CN113049808B

CN113049808B - Blocking ELISA antibody detection kit based on EHDV core sample particles, preparation method and application

Info

Publication number: CN113049808B
Application number: CN202110322734.1A
Authority: CN
Inventors: 黄超华; 花群义; 曹琛福; 史卫军; 吴江; 林彦星; 林永涛; 翁巧玉; 曾少灵; 杨俊兴
Original assignee: Shenzhen Customs Animal and Plant Inspection and Quarantine Technology Center
Current assignee: Shenzhen Customs Animal and Plant Inspection and Quarantine Technology Center
Priority date: 2021-03-25
Filing date: 2021-03-25
Publication date: 2022-02-25
Anticipated expiration: 2041-03-25
Also published as: CN113049808A

Abstract

The invention provides a blocking ELISA antibody detection kit based on deer epidemic hemorrhagic fever virus (EHDV) core sample particles (CLPs), a preparation method and application thereof. The kit disclosed by the invention has the advantages of high sensitivity, good specificity, convenience in operation, high accuracy due to the fact that a blocking rate (PI) method is adopted for result judgment, and detection coincidence rate of the kit is up to more than 99% compared with that of an imported kit.

Description

Blocking ELISA antibody detection kit based on EHDV core sample particles, preparation method and application

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a detection kit for an ELISA antibody for blocking the epizootic hemorrhagic fever virus of deer, a preparation method and application thereof.

Background

Epizootic hemorrhagic fever (EHD) is an insect-borne infectious disease of various wild and domestic ruminants such as deer, goats, cattle, and the like, caused by infection with epizootic hemorrhagic fever viruses (EHDV) of the circovirus genus (Orbivirus) of the Reoviridae family (Reoviridae). EHD is mainly distributed in tropical, subtropical and temperate regions, but as global climate gradually warms, the activity range of a transmission medium, female Culicoides spp, is continuously enlarged, and the influence range of the disease is correspondingly enlarged and gradually trends to be distributed globally. For this reason, the world animal health Organization (OIE) lists it as a legal report for animal epidemic. EHD mainly attacks a variety of wild and domestic ruminants such as deer, goats, cattle and the like, and the outbreak of EHD can bring serious economic loss to the animal husbandry. In recent serological investigation of China, EHDV positive herds exist in Yunnan, Xinjiang, inner Mongolia, Guangxi, Guangdong and the like, wherein special attention needs to be paid to detecting EHDV-2, 6 and 7 types which have strong pathogenicity to cattle in positive samples. 5 serotypes including EHDV-1, EHDV-5, EHDV-6, EHDV-7, EHDV-10 and the like are sequentially separated from Yunnan, Guangxi, Guangdong and the like in China by the Yunnan animal husbandry and veterinary academy of sciences during 2013-2017; further, the serological survey results of cattle and sheep with 15 provinces in China show that EHDV antibody positive animals generally exist in cattle groups with 13 provinces, and the positive rate is gradually increased from north to south. These studies show that EHDV is widely distributed in China, and there is a risk of outbreak and possibly causing significant impact on ruminant breeding in China, and research and development of EHD diagnostic reagents are necessary.

Currently, the serological detection method of EHDV mainly comprises methods such as a serum neutralization test, an indirect ELISA (enzyme-linked immunosorbent assay) method and a competitive ELISA (enzyme-linked immunosorbent assay) method. Wherein, the ELISA method mostly uses whole virus or single prokaryotic or eukaryotic expressed recombinant protein as coating antigen, the former has the risk of spreading virus, and the latter can not completely display antigen epitope; the EHDV CLPs are hollow particles which are similar to viruses and are formed by assembling EHDV VP3 and VP7 proteins, do not contain viral nucleic acid genomes, have no infectivity, and can fully display antigen epitopes due to the similar virus structure and shape.

The invention is provided in view of the above.

Disclosure of Invention

The first purpose of the invention is to find a method which has high sensitivity and strong specificity and can quickly and simply detect the antibody of the deer epizootic hemorrhagic fever virus;

the second purpose of the invention is to find a blocking ELISA kit which has high sensitivity and strong specificity and can quickly and simply detect the antibody of the epizootic hemorrhagic fever virus of the deer. One of the advantages of the kit is that EHDV CLPs are used as coating antigens, so that the sensitivity and specificity of detection are improved.

Based on the above purpose, the invention provides the following technical scheme:

the invention firstly provides a preparation method of an EHDV blocking ELISA antibody detection kit, which comprises the following steps:

1) preparing an enzyme label plate: coating EHDV CLPs on an ELISA plate;

2) preparing an enzyme-labeled antibody: using a group-specific monoclonal antibody of horseradish peroxidase (HRP) labeled anti-EHDV VP7 protein as an enzyme-labeled antibody;

in some embodiments, the step 1) is to dilute the EHDV CLPs to 1-1.5 μ g/mL with 0.1-0.2M Tris hydrochloric acid coating solution, coat for 12-16h at 4-6 ℃, and add blocking solution containing 1-3% BSA after washing;

in some preferred embodiments, EHDV CLPs are diluted to 1-1.5. mu.g/mL with 0.2M Tris HCl coating, pH8.0, coated at 4 ℃ for 12-16h, washed, added with a blocking solution containing 3% BSA, blocked at 37 ℃, washed and stored.

In some more preferred embodiments, the EHDV CLPs are diluted to 1.25. mu.g/mL with 0.2M Tris HCl coating at pH8.0, 100. mu.L per well, coated at 4 ℃ for 12h, washed, added with 200. mu.L of a blocking solution containing 3% BSA, blocked at 37 ℃ for 2h, and stored after washing.

In some embodiments, the enzyme-labeled antibody is diluted at a working concentration of 1:6000 to 1:8000, more preferably 1: 6000.

In some embodiments, the method further comprises: 3) assembling a color developing agent, a stop solution and a negative and positive control; preferably, the color developing agent and the stop solution are 0.1mg/mL tetramethyl benzidine (TMD) color developing solution and 2M sulfuric acid solution stop solution; the positive control and the negative control are respectively: the positive control serum is EHDV positive bovine serum determined by a commercial kit; the negative control was healthy bovine serum without EHDV and without vaccination.

The invention also provides an EHDV blocking ELISA antibody detection kit, which is prepared by the method. Or, the kit comprises an enzyme label plate and an enzyme labeled antibody; wherein the ELISA plate is coated with EHDV CLPs, and the ELISA-labeled antibody is a group-specific monoclonal antibody which is labeled by horseradish peroxidase (HRP) and is used for resisting EHDV VP7 protein.

In some embodiments, the EHDV CLPs are hollow particles assembled from EHDV VP3 and VP7 proteins; preferably, the VP3 and VP7 protein sequences are shown in SEQ ID NO.1 and 2.

In some embodiments, the enzyme-labeled antibody is diluted 1:6000 at working concentration.

In some preferred embodiments, the preparation method of the microplate comprises: diluting the EHDV CLPs with 0.1-0.2M Tris hydrochloric acid coating solution to 1-1.5 mu g/mL, coating at 4-6 ℃ for 12-16h, washing, and blocking with 1-3% BSA blocking solution

In some more preferred embodiments, the specific preparation method of the microplate comprises: diluting the EHDV CLPs with 0.2M Tris hydrochloric acid coating solution with pH8.0 to 1.5 mu g/mL (preferably 1.25 mu g/mL), adding 100 mu L of coating solution into each well at 4 ℃ for 12-16h, washing, adding 200 mu L of blocking solution containing 3% BSA, blocking at 37 ℃ for 2-4h, washing and storing.

In some embodiments, the kit further comprises 0.1mg/mL of a Tetramethylbenzidine (TMD) color former and a 2M sulfuric acid solution stop; the kit also includes positive and negative controls: the positive control serum is EHDV positive bovine serum determined by a commercial kit; the negative control was healthy bovine serum without EHDV and without vaccination.

The invention also provides an application of the EHDV blocking ELISA antibody detection kit or the EHDV CLPs in preparation of products for detecting EHDV infection or vaccination samples to be detected.

In some embodiments, the detection is: adding 100 μ L of PBST diluted serum to be detected into each well at a dilution ratio of 1:5-1:10, and incubating at 37 deg.C for 60-90 min; after PBST washing, 1:6000 dilution of HRP-labeled anti-EHDV VP7 monoclonal antibody, and incubating at 37 ℃ for 30-45 min; adding a TMB substrate for incubation, adding a stop solution H2SO4 for stopping reaction, reading an OD450 value by an enzyme-labeling instrument, and calculating a blocking rate PI value;

in some embodiments, the detecting is specifically: adding 100 μ L of PBST diluted serum to be detected (dilution ratio is 1:5) into each well, and incubating at 37 deg.C for 90 min; PBST wash 3 times; add 100. mu.L 1:6000 dilution of HRP-labeled anti-EHDV VP7 monoclonal antibody, and incubating at 37 ℃ for 45 min; PBST wash 3 times; adding 100 μ L TMB substrate into each well, incubating at room temperature in dark for 10min, adding 50 μ L stop solution 2M H into each well₂SO₄Terminating the reaction, enzyme labelingInstrument reading OD₄₅₀Calculating a blocking rate PI value;

in some preferred embodiments, a positive is determined when the blocking rate PI ≧ 24.36%; judging the PI is negative when the PI is less than or equal to 19.74 percent; if the PI is less than 19.74% < PI < 24.36%, the test is judged to be suspicious, the test is repeated for 1 time, and if the PI is still less than 24.36%, the test is judged to be negative for serum antibodies.

In some preferred embodiments, the serum to be tested is ruminant serum infected with a wild strain or administered with a conventional EHDV attenuated vaccine, inactivated vaccine, or administered with a non-EHDV VP7 deletion vaccine.

The invention also provides a detection method based on the ELISA for blocking the core-like particles of the deer epidemic hemorrhagic fever virus, which comprises the following steps:

(1) coating buffer solution is 0.2M Tris hydrochloric acid buffer solution with pH8.0, the deer epidemic hemorrhagic fever virus core-like particles are diluted to 1-1.5 μ g/mL by the coating solution, 100 μ L of the coating solution is added into each hole, the coating solution is coated for 12-16h at 4 ℃, and PBST is washed for 3 times;

(2) adding 200 μ L of blocking solution containing 3% BSA into each well, blocking at 37 deg.C for 2-4h, and washing with PBST for 3 times;

(3) diluting the serum to be detected according to the proportion of 1:5, setting standard negative serum control and standard positive serum control at 100 mu L/hole, incubating for 1-1.5h at 37 ℃, and washing for 3 times by PBST;

(4) HRP-labeled EHDV VP7 population-specific monoclonal antibodies were subjected to 1: after 6000 dilution, 100 mu L/hole, incubation for 45min at 37 ℃, PBST washing for 3 times;

(5) adding 100 μ L TMB substrate into each well, incubating at room temperature in dark for 10min, adding 50 μ L stop solution 2M H into each well₂SO₄The reaction was terminated.

(6) Enzyme-linked immunosorbent assay (OD) reading₄₅₀Value, calculate the blocking rate PI value.

(7) The judgment standard is as follows: when the blocking rate PI is more than or equal to 24.36 percent, the test sample is judged to be positive; judging the PI is negative when the PI is less than or equal to 19.74 percent; if the PI is less than 19.74% < PI < 24.36%, the test is judged to be suspicious, the test is repeated for 1 time, and if the PI is still less than 24.36%, the test is judged to be negative for serum antibodies.

In some embodiments, the EHDV CLPs referred to above are hollow particles formed by assembly of EHDV VP3 and VP7 proteins;

in some preferred embodiments, the EHDV CLPs are specifically prepared by recombinant expression of VP3 shown in SEQ ID No.1 and VP7 shown in SEQ ID No. 2.

In some more preferred embodiments, the preparation is carried out by inserting EHDV vp3 gene and vp7 gene sequentially into the vector pFastBac^TMDual, constructing a recombinant plasmid pFastBac-Dual-vp3-vp7, and transfecting Sf9 cells with the recombinant plasmid; sf9 cells were harvested and purified by discontinuous sucrose density gradient ultracentrifugation.

Compared with the prior art, the invention at least has the following beneficial technical effects:

(1) the invention provides an ELISA kit for detecting an epidemic hemorrhagic fever virus antibody of a deer. The kit utilizes EHDV CLPs as coating antigens, the EHDV CLPs are hollow particles which are similar to viruses and are formed by assembling EHDV VP3 and VP7 proteins, virus nucleic acid genomes are not contained, the kit has no infectivity, and compared with the kit which takes whole viruses or inactivated viruses as coating antigens, the kit avoids the risk of virus diffusion to the greatest extent.

(2) According to the invention, as the core-like particles keep a form similar to that of a euvirus, each core-like particle is composed of 780 VP7 proteins and 120 VP3 proteins, and the subunit formed by 780 VP7 proteins is positioned on the outer layer of the core-like particles similar to a brush coat, compared with EHDV VP7 protein obtained through prokaryotic expression or eukaryotic expression as a coating antigen, the core-like particles can better display the epitope of the VP7 protein, so that the detection sensitivity and specificity are further improved.

(3) The invention takes the group specificity monoclonal antibody of the enzyme-labeled EHDV VP7 protein as a blocking enzyme-labeled antibody, thereby further improving the sensitivity and specificity of detection.

(4) After a detection system is prepared by group specificity monoclonal antibodies of EHDV CLPs and VP7 proteins, system optimization selection is carried out on coating liquid, antibody concentration, concentration relation between the CLPs and the antibodies, confining liquid, optimal dilution of serum to be detected, optimal incubation time, optimal color development time and the like through an optimization test, and finally a set of optimal enzyme label plate preparation method and an optimal detection method are established and a corresponding kit and the like are prepared on the basis.

(5) The sensitivity test result shows that the kit can detect positive serum diluted by 1:1280 times, and the sensitivity reaches 98.3 percent; the specificity test result shows that the polypeptide has no cross reaction with the current common ruminant pathogens such as bluetongue virus, foot and mouth disease virus, bovine viral diarrhea virus, vesicular stomatitis virus, peste des petits ruminants virus, capripoxvirus and the like, and the specificity is 100 percent.

In conclusion, the kit adopts EHDV CLPs as coating antigens and a specific monoclonal antibody aiming at an EHDV VP7 protein group as a blocking enzyme-labeled antibody to construct a blocking ELISA antibody detection kit, has high sensitivity and strong specificity, can effectively detect the content of the specific antibody of EHDV in a sample, has the coincidence rate with imported kits of more than 99 percent, and has wide market prospect and good economic and social benefits.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the structure of recombinant plasmid pFastBac-Dual-vp3-vp 7;

FIG. 2 is a lesion map of the recombinant baculovirus plasmid Bacmid-vp3-vp7 after transfection of Sf9 cells;

FIG. 3 is a graph showing the results of SDS-PAGE and Western Blot;

a: SDS-PAGE results; b: western blot results (EHDV sheep positive sera);

(1: bottom layer protein collected by sucrose gradient centrifugation; 2: sandwich protein collected by sucrose gradient centrifugation; 3: sf9 cell total protein infected by recombinant baculovirus rBac-vp3-vp 7; 4: sf9 cell control infected by wild baculovirus; M: protein Marker).

FIG. 4 is a transmission electron microscopy inspection of EHDV core-like particles;

FIG. 5 is a transmission electron microscopy of EHDV core-like particles diluted with various coating solutions;

a, a transmission electron microscope result is obtained after dilution by using 0.05M bicarbonate buffer solution with pH9.6 as coating solution;

b, taking 0.2M hydrogen phosphate buffer solution with pH7.4 as a coating solution to dilute the transmission electron microscope result;

c, taking 0.2M Tris hydrochloric acid buffer solution with pH8.0 as a coating solution to dilute the coating solution to obtain a transmission electron microscope result;

d, taking 0.1M Tris hydrochloric acid buffer solution with pH8.0 as a coating solution to dilute the solution, and then obtaining the result of the transmission electron microscope.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The following terms or definitions are provided only to aid in understanding the present invention. These definitions should not be construed to have a scope less than understood by those skilled in the art.

Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.

As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.

Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.

The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

The access to the various biomaterials described in the following examples is provided only for the purpose of providing an experimental access to achieve the specific disclosure and should not be a limitation on the source of the biomaterials of the present invention. In fact, the sources of the biomaterials used are wide and any biomaterials available without violating laws and ethical ethics can be used instead as suggested in the examples.

Example 1 preparation and purification of EHDV core-like particles

(1) Construction of recombinant baculovirus plasmid Bacmid-vp3-vp7

By subcloning, the EHDV vp3 gene (SEQ ID NO.1) and the vp7 gene (SEQ ID NO.2) were sequentially inserted into the vector pFastBac^TMDual, construct recombinant plasmid pFastBac-Dual-vp3-vp7, the structure of which is shown in FIG. 1. And (3) transforming the recombinant plasmid pFastBac-Dual-vp3-vp7 with correct sequencing into DH10Bac, and screening by blue white spots and colony PCR to obtain the recombinant baculovirus plasmid Bacmid-vp3-vp 7.

The SEQ ID NO.1 is as follows:

ATGGCAGATCCACCAGATGCAAATGCACCAAAAACGAGTCCGTATCTAAAAGGAGATGAGTTATCAAGTGACAGTGGACCTTTGCTTTCAATCTTCGCTCTACAAGAGATTATGCAAAAGGTGCGACAAGCGCAATCGGAGTATGTTGCAGCAACTAAAGATGTCGATCTAACGGTACCGGATGTTCAAAAAATAATCGATGGAGTTAAAGAGCTGGCCTCAGAGACGATCTATAAAATTGTACAGAAACCCATCATCTCGTATAGGCATGTGGTGATGCAATCAAGGGATAGATTTCTCCGGGTGGACACCTATTATGAAAGGATGTCTGAAGTTGGCGATAAGATAGATGAGAATGAACCCGCGAAATTTTATGAGACTATAATCAAGAAAGTAAGGCATTTACGTACCGAGGGAGCCTTTATCTTACATAACATACCCACAAAGGATCATAGAGGCATGGAAATAGCGGATCCTGAGATCCTGGGCGTCGATGTCAAAAGCATATTACCGGTGCTAACGGCTGAGCATAGAGCGATGATACAGCATGTTCTAGATGGCGCTATAATAGAGAACGGTAATATAGCGACCCGTGATGTCGATGTGTATTTGGGTGCTTGTTCAGAATCAGTGTATCGCATATACAATCGATTACAAGGATATATCGAGGCCGTTCAATTGGAAGAGTTGCGCGCAGCGGTGACATGGCTCGAGCGTCTGGGGAAACGAAAACGCATGACTTTTTCACAAGAATTTCTAACAGATT TCAGACGTGCAGATACGGTTTGGGTACTGGCGTTGAGGCTGCCAGCCAACCCACGCGTGATTTGGGATGTACCGAGGTGCTCAATCGCGAATCTAATAATGAATATAGCGACGTGCTTACCGACAGGAGAGTATGTTTCACCCAATCCTCGCATAGCTTCAATCACACTGACGCAAAGAATTACTACAACTGGACCATTTGCTATATTAACGGGATCGACGCCAACGGCACAACAATTAGATGACGTTAGAAAGATATACTTAGCGTTAATGTTTCCAGGACAAATAATTTTAGATTTAAAAATAGATCCGGGTGAAAGAATGGACCCAGCTGTACGGATGGTGGCAGGAGTTGTTGGGCATTTAATGTTTACAGCAGGCCCACGATTTACGAACATAACTCAAAACATGGCAAGGCAGCTAGATATCGCACTGGCCGATTTTTTATTATATATGTATAATACCAGAATCCAAGTTCAGTATGGACCGACTGGAGAATCCTTAGATTTTAGAATTGGTCGTGGACAGTATGATTGTAACGTATTTCGCGCCAACTTTCAAACGGGTACGGGATATAATGGTTGGGGTTTAGTTGATGTTGAAAACAGGGAACCAGCGCCCTATGATCATGCACAACGGTATATACGATATTGCAATATAGACTCACGAGAACTGATACATCCAGCCACATTTGGTATTGGTATGAATTACCATTGTTATAATGAAATGTTGAGGATGTTAGTTGCTGCGGGTAAGGACACAGAAGCTGCATTTTTCCGGAATATGTTACCGTTTCATATGGTCCGATTTGCTCGTATAAATCAGGTAATAAATGAAGATTTACACTCAGCTTTCTCGATGCCAGATGATCAGTTTAACGTGTTATTAGCGAATATGATGGTAGGCCAGCAAGAAAGGATTGACCCGGTGATATTGGATATAAGTTGGATCTCAATTTGGTACGCTTTCAATAGATCTTTTGAGCCGATCCGTCGAAACGAAATGCTGGAAAGTGCGCCGCTAATCGAGTCGGTCTATGCCTCAGAATTGACAGTTATGAAGACGGATATGCAGCAGATGGCCCTATTACAGCGCCGTTTCCCAGATGTTTTAATTGAAGCCCGTCCCACGCATTTCTGGAAAGCTGTTATGGAGGTATCACCAGAGCCTGTACGAGCGATCATGGATTTAGCGCATTCACATAGCTTTATCAACATCCGAGATATGATGAGGTGGATAGGTTTGCCTTCGATGCAGAATTCCATGAAGTTGGTGCTAGAAGAAGAAGCTTGGGCGGTGGCTAATGATTTCGAAGAATTGATGCTGACTGATCAGGTGTATATGTACCGTGATATGCTTCCGGAACCAAGGTTAGATGATATAGAGAGATTCAGGCAAGAGGGATTCTACTACACTAATATGTTGGATGGGCCGCCTGCGATCGATCGAGTGGTTCAATATACGTATGAGGTGGCACGATTACAGGCAAATATGGGACAACTACGAGCGGCGTTACGGAGGATTATGGATGACGAAGGATGGGTTAGATTCGGAGGTGTACTACGAACTGTACGGATTAAATTCTTCGACTCACGTCCACCCGAAGAAATCCTTCAAGCATTACCTTTTGATTACCAGACAAATGAGAAGGGCGGATTGACTTATGCCACAATCAAATATGCGAATGATACCACAATATATTATTTAATCTATAATGTTGAGTATTCAAATTTACCTGATTCCTTAGTTTTAATCAATCCTACTTATGTGATGACCAAAGTTTTTATAAATAAACGAATAGTAGAGAGGGTTCGAGTGGGACAAGCGTTGGCCGTAATGAATAAAAGATTTATAGCATTTAAAGGAAAGATGCGAATTATGGATATAACGCAAGCGCTCAAGGTGGGCACCAAGCTAGCGGCGCCGACCGTGTAG。

the SEQ ID NO.2 is as follows:

ATGGACACGATTGCTGCGAGAGCTCTAACAGTGATCAAAGCTTGTAACACTCTAAAAGAGGTAAGAATTGTAGTGGAGTCCAATGTCTTGGAGATATTAGGGACAGCAGTTAATAGATATAACGGATTGACTCTAAGATCAGTTACGATGCGACCAACTTCGCAGGAACAACGGAATGAAATGTTCTATATGTGTCTAGATATGATATTAGCAGCAGCAAATCTAAATGTAGGAAATATTTCCCCTGATTACATACAAAATTTGGCAACGATCGGGGTGTTGGCGACGCCAGAAATACCATATA CGATGGAATCCGCGAACGAAATTGCTCGAATGAGCGGGGAGACAGGAACCTGGGGGCCGGATCGTCAACCTTTCGGCTATTTTTTGGCAGCGCCAGAAGTTACCCAACATGGGCGGTTCAGACAGCGAGTTGGCCAGAATGTTACTACATCAATCGTATCCTCGACTTTAGCTCAGGTTTCAATGAATGCTGGGGCACGGGGTGATATCCAGGCGCTATTTCAAAATCAAAATGATCCTGTAATGATTTACTTTGTGTGGAGACGAATTGGGACTTTTTCGAATGCAGCGGGTAATGCACAAGATACACCTCAGGGCGTGACTCTGAACGTGGGGGGTGTAAACATGAGGGCTGGTGTGATAATAGCTTATGATGGGCAAGCGCCGGTTAATGTGAATAACCCAGGTCTAGGACAAGGTATGATCGAGATTGAAGTGATCTATTATTTGAGTTTAGACAAAACCATGACCCAGTATCCATCATTACAAGCACATATATTCAATGTTTACTCATATAAGAATCCTTTGTGGCATGGACTACGAGCTGCGATTCTTAACAGAACAACGCTACCAAACAATATACCGCCCATTTATCCGCCTCATGATCGCGAGAACGTTTTGTTGATAATATTGCTGTCAGCTTTAGCAGATGCCTTTAGCGTATTGGCGCCAGACTTTAACTTATTTGGTGTAGTACCTATACAAGGTCCGATTAATAGGGCTGTTGCACAAAACGCCTATGTGTGA。

(2) acquisition of recombinant baculovirus rBac-vp3-vp7

Transfection kit recombinant baculovirus plasmid Bacmid-vp3-vp7 was transfected into Sf9 cells. Obvious cytopathic effects can be observed 48-72 h after transfection: compared with normal sf9 cells, the number of cells is significantly reduced, the cell volume becomes larger, round, and has tympanites, becomes easy to fall off, and a small amount of cells are broken, as shown in fig. 2. More than 72h after transfection, the sf9 cells showed massive disruption.

(3) Preparation and purification of EHDV core-like particles

Culturing sf9 cells in bulk suspension at 28 ℃ and 130 rpm; when the cell density reaches 3-4 multiplied by 10⁶When the cell activity exceeds 95%, sf9 cells are diluted to 1X 10⁶Continuing culturing in the volume of/mL; when the cell density reaches 2X 10⁶When the cells were in mL, sf9 cells were again diluted to 1X 10⁶And inoculating the recombinant baculovirus rBac-vp3-vp7 at low MOI (0.001PFU/cell), and collecting sf9 cells after culturing for 96 hours. Collecting a large amount of recombinant virus infected cells, adding appropriate amount of lysis buffer, standing at 4 deg.C overnight, repeatedly freezing and thawing for 3 times, centrifuging at 4 deg.C and 10000r/min for 10min, collecting supernatant, and ultracentrifuging with discontinuous sucrose density gradient for purification. Prepare 30% and 60% sucrose with Tris-HCl buffer, add 24mL lysis supernatant, 6mL 30% and 6mL 60% sucrose in sequence, and ultracentrifuge for 3h at 21500r/min horizontal rotor at 4 ℃. The sandwich protein and bottom precipitate were collected and verified by SDS-PAGE and Western Blot.

The results of SDS-PAGE and Western Blot are shown in FIG. 3, and the results of SDS-PAGE show that two main bands of about 100ku and 38ku appear in both the intermediate protein and the bottom precipitate; western blot results also showed that there were two major bands in both the sandwich and bottom pellet, of around 100 and 38ku size, that specifically bind EHDV positive sera, corresponding to VP3 and VP7 proteins of EHDV, respectively. These results indicate that both the sandwiches and the bottom pellet collected by sucrose gradient centrifugation may have EHDV core-like particles present.

And diluting the interlayer protein and the bottom precipitate, carrying out negative staining by using 2% phosphotungstic acid negative staining solution, and observing under a transmission electron microscope. As shown in FIG. 4, the sandwich protein and the bottom sediment both contain a large amount of dense hollow particles with uniform shapes, the diameter of the particles is about 60-70 nm, the surfaces of the particles have obvious thorn-shaped protrusions, and the shape and the size of the particles are similar to those of bluetongue virus core-like particles obtained by literature reports and laboratory preparation.

Example 2 establishment of a blocking ELISA method based on EHDV core-like particles

(1) Determination of optimal coating solution

The difficulty in establishing an ELISA method by using EHDV CLPs as coating antigens is that the coating process needs to ensure that the morphological structure of the EHDV CLPs is not damaged by coating liquid. For this, in the present invention, in order to determine the most suitable coating solution, the coating solutions were set to 0.05M bicarbonate buffer (CB) at pH9.6, 0.2M biphosphate buffer (PBS) at pH7.4, 0.2M Tris HCl buffer (TB) at pH8.0, and 0.1M Tris HCl buffer at pH8.0, respectively, and the purified EHDV CLPs were diluted with these buffers and the particle morphology was observed under a transmission electron microscope. The results (see FIG. 5) show that the structural morphology of EHDV CLPs was completely destroyed after dilution with 0.05M bicarbonate buffer (CB) pH9.6 as coating (FIG. 5A); the structural morphology of EHDV CLPs was completely destroyed in the same manner as that of the coating solution diluted with 0.2M biphosphate buffer (PBS) at pH7.4 (FIG. 5B); and the structural morphology of the EHDV CLPs remained unchanged after dilution with 0.2M Tris-HCl buffer (TB) with pH8.0 and 0.1M Tris-HCl buffer with pH8.0 as coating solutions, respectively (FIGS. 5C and 5D).

To further determine the optimal coating solution, the purified EHDV CLPs were diluted to 1.0. mu.g/mL with the above coating solution, coated at 4 ℃ for 12h, blocked at 37 ℃ for 2h, washed, added with 100. mu.L of HRP-labeled anti-EHDV VP7 specific monoclonal antibody (1:4000 dilution) and incubated at 37 ℃ for 1h, washed, developed for 10min, added with stop solution, and read OD on microplate reader₄₅₀The value is obtained. The results are shown in Table 1, and the OD of the coating solution is 0.05M of bicarbonate buffer (CB) at pH9.6 and 0.2M of hydrogen Phosphate Buffer (PBS) at pH7.4₄₅₀The values are all less than 0.5; while 0.2M Tris-HCl buffer (pH8.0) is the OD of the coating solution₄₅₀The highest value, greater than 1.5; for this reason, Tris-HCl buffer of 0.1-0.2M pH8.0 is preferable, and the optimal antigen coating solution is preferably determined to be Tris-HCl buffer of 0.2M pH8.0.

TABLE 1 determination of optimal coating solution

(2) Determining the coating concentration of EHDV core-like particles and the optimal dilution multiple of an enzyme-labeled monoclonal antibody

EHDV core-like particles purified according to example 1 were diluted with 0.2M Tris-HCl buffer pH8.0 to 0.25. mu.g/mL, 0.75. mu.g/mL, 1.25. mu.g/mL, 2.5. mu.g/mL, 5.0. mu.g/mL, 10. mu.g/mL by checkerboard titration, 12 wells per concentration were coated in microtiter plates at 100. mu.L/well overnight at 4 ℃. PBST is washed for 3 times, sealing liquid is added, 200 mu L/hole is added, and sealing is carried out for 2h at 37 ℃; PBST wash 3 times; adding 1: 1000. the HRP-labeled anti-EHDV VP7 specific monoclonal antibody prepared by the experiment is diluted by 1:2000, 1:4000, 1:6000, 1:8000 and 1:16000 times and is incubated for 1h at 37 ℃; PBST wash 3 times; adding substrate TMB, 100. mu.L/well, developing at room temperature in dark for 10min, adding 2mol/L H at 50. mu.L/well₂SO₄The reaction was stopped and the OD of each well was read with a microplate reader_450nmThe value is obtained. Selection of OD₄₅₀The concentration of the antigen with the value of about 1.0 and the dilution of the enzyme label are the optimal working conditions. The results are shown in Table 2, and the optimal antigen coating concentration and enzyme-labeled monoclonal antibody dilution are determined to be 1.25-2.5ug/mL and 1:6000-1:8000, and the most preferable is 1.25 mug/mL and 1:6000, respectively.

TABLE 2 determination of EHDV core-like particle coating concentration and enzyme-labeled monoclonal antibody dilution

(3) Determination of optimal blocking solution

To determine the optimal blocking solution, 3 commonly used blocking solutions were selected as 0.5% BSA, 1% BSA, 2% BSA, 3% BSA, 2.5% skim milk, 5% skim milk, 0.5% gelatin, 1% rabbit serum, 5% rabbit serum, 1% horse serum, and 5% horse serum, respectively, for blocking, and the rest was performed according to the above procedure. The results are shown in Table 3, OD when 3% BSA was used as blocking solution₄₅₀The value was closest to 1.0, thus determining the optimal blocking solution to be 3% BSA.

TABLE 3 determination of optimal blocking solution

(4) Determination of the optimal dilution of the serum to be examined

Coating according to the optimized optimal antigen coating concentration and the optimal coating solution, carrying out overnight sealing at 4 ℃ by using the optimal sealing solution, washing for 3 times, and then respectively adding 1: 5. 1: 10. 1:20 and 1:40 dilution of EHDV positive serum and negative serum, and incubating for 45min at 37 ℃; washing 3 times, adding enzyme-labeled monoclonal antibody with optimal concentration, adding developing solution and stop solution according to the method, reading, and calculating the blocking rate (PI) of positive serum, wherein PI is ═ negative serum OD_450nmDetection of serum OD_450nm) Negative serum OD_450nm]X 100%) and the optimal dilution of the serum to be tested when PI is maximal. The results are shown in table 4, 1: serum is diluted at 5-1:10, preferably at 1: 5.

TABLE 4 determination of the optimal dilution of the sera to be tested

(5) Determination of the optimal incubation time of the serum to be tested

Respectively detecting 1 part of EHDV positive serum and 1 part of EHDV negative serum by using the determined optimal reaction conditions, repeating 2 holes for each part of serum, respectively acting for 30min, 45min, 60min and 90min at 37 ℃, keeping other steps unchanged, calculating the average PI of the positive serum with different acting time, and taking the maximum PI as the optimal incubation time of the serum to be detected. The results are shown in Table 5, and the optimal incubation time of the serum to be tested is 60-90min, preferably 90 min.

TABLE 5 determination of the optimal incubation time for the sera to be tested

(6) Determination of optimal incubation time for enzyme-labeled monoclonal antibodies

And according to the optimal conditions, changing the incubation time of the enzyme-labeled monoclonal antibody to be 30min, 45min, 60min and 90min at 37 ℃, respectively detecting EHDV positive serum and negative serum, calculating the average PI of the positive serum under different conditions, and taking the maximum PI as the optimal incubation time of the enzyme-labeled monoclonal antibody. The results are shown in Table 6, and the optimal incubation time of the enzyme-labeled monoclonal antibody is 30-45min, preferably 45 min.

TABLE 6 determination of optimal incubation time for enzyme-labeled monoclonal antibodies

(7) Determination of optimal color development time

Detecting EHDV positive serum and EHDV negative serum according to the optimal conditions, adding TMB developing solution, terminating the reaction at 5min, 10min and 15min after developing, respectively, calculating average PI of the positive serum under different conditions, and taking the maximum PI as the optimal developing time. The results are shown in Table 7, and the optimum development time is 5-10min, preferably 10 min.

TABLE 7 determination of optimal color development time

(8) Blocking ELISA method based on EHDV core-like particles

The optimal reaction conditions for blocking ELISA, which were investigated according to steps (1) to (7), were:

adding EHDV core-like particles diluted to 1.25 mu g/mL by 0.2M Tris-hydrochloric acid buffer solution with pH8.0 into a 96-hole enzyme label plate, coating at 100 mu L/hole and standing overnight at 4 ℃; PBST wash 3 times; adding 200 mu L of PBST blocking solution containing 3% BSA into each well, and blocking for 2h at 37 ℃; PBST wash 3 times; adding 100 μ L of PBST diluted serum (1:5) or standard positive serum or standard negative serum into each well, and incubating at 37 deg.C for 90 min; PBST wash 3 times; add 100. mu.L 1:6000 dilution of HRP-labeled anti-EHDV VP7 monoclonal antibody incubated at 37 ℃ for 45 min; PBST wash 3 times; adding 100 μ L TMB substrate into each well, incubating at room temperature in dark for 10min, adding 50 μ L stop solution into each well, and incubating at 2M H₂SO₄The reaction is stopped, and the enzyme-linked immunosorbent assay (OD) is read by an enzyme-linked immunosorbent assay (ELISA) instrument₄₅₀Value, calculate the blocking rate PI value.

Example 3 determination of the threshold value

80 known EHDV negative sera were tested according to a defined blocking ELISA protocol and OD read_450nmThe average blocking rate of the serum samples is calculated by statistical analysis of the values and results

10.5%, the standard deviation(s) is 4.62%,

when the blocking rate PI is more than or equal to 24.36 percent, the test sample is judged to be positive,

when the blocking rate PI is less than or equal to 19.74 percent, the test sample is judged to be negative,

suspicious was judged when the blocking rate 19.74% < PI < 24.36%,

the test is repeated for 1 time, and if the test is still less than 24.36 percent, the test is judged to be negative by serum antibodies.

EXAMPLE 4 sensitivity test

Using 3 batches of blocking ELISA antibody detection kit batches 20201206, 20210110 and 20210206 based on EHDV core-like particles prepared according to the method of example 2), 20 parts of EHDV-infected bovine serum, 20 parts of EHDV-infected sheep serum and 20 parts of EHDV-infected goat serum were tested according to the method of example 2, and the test results are shown in table 8, and the test results of the test kit of the present invention were 59 parts in total and 1 part was not detected, indicating that the sensitivity of the test kit to 40 parts of known positive serum was 98.3%.

TABLE 8 sensitivity test

Example 5 specificity test

To determine the specificity of the present invention, 60 parts of serum from healthy ruminants, 5 parts of bovine bluetongue positive serum (BT), 2 parts of bovine foot-and-mouth disease positive serum (FMD-O), 2 parts of bovine foot-and-mouth disease positive serum (FMD-A), 2 parts of bovine viral diarrhea positive serum (BVD), 2 parts of bovine vesicular stomatitis positive serum (VS), 3 parts of sheep peste des petits ruminants positive serum (PPR), and 3 parts of sheep pox positive Serum (SP) were separately tested by the blocking ELISA method established in example 2 at different time periods (lots 20201206, 20210110, and 20210206).

The results of the specific detection of the kit are shown in the following table (table 9), and the detection results of 40 healthy pig sera show that the specificity of 3 kits is 100.0%. The specificity of the 3 batches of the kit for detecting the 7 related pathogen positive sera is 100% for 5 parts of bovine bluetongue positive serum (BT), 2 parts of bovine foot-and-mouth disease positive serum (FMD-O), 2 parts of bovine foot-and-mouth disease positive serum (FMD-A), 2 parts of bovine viral diarrhea positive serum (BVD), 2 parts of bovine vesicular stomatitis positive serum (VS), 3 parts of sheep peste des petits ruminants positive serum (PPR) and 3 parts of capripox positive Serum (SP).

TABLE 9 results of the specificity test of the kit of the present invention

EXAMPLE 6 repeatability test

Taking 3 enzyme-labeled plates coated in the same batch and 1 enzyme-labeled plate coated in 3 times of different batches respectively, carrying out repeated tests in batches and among batches by using 4 parts of EHDV negative serum and 4 parts of EHDV positive serum, and calculating the variation coefficient in batches and among batches. The result of the repeatability test shows that the variation coefficient of 8 parts of serum in the batch and batch-to-batch tests is less than 10 percent, and the blocking ELISA detection method is proved to have good repeatability.

Example 7 compliance testing

200 clinical serum samples were simultaneously detected by the blocking ELISA detection method established by the present invention and an imported commercial kit (whole virus plate), and the results are shown in Table 11; the results show that the blocking ELISA method and the commercialized kit have the positive coincidence rate of 100 percent, the negative coincidence rate of 98.7 percent and the total coincidence rate of 99 percent; has higher coincidence rate with a commercial kit, and can be used for clinically detecting EHDV serum samples.

TABLE 11 detection coincidence rate of blocking ELISA detection result and commercial kit

The foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain certain principles of the invention and its practical application to enable one skilled in the art to make and use various exemplary embodiments of the invention and various alternatives and modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

Sequence listing

<110> Shenzhen customs animal and plant inspection and quarantine technical center

<120> blocking ELISA antibody detection kit based on EHDV core-like particles, preparation method and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2700

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcagatc caccagatgc aaatgcacca aaaacgagtc cgtatctaaa aggagatgag 60

ttatcaagtg acagtggacc tttgctttca atcttcgctc tacaagagat tatgcaaaag 120

gtgcgacaag cgcaatcgga gtatgttgca gcaactaaag atgtcgatct aacggtaccg 180

gatgttcaaa aaataatcga tggagttaaa gagctggcct cagagacgat ctataaaatt 240

gtacagaaac ccatcatctc gtataggcat gtggtgatgc aatcaaggga tagatttctc 300

cgggtggaca cctattatga aaggatgtct gaagttggcg ataagataga tgagaatgaa 360

cccgcgaaat tttatgagac tataatcaag aaagtaaggc atttacgtac cgagggagcc 420

tttatcttac ataacatacc cacaaaggat catagaggca tggaaatagc ggatcctgag 480

atcctgggcg tcgatgtcaa aagcatatta ccggtgctaa cggctgagca tagagcgatg 540

atacagcatg ttctagatgg cgctataata gagaacggta atatagcgac ccgtgatgtc 600

gatgtgtatt tgggtgcttg ttcagaatca gtgtatcgca tatacaatcg attacaagga 660

tatatcgagg ccgttcaatt ggaagagttg cgcgcagcgg tgacatggct cgagcgtctg 720

gggaaacgaa aacgcatgac tttttcacaa gaatttctaa cagatttcag acgtgcagat 780

acggtttggg tactggcgtt gaggctgcca gccaacccac gcgtgatttg ggatgtaccg 840

aggtgctcaa tcgcgaatct aataatgaat atagcgacgt gcttaccgac aggagagtat 900

gtttcaccca atcctcgcat agcttcaatc acactgacgc aaagaattac tacaactgga 960

ccatttgcta tattaacggg atcgacgcca acggcacaac aattagatga cgttagaaag 1020

atatacttag cgttaatgtt tccaggacaa ataattttag atttaaaaat agatccgggt 1080

gaaagaatgg acccagctgt acggatggtg gcaggagttg ttgggcattt aatgtttaca 1140

gcaggcccac gatttacgaa cataactcaa aacatggcaa ggcagctaga tatcgcactg 1200

gccgattttt tattatatat gtataatacc agaatccaag ttcagtatgg accgactgga 1260

gaatccttag attttagaat tggtcgtgga cagtatgatt gtaacgtatt tcgcgccaac 1320

tttcaaacgg gtacgggata taatggttgg ggtttagttg atgttgaaaa cagggaacca 1380

gcgccctatg atcatgcaca acggtatata cgatattgca atatagactc acgagaactg 1440

atacatccag ccacatttgg tattggtatg aattaccatt gttataatga aatgttgagg 1500

atgttagttg ctgcgggtaa ggacacagaa gctgcatttt tccggaatat gttaccgttt 1560

catatggtcc gatttgctcg tataaatcag gtaataaatg aagatttaca ctcagctttc 1620

tcgatgccag atgatcagtt taacgtgtta ttagcgaata tgatggtagg ccagcaagaa 1680

aggattgacc cggtgatatt ggatataagt tggatctcaa tttggtacgc tttcaataga 1740

tcttttgagc cgatccgtcg aaacgaaatg ctggaaagtg cgccgctaat cgagtcggtc 1800

tatgcctcag aattgacagt tatgaagacg gatatgcagc agatggccct attacagcgc 1860

cgtttcccag atgttttaat tgaagcccgt cccacgcatt tctggaaagc tgttatggag 1920

gtatcaccag agcctgtacg agcgatcatg gatttagcgc attcacatag ctttatcaac 1980

atccgagata tgatgaggtg gataggtttg ccttcgatgc agaattccat gaagttggtg 2040

ctagaagaag aagcttgggc ggtggctaat gatttcgaag aattgatgct gactgatcag 2100

gtgtatatgt accgtgatat gcttccggaa ccaaggttag atgatataga gagattcagg 2160

caagagggat tctactacac taatatgttg gatgggccgc ctgcgatcga tcgagtggtt 2220

caatatacgt atgaggtggc acgattacag gcaaatatgg gacaactacg agcggcgtta 2280

cggaggatta tggatgacga aggatgggtt agattcggag gtgtactacg aactgtacgg 2340

attaaattct tcgactcacg tccacccgaa gaaatccttc aagcattacc ttttgattac 2400

cagacaaatg agaagggcgg attgacttat gccacaatca aatatgcgaa tgataccaca 2460

atatattatt taatctataa tgttgagtat tcaaatttac ctgattcctt agttttaatc 2520

aatcctactt atgtgatgac caaagttttt ataaataaac gaatagtaga gagggttcga 2580

gtgggacaag cgttggccgt aatgaataaa agatttatag catttaaagg aaagatgcga 2640

attatggata taacgcaagc gctcaaggtg ggcaccaagc tagcggcgcc gaccgtgtag 2700

<210> 2

<211> 1050

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggacacga ttgctgcgag agctctaaca gtgatcaaag cttgtaacac tctaaaagag 60

gtaagaattg tagtggagtc caatgtcttg gagatattag ggacagcagt taatagatat 120

aacggattga ctctaagatc agttacgatg cgaccaactt cgcaggaaca acggaatgaa 180

atgttctata tgtgtctaga tatgatatta gcagcagcaa atctaaatgt aggaaatatt 240

tcccctgatt acatacaaaa tttggcaacg atcggggtgt tggcgacgcc agaaatacca 300

tatacgatgg aatccgcgaa cgaaattgct cgaatgagcg gggagacagg aacctggggg 360

ccggatcgtc aacctttcgg ctattttttg gcagcgccag aagttaccca acatgggcgg 420

ttcagacagc gagttggcca gaatgttact acatcaatcg tatcctcgac tttagctcag 480

gtttcaatga atgctggggc acggggtgat atccaggcgc tatttcaaaa tcaaaatgat 540

cctgtaatga tttactttgt gtggagacga attgggactt tttcgaatgc agcgggtaat 600

gcacaagata cacctcaggg cgtgactctg aacgtggggg gtgtaaacat gagggctggt 660

gtgataatag cttatgatgg gcaagcgccg gttaatgtga ataacccagg tctaggacaa 720

ggtatgatcg agattgaagt gatctattat ttgagtttag acaaaaccat gacccagtat 780

ccatcattac aagcacatat attcaatgtt tactcatata agaatccttt gtggcatgga 840

ctacgagctg cgattcttaa cagaacaacg ctaccaaaca atataccgcc catttatccg 900

cctcatgatc gcgagaacgt tttgttgata atattgctgt cagctttagc agatgccttt 960

agcgtattgg cgccagactt taacttattt ggtgtagtac ctatacaagg tccgattaat 1020

agggctgttg cacaaaacgc ctatgtgtga 1050

Claims

1. A preparation method of an EHDV blocking ELISA antibody detection kit is characterized by comprising the following steps:

step 1) enzyme label plate preparation: coating EHDV CLPs (extracellular domain-binding proteins) to an ELISA plate, wherein the EHDV CLPs are hollow particles formed by assembling EHDV VP3 and VP7 proteins;

step 2) enzyme-labeled antibody preparation: using a group specific monoclonal antibody of horseradish peroxidase (HRP) marked anti-EHDV VP7 protein as an enzyme-labeled antibody;

the step 1) is specifically as follows: diluting the EHDV CLPs to 1.25 mu g/mL by using 0.2M Tris hydrochloric acid coating solution with pH8.0, adding 100 mu L of each well, coating for 12h at 4 ℃, adding 200 mu L of blocking solution containing 3% BSA after washing, blocking for 2h at 37 ℃, and storing after washing;

the concentration dilution of the enzyme-labeled antibody in the step 2) is 1: 6000;

the EHDV CLPs are specifically prepared by carrying out recombinant expression on VP3 shown in SEQ ID NO.1 and VP7 shown in SEQ ID NO. 2; the preparation method comprises the steps of sequentially inserting an EHDV vp3 gene and a vp7 gene into a vector pFastBac^TMDual, construct recombinant plasmid pFastBac-Dual-vp3-vp 7; transforming a recombinant plasmid pFastBac-Dual-vp3-vp7 with correct sequencing into DH10Bac, and screening by blue white spots and colony PCR to obtain a recombinant baculovirus plasmid Bacmid-vp3-vp 7; transfecting a recombinant baculovirus plasmid Bacmid-vp3-vp7 into Sf9 cells; sf9 cells were harvested and purified by discontinuous sucrose density gradient ultracentrifugation.

2. An EHDV blockade ELISA antibody detection kit, prepared by the method of claim 1.

3. The blocking ELISA antibody detection kit of claim 2, characterized in that: the kit also comprises 0.1mg/mL of TMB color development solution and 2M sulfuric acid solution stop solution.

4. The blocking ELISA antibody detection kit of claim 3, characterized in that: the kit also includes positive control serum and negative control serum: the positive control serum is EHDV positive bovine serum determined by a commercial kit; the negative control serum is healthy bovine serum without EHDV and without vaccination.

5. Use of an EHDV blockade ELISA antibody detection kit of any one of claims 2-4 in the preparation of a product for detecting an EHDV infection or a vaccinated test sample.

6. The use according to claim 5, wherein the detection is: adding 100 μ L of PBST diluted serum to be detected into each well at a dilution ratio of 1:5, and incubating at 37 deg.C for 90 min; PBST wash 3 times; add 100. mu.L 1:6000 dilution of HRP-labeled anti-EHDV VP7 monoclonal antibody, and incubating at 37 ℃ for 45 min; PBST wash 3 times; adding 100 μ L TMB substrate into each well, incubating at room temperature in dark for 10min, adding 50 μ L stop solution 2M H into each well₂SO₄The reaction is stopped, and the enzyme-linked immunosorbent assay (OD) is read by an enzyme-linked immunosorbent assay (ELISA) instrument₄₅₀Calculating a blocking rate PI value;

when the blocking rate PI is more than or equal to 24.36 percent, the test sample is judged to be positive; judging the PI is negative when the PI is less than or equal to 19.74 percent; if the PI is less than 19.74% < PI < 24.36%, the test is judged to be suspicious, the test is repeated for 1 time, and if the PI is still less than 24.36%, the test is judged to be negative for serum antibodies.

7. The use of claim 6, wherein the serum to be tested is ruminant serum infected with a wild strain or administered with a conventional EHDV attenuated vaccine, inactivated vaccine or administered with a non-EHDV VP7 deletion vaccine.