CN113061624B - Method for knocking out Tim-3 gene to prolong survival of T cells in vivo - Google Patents
Method for knocking out Tim-3 gene to prolong survival of T cells in vivo Download PDFInfo
- Publication number
- CN113061624B CN113061624B CN202110256435.2A CN202110256435A CN113061624B CN 113061624 B CN113061624 B CN 113061624B CN 202110256435 A CN202110256435 A CN 202110256435A CN 113061624 B CN113061624 B CN 113061624B
- Authority
- CN
- China
- Prior art keywords
- cells
- cell
- gene
- grna
- artificial sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application relates to a method for knocking out Tim-3 genes to prolong survival of T cells in vivo, in particular to a method for knocking out T cell TIM-3 genes, which comprises the steps of preparing a CRISPR-Cas9 protein and gRNA into an RNP complex, and then delivering the RNP complex into the T cells in an electroporation mode. The method can ensure the effect of high-efficiency gene knockout by utilizing CRISPR-Cas9 and sgRNA to specifically knockout the HAVCR2 gene in human T cells so as to prolong the survival time of the T cells.
Description
Technical Field
The application relates to the field of genetic engineering, in particular to a method for prolonging the survival time of T cells by gene editing, which can specifically be a method for prolonging the survival time of T cells by specifically knocking out HAVCR2 genes by utilizing CRISPR-Cas9 and sgRNA in human T cells.
Background
Adoptive immunotherapy (car-T therapy) of T cells, known collectively as chimeric antigen receptor T cell therapy technology, is an emerging therapeutic modality, exhibiting widespread use in the field of tumor immunotherapy. Mainly by in vitro transduction of an artificial gene for identifying cancer cells into human T cells, the human T cells have the capability of specifically killing tumor cells, and then are introduced into a patient to exert specific therapeutic effects. The car-T cell therapy uses human immune cells to combat tumors, has very high pertinence, has the advantage of less killing of non-therapeutic target cells than traditional chemotherapy, and is called "in vivo drug".
However, car-T therapy generally has the problems of faster T cell failure rate and short in vivo residence time, and the clinical application of the method of using immunosuppressive spot antibodies is used for enhancing the anti-tumor activity of T cells. The PD-1 and CTLA-4 antibodies are mainly used for targeting immune checkpoint gene knockout, so that the car-T curative effect is improved, the activity of T cells is activated by blocking the related immune checkpoint antibodies, and the in-vivo residence time is prolonged. However, the prior art has limited knowledge of other failure signaling pathways, and the use of antibodies to block immune checkpoints itself presents insufficient antibody binding and the risk of activating systemic immunity.
If T cell related target spot knockout can be realized through gene editing, the risk of activating system immunity existing in the presence of an antibody can be well avoided, so that the editing of the anti-tumor T cells has the definite advantage of target cells.
Disclosure of Invention
The application aims at: aiming at the problems of low efficiency and possible activation of immune risks of a system in the prior art in a gene knockout method using an antibody directed immune checkpoint, a method for prolonging the retention time of T cells by gene editing is provided.
In order to achieve the above purpose, the technical scheme adopted by the application is as follows:
a method of knocking out a T cell TIM-3 gene comprising preparing a CRISPR-Cas9 protein and a gRNA into an RNP complex, and then electroporating the RNP complex into a T cell.
The T cell TIM-3 gene knockout method can fully exert the technical advantages of CRISPR-Cas9 gene editing, ensure that Cas9 and gRNA are efficiently matched to exert the TIM-3 gene effect of T cell knockout, relieve immunosuppression, and ensure that the anti-tumor T cells have stronger activity and longer residence time. Because the electric transfer RNP complex is adopted for transportation, the effect of knocking out genes is good, the knocking-out rate is high, the obtained T cells have long retention time, and the problems of short service life and rapid failure of the T cells commonly existing in the car-T therapy in the prior art can be well solved. The RNP complex is a ribonucleoprotein complex and is formed by a specific CRISPR-Cas9 protein and gRNA.
Tim-3 (T cell immunoglobulin and mucin domain-3) Cat# Abt-P-422T cell immunoglobulin and mucin domain molecule 3 (T cell immunoglobulin and mucin domain-3, tim-3), also known as HAVCR2, is an immunomodulatory molecule, TIM family member, a type I transmembrane glycoprotein of 60kD molecular weight.
Further, the CRISPR-Cas9 protein is a Cas9 recombinant protein.
As a preferred embodiment of the application, the gRNA is an RNA fragment targeting the TIM-3 gene predicted by genomic data and bioinformatic algorithms and chemically synthesized and/or modified.
The selected artificial sequence gRNA has the characteristics of high binding force and low off-target rate, can obviously improve the gene knockout efficiency, can better realize accurate gene editing in T cells, and ensures that the T cell treatment product overcomes the defect of short residence time.
Further, the gRNA coding sequence comprises any one of SEQ ID NO.1 to SEQ ID NO. 37.
As a preferred embodiment of the application, the gRNA coding sequence comprises SEQ ID NO.1, SEQ ID NO.2 and/or SEQ ID NO. 3.
As a preferred scheme of the application, the gRNA coding sequence is shown as SEQ ID NO. 1. The specific sequence table is SEQ ID NO.1: CGCUCUGUAUUCCACUUCUG.
Alternatively, the gRNA coding sequence is shown as SEQ ID NO. 2. The specific sequence table is SEQ ID NO.2: CUAUGCAGGGUCCUCAGAAG.
Alternatively, the gRNA coding sequence is shown as SEQ ID NO. 3. The specific sequence table is SEQ ID NO.3: CUCAGAAGUGGAAUACAGAG. The screened gRNA has better matching effect with Cas9 protein, and the binding force and the knockout rate are better.
As a preferred embodiment of the application, the gRNA comprises a composition of gRNA sequences of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO. 3. That is, the gRNA includes simultaneously three gRNA sequences: the gRNA sequences of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. Efficient editing of T cells can be achieved by selecting three grnas. Through combining a plurality of gRNA sequences, mutual cooperation and synergy are realized, so that the gene knockout efficiency is greatly improved.
As a preferred embodiment of the application, the electroporation mode delivers RNP complexes to T cells with the following specific control parameters: an instrument Lonza4D (Lonza corporation) was used.
Preferably, the choice of the electrotransformation parameters is made by using Nucleofector EN-138 or Nucleofector EH-115. Parameters of electric transfer complex RNP
More preferably, instrument Lonza4D (Lonza Corp.) has an electrical conversion program code EH-115.
The RNP complex is delivered into T cells by electrotransformation, and the instrument is selected to perform electrotransformation according to program codes by activating the T cells and combining with a great amount of experimental researches of the inventor. The high-efficiency transfer can be realized by controlling certain electrotransfer parameters, the activity of the T cells after electrotransfer is good, the expansion is rapid, and the T cells obtained after the TIM-3 gene is finally knocked out have better therapeutic activity.
The application has high gene knockout efficiency in the electrotransformation mode, the gene knockout rate of T cell TIM3 after gene editing is more than or equal to 90 percent, and the experimental result of the T cell killing function shows that the killing capacity of the T cell is greatly improved, the expression of a cell failure marker after killing is low, and the residence time of the T cell is prolonged.
Therefore, preferably, the Cas9 recombinant protein and gRNA ratio range is 1:1.5 to 1:2.
preferably, the Cas9 recombinant protein is used in an amount of 10-20mg.
The method for knocking out the T cell TIM-3 gene is applied to treating tumor diseases.
In summary, due to the adoption of the technical scheme, the beneficial effects of the application are as follows:
1. the method can ensure the effect of high-efficiency gene knockout by utilizing CRISPR-Cas9 and sgRNA to specifically knockout the HAVCR2 gene in human T cells so as to prolong the survival time of the T cells.
2. According to the T cell gene editing method, the input of the RNP complex in a T cell electrotransformation mode is determined through a series of condition optimization, so that high-efficiency transformation is realized, a knockout system is very effective, the knockout efficiency of more than 90% can be realized, and compared with the prior art, the method is remarkably improved. While maintaining the cell activity and state, and the cells have good proliferation activity after electrotransformation.
3. According to the T cell gene editing method, the gRNA sequence is determined through testing, can be specifically combined with the HAVCR2 gene region, and has important significance for knocking out the T cell TIM3 gene through a CRISPR-Cas9 technology. Through optimization and adjustment, the T cell gene editing efficiency is higher, the off-target rate is lower, and better T cell activity is achieved. Finally, through a T cell function experiment, the HAVCR2 gene is determined to be knocked out, so that the T cell killing function can be enhanced, the T cell survival time can be prolonged, and the reliability of the gene knockout method is extremely high.
4. According to the gene editing method, sequences and combinations with high cutting activity can be determined through the gRNA sequences and combinations and by utilizing a plurality of gRNAs and the combinations thereof, so that better targeting effect is achieved, and accurate gene editing effect is achieved through targeted cutting.
5. According to the T cell gene editing method, cas9 protein and gRNA are used as editing tools, and after editing is completed, cas9 and gRNA can be completely degraded, so that the risk of activating system immunity is avoided.
5. The gene editing method of the application comprises the steps of determining a method for activating T cells (through OKT3+IL2) and a time point of electrotransformation (72 h after activation) in an electrotransformation T cell flow; in the electric transfer program, optimal electric transfer conditions are preferably determined by testing and optimizing electric transfer RNP concentration, electric transfer parameters and the like, so that high-efficiency electric transfer is realized, gene knockout efficiency is ensured, and off-target probability is reduced.
Description of the drawings:
FIG. 1 is a graph comparing the efficiency of Tim3 knockout by different methods.
FIG. 2 is a Tim3 gene knockout sequencing analysis.
FIG. 3 is a Sanger sequencing comparison of wild type (upper) and Tim3 knockout cells (lower).
FIG. 4 is a flow chart of cell phenotypes of wild-type and different knockout methods.
FIG. 5 is a comparison of killing effect of wild type and Tim3 knockout cells.
FIG. 6 is a comparison of apoptosis induction by wild-type and Tim3 knockout cell targets.
FIG. 7 is a comparison of the residence time of wild type and Tim3 knockout cells in mice.
Figure 8 is the effect of different RNP ratios on knockout efficiency.
FIG. 9 is the effect of different RNP concentrations on knockout efficiency.
Fig. 10 is an effect of the electrical transfer parameters on knockout efficiency.
Detailed Description
The present application will be described in detail below.
The present application will be further described in detail with reference to the following examples, in order to make the objects, technical solutions and advantages of the present application more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the application.
The reagent preparation method and corresponding experimental method applied in the following examples:
CRISPR-Cas9 protein is Cas9 recombinant protein purchased from NEB company, and has no specification and model Spy Cas9NLS,M0646T。
1. Reagent preparation
1.1. Complete medium
Prepared according to the proportion of DMEM culture medium to Fetal Bovine Serum (FBS) to green-streptomycin solution=89:10:1, 200mL of the mixture is prepared each time, 3mL of the mixture is placed in a culture dish with the diameter of 2cm, the culture dish is placed in an incubator for 1 to 2 days for bacterial detection, and the culture dish is used after the detection result is sterile.
Western Blot electrophoresis liquid formulation
5 x electrophoretic fluid: a one thousandth electronic balance weighed 15.1g of Tris (hydroxymethyl) aminomethane (Tris) powder, 94g of Glycine (Glycine) powder, 5g of Sodium Dodecyl Sulfate (SDS) powder in sequence, dissolved with 1000mL of ultrapure water, and stored in a dark place at a pH of 8.8,4-16 ℃. The gel was diluted to 1 Xof the electrophoretic fluid with double distilled water before use.
Preparation of Western Blot transfer solution
10 x transfer solution: 30.28g of Tris powder, 150.14g of Glycine powder and double distilled water are sequentially weighed by a one-thousandth electronic balance, dissolved to 1000mL, and the pH value is adjusted to 8.5, and the mixture is stored at room temperature. When in use, the double distilled water is diluted to be 1X membrane transferring liquid for use.
Preparation of Western Blot blocking solution
5% of blocking solution: 1g of skimmed milk powder was weighed by a one thousandth electronic balance and dissolved in 20mL of fresh PBST buffer.
2. Cell culture, counting, passaging, cryopreservation and resuscitation
2.1. Cell culture
The digested cells were inoculated to a basal area of 25cm 2 In a cell culture flask with holes, 5mL of complete medium is added each time, cells are completely covered, and the flask is placed at 37 ℃ and CO 2 In an incubator with a concentration of 5%, the medium was replaced every 24 hours.
2.2. Cell count
When the number of cells grows to 80% -90% of the bottom surface of the culture flask, sucking out the complete culture medium, slightly rinsing with PBS buffer solution twice, adding EDTA-free pancreatin for digestion at 37 ℃ for about 30-60s, stopping digestion when the cells shrink and become round under a microscope, adding a small amount of complete culture medium to stop digestion, carefully blowing down the cells by using a Pasteur pipette, collecting and centrifuging at 800r/min for 3min, discarding the supernatant, adding a proper amount of complete culture medium to resuspend the cells, placing a 0.17mm cover glass in the center of a cell counting plate, sucking 10 mu L of cell suspension drops from one side of the edge of the cover glass by using a pipette, and counting the cells in four square grids under an inverted microscope. When counting, the line pressing cells only count the upper line and the left line, and the agglomeration cells are counted regularly.
The calculation formula is as follows: viable cell density= (total number of 4 pane cells/4) ×10 4 And each mL.
2.3. Cell passage
When the number of cells in the flask is as long as about 80% -90%, the process is carried out according to a ratio of 1:3. Cells in the logarithmic growth phase were selected for subsequent experiments.
2.4. Cell cryopreservation
Cells in the logarithmic growth phase were aspirated, the medium was gently rinsed twice with PBS buffer saline, and the cells were digested and collected. Adding appropriate amount of frozen culture solution, gently blowing to suspend the cells uniformly, counting, and regulating cell density to 5×10 6 ～1×10 7 personal/mL
Frozen medium, fetal bovine serum, dmso=6:3:1
In the labeled frozen tube, 1mL of cell frozen suspension is added to each tube, and the connection is sealed by using sealing glue. And placing the freezing tube filled with the cell freezing suspension in a cell program freezing box, placing the freezing tube at the temperature of-80 ℃ for at least 10 hours, and transferring the freezing tube into liquid nitrogen for preservation.
2.5. Cell resuscitation
Taking out the freezing tube from the liquid nitrogen, quickly immersing the freezing tube under the liquid level of the constant-temperature water bath kettle at 37 ℃ and continuously shaking the freezing tube to melt cell frozen blocks, and wiping the freezing tube with 75vol% alcohol after the cell frozen blocks are completely melted to prevent pollution. And (3) rotating the cover of the cryopreservation tube in an ultra-clean bench, transferring the cell cryopreservation suspension into a 15mL centrifuge tube added with complete culture medium in advance by using a 1mL pipetting gun, and centrifuging at 800r/min for 3min after uniform mixing to collect cells. The supernatant in the tube is discarded, 5mL of complete medium is added to resuspend the cells, a culture flask is added, the cells are placed in a 37 ℃ incubator to be cultured, after 5-12 hours, the culture solution is replaced after the cell adhesion is observed under a microscope, and the subsequent culture is carried out.
3. Flow cytometry
1) Apoptosis detection:
the survival rates of wild type (wild) and Tim3 knockout T cells were analyzed by flow cytometry using an annexin V staining kit. After the cells are treated, they are digested with cell trypsin and collected by centrifugation. The supernatant was removed and cells were resuspended in 500. Mu.L of Annexin V solution with 4. Mu.L of Propidium Iodide (PI) and 2. Mu.L of FITC according to the manufacturer's instructions. After 15min incubation in the dark at room temperature, the cells were analyzed using a FACSVerse flow cytometer (BD Biosciences, san Jose, CA, USA);
2) Cell and cell death rate assay:
to determine Tim3 expression, cells were trypsinized, harvested and analyzed by flow cytometry, as described above, following transfection and treatment of the cells. Cells were collected by centrifugation and detected after incubation for 15min in 200 μl of 4 μl PI-containing PBS. Data collection and analysis used BD FACSuiste v1.0.6 software (BD Biosciences, san Jose, calif., USA).
Example 1
The T cell gene editing method is summarized, and the CRISPR-Cas9 is utilized to specifically knock out the human T cell TIM-3 gene, and the method specifically comprises the following steps:
1. PBMCs were isolated.
2. Activating T cells.
3. RNP was prepared.
4. And (5) electric rotation.
5.T cell knockout detection.
The method of the application extends T cell survival by specifically knocking out HAVCR2 genes in human T cells using CRISPR-Cas9 and sgrnas.
The preferable technical points are as follows:
1) The sequence and combination of gRNA are determined by testing multiple gRNAs and combinations thereof, and the sequence and combination with high cleavage activity is determined.
2) Electrotransformation T cell flow, comprising determining the method of activating T cells (by okt3+il2) and the time point of electrotransformation (72 h post activation). OKT3 (Orthoclone OKT 3) is a baiCD3 monoclonal antibody, OKT3 reacting with and blocking the function of CD3 of T cell membranes.
3) The procedure of electrotransformation, the optimal electrotransformation conditions were determined by testing the optimal electrotransformation RNP ratio, concentration, electrotransformation parameters, etc. (see fig. 8,9, 10).
4) Through T cell function experiments, it is determined that the knockout of the HAVCR2 gene can achieve the effects of enhancing the T cell killing function and prolonging the survival time of the T cells.
In the T cell TIM-3 gene knockout method, main key control parameters are as follows:
(1) gRNA sequences and combinations
(2) Electrical transfer flow and parameters
By controlling the above 2 key parameters, it is possible to ensure the effect of achieving efficient gene knockout. Firstly, the gRNA sequence is determined through a test, can specifically bind to the HAVCR2 gene region, and has important significance for knocking out the T cell TIM3 gene through CRISPR-Cas9 technology. The method for optimizing and determining the T cell electrotransfer RNP realizes high-efficiency transfer while maintaining the cell activity and state, and the cells have good proliferation activity after electrotransfer.
Specific experimental characterization validation is shown in the examples below.
Example 2
Preparation of tumor-specific and TIM 3-TCell products (best mode)
1. Isolation of PBMC
Healthy volunteers were recruited for nails without symptoms of cold fever. The elbow vein was bled 100mL to BD anticoagulated. The blood was mixed with an equal amount of PBS buffer (containing 2% fetal bovine serum). PBMC separation tube Seplate-50 was taken, 15mL of Ficoll buffer was added, and then the blood PBS mixture was added. 1200 Xg centrifugation for 10 minutes, then rapidly pouring the supernatant into a new 50mL tube, 200 Xg centrifugation for 8 minutes, discarding the supernatant, adding 10mL PBS buffer to resuspend the pellet, discarding the supernatant, adding 20mL PBS buffer to resuspend, centrifuging 10mL supernatant PBS buffer after discarding the supernatant, and resuspending all pellet. The resuspended cells were counted, 10. Mu.L of the suspension was added to 10. Mu.L of 0.1% trypan blue and mixed well, and the cells were counted and viability was measured on the machine.
2. Sorting CD8+ T cells
Isolated PBMC were subjected to the Methaemagglutinin CD8 extraction kit (CD 8 microblades, human, 130-045-201) to obtain CD8+ cells.
3. Activation of T cells
4mL of the isolated CD8+ cells were centrifuged at 200 Xg for 5 minutes, and the supernatant was removed and resuspended in 12mL of X-VIVO-15 medium. anti-CD 3/anti-CD 28 magnetic beads (Life Technology) were resuspended in PBS buffer (containing 2mM EDTA and 1wt.% fetal bovine serum), added to the pole, allowed to stand for 2 minutes, and the supernatant removed. The above operation was repeated 4 times. The magnetic beads after washing were collected and 1.2X10 7 The beads were added to PBMC cells, mixed well and incubated in an incubator at 37℃for 3 days. After 3 days the beads were removed and the T cells were first resuspended several times with a pipette. The cell suspension is placed in a magnetic pole, and after standing for two minutes, the magnetic beads on the pipe wall are discarded.
4. Virus transfection
HEK293T cells were inoculated in DMEM medium (containing 10wt.% FBS) and transfected at a controlled cell density of 60 vol.% to 80 vol.%. 2. Mu.g of a plasmid carrying the targeting sequence (e.g.anti-CD 19 CAR) together with the helper vector was transfected into cells per well according to the procedure of Lipofectamine 3000Transfection Reagent (Invitrogen, 11668-019), and the supernatant was recovered after 6-8 hours. The supernatant virus titer was measured by qPCR and activated T cells were infected according to MOI 5.
5. Preparation of RNP
Cas9 gRNA Ribonucleoprotein (RNP) complex, cas9 recombinant proteinSpy Cas9 NLS, M0646T, NEB) and gRNA were incubated in NEB buffer 3.1 for 10min at room temperature to form RNP complexes for the next electrotransport experiments.
Wherein, the matching proportion of Cas9 to gRNA is 1:1.5. Wherein the gRNA comprises gRNA sequences of SEQ ID NO.1 to SEQ ID NO.3, and the molar ratio of the three is 1:1:1.
The specific sequence table is
SEQ ID NO.1：CGCUCUGUAUUCCACUUCUG；
SEQ ID NO.2：CUAUGCAGGGUCCUCAGAAG；
SEQ ID NO.3：CUCAGAAGUGGAAUACAGAG。
6. Electric rotating device
The infected T cells were taken 1X 10 6 The cell suspensions were placed in a centrifuge tube for centrifugation at 200 Xg for 5 minutes, after centrifugation the medium was completely removed and resuspended with Lonza electroporation buffer, respectively, and then Cas9 120 pmol+control sgRNA 150pmol, cas9 120pmol and Cas9 120 pmol+experimental group sgRNA 150pmol were added to the T cell suspension, after homogenization, added to the electroporation cuvette, shocked with the EH-115 program of the Lonza4D electroporation apparatus, placed in a 37℃incubator for 5 minutes and then added to 3mL of pre-warmed cell medium (X-VIVO-15+10 ng/mL rIL-2), respectively. Continuing the culture, maintaining the growth density of each T cell at 1×10 6 About one/mL, and replenishing fluid every other day.
7.T cell transfection and knockout detection
Culturing for 4 days after electroporation, collecting 10 5 The flow cytometry analysis of the corresponding cells comprises the following specific steps: adding corresponding cells into a 1.5mL centrifuge tube, washing with PBS+1% FBS buffer solution for 2 times, completely discarding the supernatant, adding 100 mu L buffer solution to re-suspend the cells, adding 5 mu L PE-anti-human-Tim 3 or APC-anti-human CD137 streaming antibody, mixing uniformly, standing at room temperature in a dark place for 15 minutes, adding PBS buffer solution, washing for 2 times, and then respectively detecting PE and APC channels by a machine.
As shown in FIG. 1, the TIM3 gene knockout is performed by adopting the application to perform the electric transfer RNP mode, the knockout rate is greatly improved under the condition of gRNA guiding, and if the TIM3 gene knockout is performed by adopting multiple gRNA guiding, the knockout rate can reach approximately 100%, and the advantages are very obvious. Figures 2 and 3 show the sequencing results after knockout, and a quantitative assessment of knockout efficiency is made, further illustrating the advantages of the present application in knockout efficiency.
Example 3
Effect of TIM3 knockout on T cell residence time
Tim 3-cell proliferation assay
TIM3 knockdown T cells were cultured in complete medium for 1, 2, 3, 4, 5, 6 days and CCK8 assay was used to examine the effect of TIM3 knockdown on T cell proliferation.
Principle of CCK 8: the CCK-8 kit mainly contains WST-8,2- (2-methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2, 4-disulfonic acid benzene) -2H-tetrazole monosodium salt. In the presence of an electron-coupling reagent (i.e., the cell is living, respiring, has energy metabolism), it is oxidized and reduced by NAD+ to a water-soluble yellow Formazan product (Formazan). The more living cells, the more formalzan is produced and the darker the color.
The CCK8 assay detects the effect of TIM3 knockout on T cell proliferation as follows:
1. 100. Mu.L of the cell suspension was prepared in 96-well plates. The plates were pre-incubated in an incubator for 24 hours (37 ℃,5% co 2 )。
2. To the plates 10. Mu.L of the substances to be tested were added in different concentrations.
3. The plates are incubated in the incubator for an appropriate period of time (e.g., 6, 12, 24, or 48 hours).
4. To each well 10 μl of CCK solution was added (note that bubbles were not generated in the wells, which would affect the OD reading).
5. The plates were incubated in the incubator for 1-4 hours.
6. The absorbance at 450nm was measured with a microplate reader.
7. If the OD value is not determined temporarily, 10. Mu. L0.1M HCl or 1% w/v SDS solution can be added to each well and the plate covered and kept at room temperature in the absence of light. The absorbance did not change when measured within 24 hours.
Tim 3-cell killing experiment
Detection of T cell Activity Using Lactate Dehydrogenase (LDH) Release
Lactate Dehydrogenase (LDH) is one of the cytosolic inteins of living cells. Normally, it is not permeable to the cell membrane. When target cells are damaged by attack of effector cells, cell membrane permeability is changed, LDH can be released into a medium, the released LDH enables oxidized coenzyme I (NAD+) to be changed into reduced coenzyme I (NADH 2) in the process of catalyzing lactic acid to generate pyruvic acid, the oxidized coenzyme I (NAD+) is reduced by hydrogen-transferring body-phenazine dimethyl sulfate (PMS) to form colored formazane compounds by iodonitrodiazole chloride (INT) or nitrotetrazolium chloride (NBT), a high absorption peak is formed at a wavelength of 490nm or 570nm, and the activity of T cells can be obtained through calculation by utilizing the read OD value, and the steps are as follows:
1. preparation of target cells cultured for 24-48 h are taken, washed 3 times, and finally the cell concentration is regulated to 1X 10 by using the complete RPMI-1640 culture solution 5 /mL, ready for use.
2. Preparation of effector cells electrotransformed T cells, washing 3 times, and finally adjusting the cell concentration to 1×l0 with complete RPMI-1640 medium 7 /mL。
3. Effect-target cell action 0.1mL each of effector and target cells (E/T=10:1) were added to wells of a 40-well cell culture plate, 3 multiplex wells were set per specimen, and a natural release control group and a maximum release control group (0.1 mL target cells+0.1 mL1% NP-40 solution) were set for target cells, centrifuged at low speed for 1000r/min, after 2min, at 37℃and 5vol% CO 2 Incubate in incubator for 2h.
4. Taking out the culture through enzymatic reaction, sucking 0.1mL of supernatant of each hole, adding the supernatant into another culture plate hole, preheating for 10min at 37 ℃, adding 0.1mL of freshly prepared LDH substrate solution into each hole, and carrying out light-shielding reaction at room temperature for 10-15 min, and adding 30 μl of 1mol/L citric acid stop solution into each hole to stop the enzymatic reaction.
5. Results calculation the OD values of each well were read with an enzyme-linked detector at 570nm wavelength and the cell activity was calculated.
Cell activity (%) = ■ ×100%
As shown in FIG. 5, T cells and target cells were co-cultured using TIM3-KO to effectively kill target cells. Compared with wild type T cells, TIM3-KO has stronger T cell killing power and higher target cell apoptosis proportion, and the killing ratio of TIM3-KO to a knockout group is obviously higher than that of a wild type test group along with the continuous killing of the target cells by the extension of the culture time.
Phenotypic assay after Tim 3-cell activation
The electrotransformed T cells and target cells are incubated together, and the specifically activated T cells are detected by flow cytometry for cell surface activation signal molecules CD137 and Tim3. As shown in FIG. 4, the T cells after the electric transformation of the application hardly express Tim3 due to the gRNA guiding gene knockout effect, and the cell phenotype is activated but not exhausted.
In FIG. 4, the multiple guide test group uses a combination of SEQ ID NO.1, NO.2 and NO.3 for the gRNA coding sequence and SEQ ID NO.1 for the Single guide test group and the negative ctrl test group adds a mock RNA backbone.
Tim 3-apoptosis assay
Phosphatidylserine eversion assay (Annexin V method)
Phosphatidylserine (PS) is normally located inside the cell membrane, but PS can flip from inside to the surface of the cell membrane, exposing to the extracellular environment, early in apoptosis.
1. Staining of suspension cells: suspension cells (0.5-1×10) which were normally cultured and induced to undergo apoptosis were cultured 6 ) Washing with PBS for 2 times, adding 100ul Binding Buffer and FITC labeled Annexin-V (20 μg/mL) 10 μl, adding PI (50 μg/mL) 5ul at room temperature in the absence of light for 30min, adding 400ul Binding Buffer after reaction for 5min in the absence of light, and immediately performing flow cytometry quantitative detection (generally not exceeding 1 h) with FACScan, while taking a tube without addition of Annexin V-FITC and PI as a negative control. The results are shown in FIG. 6, TIMUnder the condition of different target cell ratios, the apoptosis of the T cells of the 3-KO is relatively less, and the T cells are obviously superior to the wild type.
Tim 3-cell persistence assay
The T cells after electrotransformation were intravenously injected into immunodeficient mice, and the persistence of these T cells in the mice was observed. The observation time points were 10 th, 30 th and 100 th days.
As shown in FIG. 7, wild-type T cells rapidly apoptosis after injection into mice, whereas TIM3 knocked-out T cells of the present application can maintain higher activity for a very long period of time, indicating that TIM3 knocked-out T cells of the present application have a slower depletion rate and longer residence time in vivo, and can exert better targeted antitumor activity.
Example 4
Effect of different RNP ratios on knockout efficiency
T cells were obtained and activated by the method of reference example 2, cas9 and sgrnas were made into different RNPs in ratios of 0:1, 2:1, 1:1, 1:2, 1:3. Electrolysis and T-cell tran-and knockout rates were measured in the same manner as in example 2, and the effect of different RNP ratios on knockout efficiency was examined and the results are shown in FIG. 8.
When the Cas9 recombinant protein and the gRNA are matched according to a certain proportion, the knockout rate is greatly improved, and particularly when the ratio of the Cas9 recombinant protein to the gRNA is greater than 2:1, the knockout rate is remarkably improved. Particularly in the experimental groups reaching 1:2 and 1:3, the knocking-out rate of the whole body is remarkable.
Therefore, the Cas9 recombinant protein and gRNA ratio range is preferably 1:1.5 to 1:2.
effect of different RNP concentrations on knockout efficiency
T cells were obtained and activated by the method of reference example 2, except that the amounts of cas9 recombinant proteins were changed to 0, 5mg, 10mg, 15mg, 20mg, and the other experimental procedures were consistent with those of example 2. As shown in FIG. 9, it was found that the TIM3 gene knockout rate was high when the amount of cas9 recombinant protein was 10-20mg, so that it was preferable that the amount of cas9 recombinant protein was 10-20mg.
Influence of the Electrical transfer parameters on the knockout efficiency
Experiments were performed in the same manner as in reference example 2, except that the electric conversion parameters were different, and Neon, celetrix, nucleofector EN-138 and Nucleofector EH-115 were used to perform electric conversion RNP, respectively, and the experimental results are shown in FIG. 10, which shows that the electric conversion parameters were selected by using Nucleofector EN-138 or Nucleofector EH-115 as parameters of the electric conversion composite RNP of the present application to be suitable, and that the optimal gene knockout rate was achieved.
Example 5
Method for knocking out Tim3 gene in NK cells
In addition to T cells we tested this technique to edit other cells, such as NK cells. The CRISPR-Cas9 is utilized to specifically knock out the human NK cell TIM-3 gene, and the method specifically comprises the following steps:
1. PBMCs were isolated and NK cells were extracted.
Step of isolating PBMC NK cell extraction NK cell counts were obtained and activity purity was measured as described in example 2 above using the metaplasia and human NK sorting kit 130-092-657, operating the reference kit instructions.
2. Activating NK cells.
NK was cultured in Meitian and gentle NK MACS broth (130-114-429) and IL15 was added, IL2 stimulated NK cell activation, counted by day 6, and assayed for NK phenotype.
3. RNP was prepared.
Preparation method As described in example 2, cas9: gRNA Ribonucleoprotein (RNP) complex was used for the next gene knockout experiment.
4. And (5) electric rotation.
NK cells were subjected to electroporation experiments using the FA-100 procedure of the Lonza4D electroporator as described in the previous example 2.
NK cell knockout detection.
The knocked out cells adopt the detection means in the embodiment 2, and the test result shows that the gene knockdown rate of the NK cell TIM3 reaches 80 percent, which proves that the experimental method is also applicable to NK cells and can achieve the effect of efficiently knocking out Tim3.
Example 6
Comparison of the efficiency of different gRNA sequences for TIM3 Gene knockout
RNP complex preparation was performed by referring to the method of example 2, the gRNA sequences of SEQ ID Nos. 1 to 37 of the following Table No.1 to 37 were artificially synthesized, RNP complex preparation was performed in the same manner as in example 2, and electrotransformation was performed by the electrotransformation process to obtain TIM3 gene knocked-out T cells, and TIM3 gene knockdown was tested, with the results shown in the following Table.
TABLE 1 gRNA encoding sequence listing
/>
/>
* Wherein the gRNAs with sequence numbers 1-3 are the gRNA sequences of SEQ ID NO.1 through SEQ ID NO.3 of example 2.
Experimental results show that the gRNA sequences from SEQ ID NO.1 to SEQ ID NO.3 are selected for RNP complex preparation, so that more excellent TIM3 gene knockout efficiency can be obtained, and the gene editing purpose of the application is better.
The descriptions of the patents, patent applications, and publications cited herein are incorporated by reference in their entirety. Any references cited should not be construed as allowing them to be used as "prior art" to the present application.
The foregoing description of the preferred embodiments of the application is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the application.
Sequence listing
<110> Chengdu Dayi New tumor precision technology Co
<120> a method and use for knocking out TIM-3 gene to prolong T cell survival.
<160> 37
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cgcucuguau uccacuucug 20
<210> 2
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
cuaugcaggg uccucagaag 20
<210> 3
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cucagaagug gaauacagag 20
<210> 4
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
agaaguggaa uacagagcgg 20
<210> 5
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
guggaauaca gagcggaggu 20
<210> 6
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
gguguagaag cagggcagau 20
<210> 7
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
gcggcugggg uguagaagca 20
<210> 8
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gagguucccu ggggcggcug 20
<210> 9
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ucuacacccc agccgcccca 20
<210> 10
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
gggcacgagg uucccugggg 20
<210> 11
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
gacgggcacg agguucccug 20
<210> 12
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
agacgggcac gagguucccu 20
<210> 13
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
ugccccagca gacgggcacg 20
<210> 14
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
gcuccuuugc cccagcagac 20
<210> 15
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
ggcuccuuug ccccagcaga 20
<210> 16
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
aaccucgugc ccgucugcug 20
<210> 17
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gugcccgucu gcuggggcaa 20
<210> 18
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
acguugccac auucaaacac 20
<210> 19
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
gccuguccug uguuugaaug 20
<210> 20
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
uguguuugaa uguggcaacg 20
<210> 21
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
aauguggcaa cguggugcuc 20
<210> 22
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
uggugcucag gacugaugaa 20
<210> 23
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
auuauuggac auccagauac 20
<210> 24
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
auccagauac uggcuaaaug 20
<210> 25
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
cuaaaugggg auuuccgcaa 20
<210> 26
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
ucagggacac aucuccuuug 20
<210> 27
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
agucacauuc ucuaugguca 20
<210> 28
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
gagucacauu cucuaugguc 20
<210> 29
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
ugcuagaguc acauucucua 20
<210> 30
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
aaugugacuc uagcagacag 20
<210> 31
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
augugacucu agcagacagu 20
<210> 32
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
acagugggau cuacugcugc 20
<210> 33
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
uuaugccugg gauuuggauc 20
<210> 34
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
ugcugccgga uccaaauccc 20
<210> 35
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
uuucaucauu cauuaugccu 20
<210> 36
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 36
uuuucaucau ucauuaugcc 20
<210> 37
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 37
ugaaaaauuu aaccugaagu 20
Claims (3)
1. A method of knocking out a T cell TIM-3 gene comprising preparing a CRISPR-Cas9 protein and a gRNA into an RNP complex, and then electroporating the RNP complex into a T cell;
the gRNA is a target TIM-3 gene RNA segment predicted by genome data and bioinformatics algorithm and chemically synthesized and modified;
the gRNA consists of gRNAs shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the molar ratio of the gRNAs is 1:1:1; the matching proportion of Cas9 to gRNA is 1:1.5;
the electroporation procedure delivered RNP complexes to T cells using instrument Lonza4D;
the gene knockout rate of the T cells subjected to gene editing is more than or equal to 90 percent;
the RNP complex is a ribonucleoprotein complex, which is a complex formed by a specific CRISP-Cas9 protein and a gRNA.
2. The method of claim 1, wherein the electrotransformation program encodes NucleofectorEN-138 or NucleofectorEH-115.
3. The method of knocking out a T cell TIM-3 gene according to claim 1, wherein Cas9 recombinant protein is used in an amount of 10-20mg.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110256435.2A CN113061624B (en) | 2021-03-09 | 2021-03-09 | Method for knocking out Tim-3 gene to prolong survival of T cells in vivo |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110256435.2A CN113061624B (en) | 2021-03-09 | 2021-03-09 | Method for knocking out Tim-3 gene to prolong survival of T cells in vivo |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113061624A CN113061624A (en) | 2021-07-02 |
| CN113061624B true CN113061624B (en) | 2023-08-18 |
Family
ID=76560317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110256435.2A Active CN113061624B (en) | 2021-03-09 | 2021-03-09 | Method for knocking out Tim-3 gene to prolong survival of T cells in vivo |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113061624B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107746845A (en) * | 2016-12-28 | 2018-03-02 | 北京微旋基因技术有限公司 | The method of sgRNA and specific knockdown LAG 3 gene of the selectively targeted genes of LAG 3 |
| CN108949693A (en) * | 2018-07-30 | 2018-12-07 | 苏州茂行生物科技有限公司 | A kind of pair of T cell immune detection point access carries out the method and application of gene knockout |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022516389A (en) * | 2018-05-31 | 2022-02-28 | ワシントン・ユニバーシティ | Genome-editing invariant natural killer T (iNKT) cells for the treatment of hematological malignancies |
-
2021
- 2021-03-09 CN CN202110256435.2A patent/CN113061624B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107746845A (en) * | 2016-12-28 | 2018-03-02 | 北京微旋基因技术有限公司 | The method of sgRNA and specific knockdown LAG 3 gene of the selectively targeted genes of LAG 3 |
| CN108949693A (en) * | 2018-07-30 | 2018-12-07 | 苏州茂行生物科技有限公司 | A kind of pair of T cell immune detection point access carries out the method and application of gene knockout |
Non-Patent Citations (1)
| Title |
|---|
| 人外周血TIM3基因敲除T淋巴细胞的制备及其抗肿瘤作用;王康馨 等;《中国肿瘤生物治疗杂志》;20190430;第26卷(第4期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113061624A (en) | 2021-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107245107B (en) | Chimeric antigen receptor based on CD20 and application thereof | |
| CN114929862A (en) | Production method for producing T cell expressing chimeric antigen receptor | |
| WO2023138658A1 (en) | 2019-ncov-specific t cell receptor and use thereof | |
| CN108265051B (en) | Non-invasive method and kit for capturing and isolating fetal cells from a mother | |
| CN112899233B (en) | Method for constructing acute lymphocytic leukemia mouse model | |
| CN110172089A (en) | A kind of more antigen combinations of KRAS mutation, targeting KRAS mutation tumour CTL and its application | |
| CN113684184A (en) | Method for preparing chimeric antigen receptor NK (natural killer) cells of targeted CD19 from human pluripotent stem cells and application of method | |
| CN113061624B (en) | Method for knocking out Tim-3 gene to prolong survival of T cells in vivo | |
| CN112679618A (en) | TRBC 1-targeted humanized chimeric antigen receptor, T cell and application | |
| CN113980143B (en) | Chimeric antigen receptor, chimeric antigen receptor T cell targeting CD276, preparation method and pharmaceutical application | |
| Idorn et al. | Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2 | |
| CN113943710B (en) | Culture medium for CAR-T cell culture and application thereof | |
| CN114480645B (en) | Multiple myeloma depletion NK cell subgroup, characteristic gene and application thereof | |
| WO2023049733A2 (en) | Methods and composition using patient-derived autologous neoantigens for treating cancer | |
| CN113122579B (en) | Method for transfecting immune cells by lentivirus | |
| US20230054266A1 (en) | Method for purifying ucart cell and use thereof | |
| CN117795065A (en) | Gene editing in primary immune cells using cell penetrating CRISPR-CAS system | |
| CN113122504A (en) | Method for purifying UCART cells and application | |
| CN114269902A (en) | Engineered immune killer cell, preparation method and application thereof | |
| Ferreira et al. | Reprogramming Cancer Cells to Antigen-presenting Cells | |
| CN116179606B (en) | Use of the transcription factor TCF1 against CAR-T cell depletion and terminal differentiation | |
| EP3381946A1 (en) | Anti-placenta-chondroitin-sulfate chimeric antigen receptor and application thereof | |
| CN113249331B (en) | DC cell and CTL cell loaded with Tax antigen as well as preparation methods and applications of DC cell and CTL cell | |
| CN113999320B (en) | CD 276-targeted chimeric antigen receptor taking CD28 and 4-1BB as co-stimulation domains and application thereof | |
| CN114560948B (en) | Chimeric antigen receptor, CAR-T cell and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20220211 Address after: 210000 room 715-721, building B, 6th floor, phase I, Zhongdan Ecological Life Science Industrial Park, No. 3-1, xinjinhu Road, Jiangbei new area, Nanjing, Jiangsu Applicant after: Jiao Shiping Applicant after: Keshihua (Nanjing) Biotechnology Co.,Ltd. Address before: 321 Zhongshan Road, Gulou District, Nanjing City, Jiangsu Province, 210000 Applicant before: Jiao Shiping Applicant before: Chengdu Dayi precision tumor New Technology Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |