth metal ions. The invention combines the ICP-MS analysis method and the cfDNA detection together through the metal probe, and can accurately quantify the concentration of the nucleic acid with a specific sequence. In addition, the invention does not need to process the sample too much, generally does not need nucleic acid amplification to detect, the time from sampling to detecting is shorter; in addition, the invention does not need to carry out quantification on the free nucleic acid of the specific sequence in the sample by a PCR amplification means, thereby reducing the influence of factors such as non-specific amplification, unavailable amplification product and the like caused by PCR amplification.
Preferably, the 3' end of the capture probe has a biotin label.
Preferably, in step S2-3, the concentration of the standard solution in the standard curve is in the range of 0.1 to 5.0 pmol.
The invention also protects the application of the detection method in cfDNA quantitative detection.
The detection method can also be used for liquid biopsy, compared with the traditional tissue biopsy, the traumatic property and the material drawing limitation exist, the technical method for detecting the biomarker molecules in the body fluid by the liquid biopsy is gradually popularized and applied as a new clinical examination technology, the method can realize multiple material drawing as a convenient and non-invasive cfDNA detection method, and a new method is provided for developing reliable and repeatable liquid biopsy detection.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a metal probe and a method for detecting cfDNA based on ICP-MS. The invention utilizes the compound labeled DNA containing rare earth metal to prepare the metal probe, and quantifies the metal on the metal probe through ICP-MS, thereby indirectly quantifying cfDNA. The method can detect the specific fragment of the cfDNA extracted from the plasma or the effusion, realizes the simultaneous detection of samples with larger concentration difference and the simultaneous detection of a plurality of nucleic acids to be detected by combining the ICP-MS detection with larger linear range, greatly reduces the detection limit on the basis of the existing method, can accurately quantify the cfDNA to ng/L level, and has the advantages of simple and efficient method and more accurate detection result.
Drawings
FIG. 1 is a LC-MS diagram of DNA-SH;
FIG. 2 is a LC-MS plot of DOTA-MMA-DNA;
FIG. 3 is a LC-MS diagram of a metal probe;
FIG. 4 is a chromatogram after purification of a metal probe according to the present invention;
FIG. 5 is a diagram of LC-MS after purification of a metal probe according to the present invention;
FIG. 6 is a view of a "sandwich model" of the present invention;
fig. 7 is a graph of the target cfDNA versus Tb concentration;
FIG. 8 is a graph showing the results of validation of the "sandwich model".
Detailed Description
The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. The reagents, methods and apparatus employed in the present invention are conventional in the art, unless otherwise indicated.
Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Nucleic acids used for the experiments were purchased from Biotechnology engineering (Shanghai) GmbH.
EXAMPLE 1 Synthesis of Metal Probe
1. Solution preparation:
(1) 5.3mg (10mmol) DOTA-MMA (cas: 1006711-90-5) was dissolved in 2mL NH4In OAC buffer (pH6.5), a 5M DOTA-MMA stock solution was prepared for use.
(2) 5.3mg (20mmol) of TbCl3A stock of 10M TbCl3 was prepared for use in 2mL NH4OAC buffer (pH 6.5).
(3) A stock solution of 3M tris (2-chloroethyl) phosphate (TCEP) was prepared for use by dissolving 3mg (6mmol) of tris (2-chloroethyl) phosphate (TCEP) in 2mL of NH4OAC buffer (pH 6.5).
2. Preparing a metal probe:
(1) Reduction of disulfide bonds of the sample: mu.L of thiol-modified DNA (100uM) was added to a 2mL sample tube, and then 1mL of TCEP stock solution was added thereto and reacted at 37 ℃ for 1 hour to obtain DNA-SH (Compound A), whose detection results are shown in FIG. 1.
(2) Reaction of maleimide with DNA thiol: to the above sample tube, 200. mu.L DOTA-MMA stock solution was added, and the reaction was carried out at 60 ℃ for 1 hour. DOTA-MMA-DNA (Compound B) was obtained, and the results of the detection are shown in FIG. 2.
(3) Chelating metal Tb in the ring: 200 uL of TbCl was added to the same sample tube3The stock solution (40-fold excess, 2umol) was reacted at 25 ℃ for 12 hours or more. The detection results of the obtained metal probe are shown in FIG. 3.
(4) Metal probes were prepared because excess Tb, DOTA-MMA or DOTA-MMA-Tb was present in the product. Purification of the product is therefore required. The purification method comprises eluting with high performance liquid chromatography column, lyophilizing the product after elution to obtain 100uM stock solution, and detecting the result as shown in FIGS. 4 and 5.
Wherein, the conditions of the high performance liquid chromatography are as follows: UV 260nm, Thermo Hypersil GOLD, 150X 4.6mm, 5um, flow rate of 0.8 ml/min. The mobile phase A is 0.01 percent formic acid solution, the PH value is adjusted to 4.0, and the mobile phase B is methanol; wherein, 0-2 minutes, 95% mobile phase A; 2-7 minutes, 95-70% mobile phase A; 7-9 minutes, 70-1% mobile phase A; 9-10 minutes, 1% -95% mobile phase A.
The results show that FIG. 1 is the molecular weight of the DNA material, demonstrating that the disulfide bond is reduced; FIG. 2 shows the mass spectrum result of DNA-DOTA, which proves that the obtained product is DNA-DOTA; FIG. 3 shows the molecular weight of DNA-DOTA-Tb, demonstrating that the resulting product is a metal probe. FIG. 4 is a purification diagram of a metal probe; FIG. 5 is a mass spectrometric analysis of the purified metal probe product to obtain two peaks, wherein the molecular weight of the product from the first peak is the molecular weight of the metal probe, indicating that the product from the first peak is the metal probe.
Example 2 Performance test experiments
1. Sandwich model
By using the base matching principle of DNA, the metal probe, the target DNA (cfDNA) and the capture probe marked by biotin carry out hybridization reaction according to a sandwich model. Then, the hybridization product is captured (biotin reacts with streptomycin) through a streptomycin-coated orifice plate to realize the fixation of the target cfDNA, excess metal probes are washed away, metal terbium (Tb) is released in a nitric acid digestion mode, Tb is quantified by ICP-MS, and DNA is quantified by Tb. The specific process is shown in fig. 6.
2. Base sequence design and modification of metal probe, capture probe and target cfDNA
Table 1 DNA sequences and modifications thereof
ICP-MS detection step
(1) First, 0, 0.5, 1, 2, 5pmol of the target cfDNA was added to a 200. mu.L PCR tube, then 15pmol of the metal probe and 10pmol of the capture probe were added in sequence, and finally buffer A10 XPBS, 0.1% Tween 20(tween 20)) was added to make the final volume 60. mu.L. Eight replicates were made for each sample. All PCR tubes were placed in a PCR apparatus to allow base hybridization of samples therein (temperature program 0-3min, 93 deg.C; 3-13min, 50 deg.C; 13-43min, 37 deg.C; 43-73min, 25 deg.C).
(2) And transferring the product after reaction to a streptomycin-coated pore plate, and incubating the product in the pore plate for 1 hour to ensure that the biotin and the streptomycin fully react. After completion of the reaction, the plate was washed five times with buffer B (10 XPBS, 0.1% tween 20, 0.1% BSA), and the plate was washed 5 times with buffer A, to wash away the unreacted metal probe.
(3) Adding 300 mu L of 50% (v/v) HNO into the pore plate3Heating at 90 deg.C for 1 hr to release metal. Finally, the product was transferred to a 2mL sample tube using 5% (v/v) HNO3The volume is up to 1 mL.
(4) And (3) detecting the amount of Tb contained in the sample by ICP-MS by using Bi as an internal standard (the chemical property of the Bi is similar to that of Tb and the sample solution does not contain Bi) to obtain a standard curve. The results are shown in FIG. 7.
Wherein, the ICP-MS detection conditions are as follows:
4. validation of methods
An excess of metal probe and capture probe were added to 1pmol of the target cfDNA and non-target cfDNA, respectively, and the experiment was repeated according to the ICP-MS detection procedure, and the results are shown in fig. 8.
Wherein the target DNA sequence:
GCACCAGTGGCAGACACATAATTACGCCAAGAAGTTTGTCCG；
sequence of non-target DNA:
GCACCAGTGGCAATCACATAATTACGCCAAGAAGTTTGTCCG (SEQ ID NO.5)。
as can be seen from the results of fig. 8, the method has a specific difference, has an effect of specifically recognizing cfDNA, and can exclude interference in actual samples.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<120> cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence
<400> 1
cggacaaact tcttggcgta aa 22
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
ttatgtgtct gccactggtg c 21
<210> 3
<211> 42
<212> DNA
<213> Artificial sequence
<400> 3
gcaccagtgg cagacacata attacgccaa gaagtttgtc cg 42
<210> 4
<211> 400
<212> DNA
<213> Artificial sequence
<400> 4
agagcaagac tccatctcaa aaaaaaaaaa aaagtttata aatttgtgtt gggcctcatt 60
caaagctgca ctgggccaca ggtcggacaa acttggcgta aaatattttt gggttgtcac 120
aattaactaa cggggaggtt gctgctggcc tccagtcggt ggaggccaag gatgctgcta 180
agcatcctgc aatgcacagg aaacaaccaa ttaaccccac agtgaagaat tatccagccc 240
ccaatcccag tgaccaagac tgaaaaaccc gggctgggag agacagtgct gccatcgatt 300
gcttatgtct gccactggtg cagacagggt ggtggtgatg cctgcaatcc taatcccacc 360
cggcagactg tcctgaatgt ataacccatc tcacctccca 400
<210> 5
<211> 42
<212> DNA
<213> Artificial sequence
<400> 5
gcaccagtgg caatcacata attacgccaa gaagtttgtc cg 42
Claims (10)
1. A metal probe is characterized in that-SH at the end of DNA-SH in the metal probe is connected with a chelating agent which chelates rare earth metal ions;
wherein the DNA sequence in the metal probe is 5'-CGGACAAACTTCTTGGCGTAAA-3'.
2. A method for preparing a metal probe according to claim 1, comprising the steps of:
s1-1, reacting the DNA modified by sulfydryl with tris (2-chloroethyl) phosphate, and reducing a disulfide bond to obtain DNA-SH;
s1-2, adding a chelating agent DOTA for reaction to obtain a chelated DNA-DOTA solution;
s1-3, adding a rare earth metal ion solution, and carrying out chelation reaction with the chelated DNA-DOTA solution to obtain a metal probe;
the structure of the chelating agent DOTA is shown as the formula (I):
3. the method according to claim 2, wherein in step S1-3, the rare earth metal is terbium, lanthanum, cerium, or gadolinium.
4. The method according to claim 2, wherein in step S1-2, the molar ratio of the chelating agent DOTA to the DNA-SH is 10 to 20: 1.
5. the method according to claim 2, wherein in step S1-3, the molar ratio of the rare earth metal to the thiol-modified DNA is 30 to 40: 1.
6. use of the metal probe of claim 1 or the preparation method of any one of claims 2 to 5 in detecting cfDNA content.
7. A method for detecting the content of cfDNA is characterized by comprising the following steps:
s2-1, adding cfDNA to be tested, the metal probe and the capture probe of claim 1, and performing hybridization capture reaction to obtain a sandwich model;
s2-2, adding the sandwich model into a 96-well plate coated with streptomycin for reaction, fixing cfDNA and washing;
s2-3, adding nitric acid, heating at 80-90 ℃, performing constant volume, performing ICP-MS detection, and determining the cfDNA content according to a standard curve;
wherein the DNA sequence in the capture probe is 5'-TTATGTGTCTGCCACTGGTGC-3'.
8. The detection method according to claim 7, wherein in step S2-3, the concentration of the standard solution in the standard curve is in the range of 0.1 to 5.0 pmol.
9. The detection method according to claim 7, wherein the capture probe has a biotin label at its 3' end.
10. Use of the detection method according to any one of claims 7-9 in cfDNA quantitative detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110297939.9A CN113063835B (en) | 2021-03-19 | 2021-03-19 | cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110297939.9A CN113063835B (en) | 2021-03-19 | 2021-03-19 | cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113063835A true CN113063835A (en) | 2021-07-02 |
| CN113063835B CN113063835B (en) | 2022-08-02 |
Family
ID=76562561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110297939.9A Active CN113063835B (en) | 2021-03-19 | 2021-03-19 | cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113063835B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113528627A (en) * | 2021-08-10 | 2021-10-22 | 浙江大学 | Method for detecting micro RNA based on catalytic hairpin assembly amplification and inductively coupled plasma mass spectrometry |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016020710A1 (en) * | 2014-08-07 | 2016-02-11 | Pharmassist Ltd | Method of determining pik3ca mutational status in a sample |
| CN107557448A (en) * | 2017-09-30 | 2018-01-09 | 西安交通大学 | A kind of plasma DNA methylates electrochemical detection method and kit |
| CN109828107A (en) * | 2019-01-16 | 2019-05-31 | 清华大学 | A kind of polyatom rubidium marking probe and the preparation method and application thereof |
| CN109825559A (en) * | 2019-03-11 | 2019-05-31 | 上海交通大学 | A kind of blood plasma cfDNA methylation detecting method of overall importance and application |
| CN111458496A (en) * | 2019-01-18 | 2020-07-28 | 清华大学 | Immune precise quantitative analysis method based on internal standard correction and special kit thereof |
| CN112342271A (en) * | 2020-10-20 | 2021-02-09 | 南通大学附属医院 | Method for quantitatively detecting content of free DNA (deoxyribonucleic acid) by isotope dilution mass spectrometry |
-
2021
- 2021-03-19 CN CN202110297939.9A patent/CN113063835B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016020710A1 (en) * | 2014-08-07 | 2016-02-11 | Pharmassist Ltd | Method of determining pik3ca mutational status in a sample |
| CN107557448A (en) * | 2017-09-30 | 2018-01-09 | 西安交通大学 | A kind of plasma DNA methylates electrochemical detection method and kit |
| CN109828107A (en) * | 2019-01-16 | 2019-05-31 | 清华大学 | A kind of polyatom rubidium marking probe and the preparation method and application thereof |
| CN111458496A (en) * | 2019-01-18 | 2020-07-28 | 清华大学 | Immune precise quantitative analysis method based on internal standard correction and special kit thereof |
| CN109825559A (en) * | 2019-03-11 | 2019-05-31 | 上海交通大学 | A kind of blood plasma cfDNA methylation detecting method of overall importance and application |
| CN112342271A (en) * | 2020-10-20 | 2021-02-09 | 南通大学附属医院 | Method for quantitatively detecting content of free DNA (deoxyribonucleic acid) by isotope dilution mass spectrometry |
Non-Patent Citations (2)
| Title |
|---|
| 方晓强: ""镧系金属/核苷酸配位聚合物的合成和性能研究"", 《中国优秀硕士学位论文全文数据库 工程科技I辑》 * |
| 秦少杰等: ""基于信号放大策略的超灵敏质谱新方法及其应用"", 《质谱学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113528627A (en) * | 2021-08-10 | 2021-10-22 | 浙江大学 | Method for detecting micro RNA based on catalytic hairpin assembly amplification and inductively coupled plasma mass spectrometry |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113063835B (en) | 2022-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105548109B (en) | A kind of fluorescent detection system and detection method of heavy metal cadmium | |
| CN108047060B (en) | Pyrene derivative fluorescent probe molecule for identifying and detecting formaldehyde and preparation method and application thereof | |
| CN103674935A (en) | Method for determining gibberellin based on hybridization chain-reaction signal amplification technology | |
| CN112961861B (en) | Metamitron aptamer, screening method and application of metamitron aptamer to metamitron detection | |
| CN113063835B (en) | cfDNA analysis method based on element labeling-inductively coupled plasma mass spectrometry detection strategy and application thereof | |
| CN110308289A (en) | Aminoglycoside antibiotics remains rapid fluorescence detection reagent and application simultaneously more | |
| Deng et al. | Elemental probe-based CRISPR/Cas12a biosensing for sensitive tobramycin detection | |
| CN109828107B (en) | Polyatomic element labeled probe and preparation method and application thereof | |
| EP1383920B1 (en) | Methods and kits useful for the simplification of complex peptide mixtures | |
| CN109207561B (en) | Transcription factor fluorescence detection method based on DNA-silver nanocluster allosteric probe | |
| CN107561045A (en) | A kind of fluorescence micro DNA detection method | |
| CN111239402B (en) | Mass spectrum immunoassay method for detecting disease marker and application | |
| CN108794369B (en) | Aldehyde group-containing chiral amine recognition probe and preparation method and application thereof | |
| CN111579796A (en) | High-throughput integrated phosphorylation proteomics detection method | |
| CN108218822B (en) | A kind of ratio type fluorescence probe detecting azanol and its synthetic method and application | |
| CN116004769A (en) | Kit for detecting miRNA Let-7a based on auxiliary action of magnetic beads and graphene oxide and application of kit | |
| CN114315784A (en) | Histidine-labeled fluorescent probe and preparation method and application thereof | |
| CN113267475A (en) | Method for fluorescence detection of cadmium ions by one-step quenching method | |
| KR101551925B1 (en) | Target-specific probe comprsing t7 bacteriophage and detecting for biomarker using the same | |
| CN113403690A (en) | DNA coding compound library drug molecule fishing method | |
| Chen et al. | Chemiluminescence flow sensor with immobilized reagent for the determination of pyrogallol based on potassium hexacyanoferrate (III) oxidation | |
| CN110118848A (en) | Phosphamidon class oligosaccharides non-reductive amination derivative reagent and its oligosaccharide derivatization method | |
| CN117990895A (en) | Fluorescence analysis method for detecting kanamycin content by using malachite green | |
| CN113495111A (en) | Method for representing binding affinity of aptamer and target molecule and application | |
| CN117491517A (en) | Detection method for site distribution and occupancy of cysteine coupled ADC based on isotope labeling and calculation method for DAR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |