CN113046358A

CN113046358A - Special encoding gene for recombinant protamine and preparation method thereof

Info

Publication number: CN113046358A
Application number: CN202110267035.1A
Authority: CN
Inventors: 李招发; 邱丹丹
Original assignee: Huaqiao University
Current assignee: Huaqiao University
Priority date: 2021-03-10
Filing date: 2021-03-10
Publication date: 2021-06-29

Abstract

The invention provides a special encoding gene for protamine and a preparation method thereof, wherein the special encoding gene comprises the following steps: continuously connecting the coding genes by using a cytoglobin mutant (CYGBm) and an artificially synthesized Pro gene and adopting isocaudarner BamHI and BglII to ensure that the final length of the Pro gene is 8 times of the initial length, constructing a coding gene vector pET22b-CYGBm-8Pro, and transforming to obtain an engineering bacterium BL21-pET22b-CYGBm-8 Pro; in turn, 100. mu.l/ml (Amp)⁺) Culturing with LB culture medium, culturing with lactose induction culture medium, collecting thallus, repeatedly freezing and thawing, washing, collecting precipitate, denaturing, desalting, renaturating, and purifying with column chromatography to obtain recombinantThe proteins CYGBm-8Pro and CNBr are cracked to obtain recombinant Pro; the method can effectively obtain the recombinant protamine, and the obtained recombinant protamine has good bacteriostatic effect.

Description

Special encoding gene for recombinant protamine and preparation method thereof

Technical Field

The invention relates to the field of biological gene engineering, in particular to a special encoding gene for recombinant protamine and a method for preparing the recombinant protamine by using the encoding gene.

Background

The spermary tissue of mature male fish is called milt, and is mostly discarded or used as waste due to the peculiar smell. The Protamine contains Protamine (Pro), which is also called Protamine, the type and quantity of amino acid are different according to different fish species, the Protamine is polycationic peptide consisting of 30-50 amino acids, arginine is taken as the main part, and mature testis tissues of various male fishes are tightly combined with DNA with negative electricity. Since McClean et al reported that protamine can inhibit the growth of E.typhi in 1937, and Miller et al discovered that protamine can inhibit the respiratory metabolism of various aerobic bacteria and anaerobic bacteria to affect the growth and reproduction of the bacteria, the bacteriostatic action of protamine has received much attention. Protamine has a good bacteriostatic action and shows a suppression effect on staphylococcus aureus, saccharomycetes, mould, escherichia coli, bacillus subtilis and streptococcus tetrastigrinus, and currently, protamine bacteriostatic activity is generally considered to be that a large amount of arginine exists in molecules of protamine, positive charge guanidyl in the arginine and negative charges of cell wall peptidoglycan generate an electrostatic action, and the protamine can be specifically combined with cell membranes although the length, the protein peptide and the secondary structure of the protamine are different, so that the cell membranes form channels or large apertures, and compounds in the cells flow out. Protamine destroys the cell membrane structure, and destroys the energy metabolism-related electron transport system and substance transport system, thereby causing the whole cell to fail to operate normally. As an alternative to chemical preservatives, they are increasingly emerging in the food additive line. Protamine is used as a green preservative in the food industry, and repeated freezing and thawing can be easily caused by temperature fluctuation of high-protein food in the traditional storage and transportation process, so that a large amount of microorganisms are bred to cause spoilage, and the texture and the mouthfeel of the high-protein food are greatly influenced. The protamine has good fresh-keeping effect, and provides a new technology for the application of high-protein products in fresh keeping. Protamine is used as a heparin unique antagonist, can better enable heparin to lose anticoagulant effect in extracorporeal circulation surgery, and is particularly effective under the condition of no anticoagulant property of heparin.

Disclosure of Invention

The invention mainly aims to provide a special encoding gene CYGBm-8Pro for recombinant protamine, wherein the base sequence of the encoding gene is shown as SEQ ID NO: shown at 9.

Another objective of the invention is to provide a method for preparing recombinant protamine by using the special encoding gene for recombinant protamine, which comprises the following steps:

(1) mutating cytoglobin CYGB by adopting an overlapping PCR method to obtain cytoglobin mutant CYGBm;

(2) continuously connecting a cytoglobin mutant CYGBm and an artificially synthesized protamine Pro gene by adopting isocaudarner BamHI and BglII to ensure that the length of the final protamine coding gene is 7-9 times of the initial length, and carrying out heat excitation and transformation to BL21 competence after connecting with a vector pET22b to obtain engineering bacteria BL21-pET22b-CYGBm-8 Pro;

(3) selecting engineering bacteria BL21-pET22b-CYGBm-8Pro which are proved to be correct, and screening high-expression strains;

(4) selecting the high-expression strain screened in the step (3) to culture in a culture medium, and collecting thalli;

(5) sequentially treating the thalli collected in the step (4) by using inclusion body lysate, washing solution and dissolving solution to obtain dissolving solution containing target protein;

(6) separating and purifying the dissolved solution containing the target protein to obtain the target protein CYGBm-8 Pro.

In the invention, in the step (1), except for the initiation codon, all codons ATG corresponding to methionine in CYGB are mutated into codons ATC corresponding to isoleucine to obtain CYGBm.

In a preferred embodiment of the present invention, in the step (4), the strain with the highest expression level is selected from (3) selecting 100. mu.l/ml (Amp)⁺) Culturing in LB culture medium for 16h, inoculating into lactose inducing culture medium with inoculum size of 7.5%, inducing and culturing at 37 deg.C for 30h, centrifuging lactose inducing bacteria liquid at 4 deg.C and 10000rpm for 20min, collecting thallus, removing supernatant, and storing the precipitate at-80 deg.C.

In a preferred embodiment of the invention, in the step (5) of the method, the bacterial precipitates collected in the step (4) are weighed, and the collected bacterial precipitates are repeatedly frozen and thawed at-80 ℃ and 4 ℃ for 3 or 4 times, wherein the weight ratio of the collected bacterial precipitates to the total weight of the total: 10, adding an inclusion body lysate, suspending thalli in ice, carrying out ice bath ultrasound, carrying out ultrasound with the power of 200W for 5s and 5s intermittently, storing for 20min at 4 ℃ in a refrigerator after 30 cycles, carrying out ultrasound according to the conditions, and repeating the steps for 3-4 times. Centrifuging at 4 deg.C and 10000rpm for 20min, discarding supernatant, weighing precipitate, adding inclusion body washing solution by 3 times volume, resuspending precipitate, washing in ice for 10min, and centrifuging at 4 deg.C and 10000rpm for 20 min. This was repeated 3 and 4 times. And weighing the final washing centrifugal precipitate, adding a proper inclusion body dissolving solution, re-suspending the precipitate, gently shaking in an ice bath for 1h, and standing overnight in a refrigerator at 4 ℃ to fully dissolve the precipitate. Centrifuging at 4 deg.C and 10000rpm for 20min, discarding precipitate, keeping supernatant, and storing at 4 deg.C in refrigerator.

In the preferred embodiment of the present invention, in step (6), the lysate is subjected to preliminary impurity removal by Sephadex G-25 using 20mM Tris-HCl (pH8.0) as an eluent, and the received solution is further purified by a heparin sepharose column, sequentially eluted with 50mM NaCl-20mM Tris-HCl (pH8.0), 0.2M NaCl-20mM Tris-HCl (pH8.0), 0.5M NaCl-20mM Tris-HCl (pH8.0), 1M NaCl-20mM Tris-HCl (pH8.0), and 1.5M NaCl-20mM Tris-HCl (pH8.0) buffers. Separating and purifying the target protein-containing receiving solution by a CM cation agarose gel chromatographic column, sequentially eluting 50mM NaCl-20mM Tris-HCl (pH8.0), 0.2M NaCl-20mM Tris-HCl (pH8.0), 0.5M NaCl-20mM Tris-HCl (pH8.0), 1M NaCl-20mM Tris-HCl (pH8.0) and 1.5M NaCl-20mM Tris-HCl (pH8.0) buffer solutions, and desalting the target protein CYGBm-8 Pro-containing eluent by an ultrafiltration tube.

In a preferred embodiment of the present invention, in the method step (5), the cell lysate: 1.22g Tris-HCl, 5.85g NaCl, 0.075g EDTA, 3.3mL 30% Triton X100, adding 150mL ultrapure water to dissolve, adjusting the pH to 8.0, and diluting to 200 mL. Filtering with 0.22 μm filter membrane, and storing at 4 deg.C. Inclusion body wash: 3.1g Tris-HCl, 14.63g NaCl, 0.186g EDTA, 8.3mL 30% Triton X100, 60.2g urea were weighed, dissolved in 400mL ultrapure water, the pH was adjusted to 8.0, and the volume was adjusted to 500 mL. Filtering with 0.22 μm filter membrane, and storing at 4 deg.C. Inclusion body dissolution solution: 3.1g Tris-HCl, 14.63g NaCl, 0.186g EDTA, 242.5g urea were weighed, dissolved in 400mL ultrapure water, the pH was adjusted to 8.0, and the volume was adjusted to 500 mL. Filtering with 0.22 μm filter membrane, and preparing in situ.

In a preferred embodiment of the present invention, the Sephadex G-25 chromatography conditions in the method are: the Binding Buffer and the Elution Buffer are both 20mM Tris, pH8.0. The heparin sepharose affinity chromatography conditions are as follows: the Binding Buffer is 20mM Tris, pH8.0, the Elution Buffer is 50mM NaCl, 20mM Tris, pH 8.0; 0.2M NaCl, 20mM Tris, pH 8.0; 0.5M NaCl, 20mM Tris, pH 8.0; 1M NaCl, 20mM Tris, pH 8.0; 1.5M NaCl, 20mM Tris, pH 8.0. The CM cation agarose gel chromatographic column conditions are as follows: binding Buffer is 20mM Tris, pH8.0, and Elution Buffer is 50mM NaCl, 20mM Tris, pH8.0; 0.2M NaCl, 20mM Tris, pH 8.0; 0.5M NaCl, 20mM Tris, pH 8.0; 1M NaCl, 20mM Tris, pH 8.0; 1.5M NaCl, 20mM Tris, pH 8.0.

In a preferred embodiment of the invention, said method is a method wherein the purified fusion protein CYGBm-8Pro obtained in step (6) is subjected to CNBr cleavage, in particular: placing the purified fusion protein CYGBm-8Pro in a fume hood, adding 0.2M concentrated hydrochloric acid to obtain CNBr with the final concentration of 50mg/ml in the fume hood, cracking for 24h at room temperature in a dark place, and then adding equal volume of ddH2O to inactivate the CNBr; and desalting and purifying by adopting a G-25 molecular sieve with the flow rate of 3mL/min to obtain the recombinant protamine, wherein the balance liquid and the eluent used for desalting and purifying are deionized water.

6. The method of producing protamine according to claim, wherein the gene encoding protamine comprises: the LB culture medium: 10g/L of Tryptone,5g/L of Yeast Extarch and 10g/L of NaCl; a lactose culture medium: 12g/L Tryptone,15g/L Yeast Extearct, 3g/L KH₂PO₄,7g/L K₂HPO₄2.5g/L NaCl,2g/L glucose, 0.7g/L lactose, 0.27g/L MgSO₄。

The invention has the beneficial effects that: cytoglobin (CYGB) is a new member of the globin family, discovered in 2001 as a result of its synergistic effect with hepatic stellate cells, and was named Cytoglobin in 2002. Because the CYGB protein has extremely high expression quantity in the escherichia coli, the invention realizes the high-efficiency expression of the target protein by means of the CYGB protein. In the invention, all codons ATG corresponding to methionine in CYGB are mutated into codons ATC corresponding to isoleucine (except for an initial codon) to obtain CYGBm; and in the subsequent purification process, CNBr is used for cutting methionine sites in CYGB-protamine so as to crack the protamine. Meanwhile, in order to increase the copy number of the protamine, the final protamine coding gene is 7-9 times (preferably 8 times) the initial length by utilizing continuous connection of the isocaudarner BamHI and BglII, and the special CYGBm-8Pro coding gene is constructed. Therefore, the invention provides a special encoding gene for protamine and discloses a method for preparing fused protamine by using the encoding gene, the encoding gene can effectively prepare the obtained fused protamine, the CNBr cracking is carried out, the mass preparation of the recombinant protamine is easy to realize, and the obtained recombinant protamine has the bacteriostatic effect.

Drawings

The invention is further illustrated by the following figures and examples.

FIG. 1 is a flow chart of the site-directed mutagenesis CYGB of the overlap extension PCR of the present invention

FIG. 2 is a scheme showing the construction of pET22b-CYGBm-8Pro plasmid according to the present invention

FIG. 3 shows the separation and purification of G-25 glucan column in the present invention

FIG. 4 shows the separation and purification of heparin-Sepharose column according to the invention

FIG. 5 is a CM cation sepharose column separation purification of the present invention

FIG. 6 shows the bacteriostatic activity of recombinant protamine of different concentrations in the present invention

FIG. 7 is a graph showing the change in pH during storage of recombinant protamine-treated shrimp according to the present invention

FIG. 8 is a graph showing the change in TVB-N value during storage of recombinant protamine-treated shrimp according to the present invention.

Detailed Description

The present invention will be further illustrated by the following examples, but is not limited thereto. The molecular biological experimental techniques used in the following examples include PCR amplification, plasmid extraction, plasmid transformation, and enzyme digestion. Example 1 construction of encoding Gene specific for protamine

1.1 construction of pET22b-CYGBm plasmid (the construction process is shown in FIG. 1)

All codons ATG corresponding to methionine in CYGB are mutated into codons ATC corresponding to isoleucine (except for an initiation codon) to obtain CYGBm. Designing a primer: according to the sequence of CYGB and the site to be mutated, 8 primers are designed, and the sequences of the primers are as follows:

SEQ ID NO.1:5’-AACATATGGAGAAAGTGCCAGGCGAG-3’

SEQ ID NO.2:5’-GGCCCAGATAGCCTGCACCGCCTTCC-3’

SEQ ID NO.3:5’-CGGTGCAGGCTATCTGGGCCCGGCTC-3’

SEQ ID NO.4:5’-CTCCAGGGGATCTTCGATGTGCTTGAACTGGC-3’

SEQ ID NO.5:5’-CACATCGAAGATCCCCTGGAGATCGAGCGGAGC-3’

SEQ ID NO.6:5’-GAGGGCCCCGATGACTCGGCAGGCGTGC-3’

SEQ ID NO.7:5’-GCCGAGTCATCGGGGCCCTCAACAC-3’

SEQ ID NO.8:5’-CAGGATCCCGGCCCCGAAGAGGGCAGTG-3’

PCR was performed using a plasmid pET22b-CYGB stored in the laboratory as a template (CYGB from HepG2 cells), SEQ ID NO.1 as the upstream and SEQ ID NO.6 as the downstream to obtain fragments 1-6. PCR was performed using SEQ ID NO.7 as the upstream and SEQ ID NO.8 as the downstream to obtain fragments 7-8. After running nucleic acid electrophoresis, purified fragments 1-6 and 7-8 were recovered. The fragments (1-8)67 were obtained by PCR using the recovered fragments 1-6 and 7-8 as templates, SEQ ID NO.1 as the upstream and SEQ ID NO.8 as the downstream. After running the nucleic acid electrophoresis, the purified fragment (1-8)67 was recovered. The fragments 1 to 4 are obtained by PCR using the recovered fragment (1 to 8)67 template, with SEQ ID NO.1 as the upstream and SEQ ID NO.4 as the downstream. PCR was performed using SEQ ID NO.5 as the upstream and SEQ ID NO.8 as the downstream to obtain fragments 5-8. After running nucleic acid electrophoresis, purified fragments 1-4 and 5-8 were recovered. The fragments (1-8)45 are obtained by PCR using the recovered fragments 1-4 and 5-8 as templates, SEQ ID NO.1 as the upstream and SEQ ID NO.8 as the downstream. After running the nucleic acid electrophoresis, the purified fragment (1-8)45 was recovered. And (3) carrying out PCR by using the recovered fragment (1-8)45 template, using SEQ ID NO.1 as an upstream and SEQ ID NO.2 as a downstream to obtain a fragment 1-2. PCR was performed using SEQ ID NO.3 as the upstream and SEQ ID NO.8 as the downstream to obtain fragments 3-8.After running nucleic acid electrophoresis, purified fragments 1-2 and 3-8 were recovered. And (3) carrying out PCR by taking the recovered fragments 1-2 and 3-8 as templates, taking SEQ ID NO.1 as an upstream and taking SEQ ID NO.8 as a downstream to obtain a fragment (1-8)23, namely CYGBm. CYGBm and pET22b were digested simultaneously with NdeI/EcoRI, and the fragments of interest were gel-recovered and ligated to construct pET22b-CYGBm (the construction process is shown in FIG. 1). Plasmid pET22b-CYGBm was competent mix with BL21, heat-shocked at 42 ℃ and transformed at 37 ℃ with 100. mu.l/ml (Amp)⁺) LB plate culture for 20 hours, selecting single clone colony to screen by PCR method and double enzyme digestion method, positive clone is named as engineering bacterium BL21-pET22 b-CYGBm.

Wherein, the PCR reaction system is (the total volume of the system is 50 mul): ddH 2037. mu.l, 10 XPyrobest Buffer 5. mu.l, 5. mu.M forward primer 1.3. mu.l, 5. mu.M reverse primer 1.3. mu.l, dNTPs 4. mu.l, template plasmid pET22b-CYGB 1. mu.l, Pyrobest 0.3. mu.l. PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min for 10s, and circulation for 30 times; 10min at 72 ℃; storing at 4 ℃. Enzyme digestion system (total system volume 10 μ l): 10 XH buffer 1. mu.l; 8.4. mu.l of a CYGBm fragment or pET22b plasmid; nde I0.3 μ l; xho I0.3. mu.l. Enzyme cutting conditions are as follows: carrying out water bath at 37 ℃ for 4-5 h. Enzyme linked system (total system volume 10. mu.l): 10 XLigase buffer 1. mu.L; pET22b 1 μ L, CYGBm 7 μ L; t4DNA ligase 1. mu.L. The reaction conditions were 16 ℃ overnight (14h), and the recombinant plasmid was transformed into E.coli DH 5. alpha. strain by heat shock transformation for selection.

1.2 engineering bacteria BL21-pET22b-CYGBm-8Pro

The pET22b-CYGBm plasmid was constructed and stored from a laboratory preliminary stage. Protamine (Pro) gene is synthesized by Shanghai Bioengineering Co., Ltd, and the synthesized Protamine gene is inserted into a conventional pUC57 cloning vector to obtain pUC57-Pro plasmid. plasmid pUC57-Pro and pET22b were digested with NdeI/EcoRI, and Pro was ligated to pET22b to construct pET22 b-Pro. pET22b-Pro was digested with NdeI/BamHI and NdeI/BglII, and the fragments were gel-recovered and ligated to construct pET22b-2 Pro. pET22b-2Pro was digested with NdeI/BamHI and NdeI/BglII, and the fragments were gel-recovered and ligated to construct pET22b-4 Pro. pET22b-4Pro was digested with NdeI/BamHI and NdeI/BglII enzymesThe fragments of (A) were gel-recovered and ligated to construct pET22b-8 Pro. pET22b-CYGBm and pET22b-8Pro were digested with NdeI/BamHI and NdeI/BglII, and the fragments were gel-recovered and ligated to construct pET22b-CYGBm-8Pro (the construction process is shown in FIG. 2). Plasmid pET22b-CYGBm-8Pro was competently mixed with BL21, heat-shocked at 42 ℃ and transformed at 37 ℃ with 100. mu.l/ml (Amp)⁺) LB plate culture for 20 hours, selecting single clone colony to screen by PCR method and double enzyme digestion method, positive clone is named as engineering bacterium BL21-pET22b-CYGBm-8 Pro.

Wherein, the PCR reaction system (the total volume of the system is 20 mul): 14.4. mu.l of ddH2O 14.4, 2. mu.l of 10 XPCR buffer, 2.5. mu.M of primer T71. mu.l, 1. mu.l of 2.5. mu.M of primer T7 Ter, 1. mu.l of dNTP, 0.3. mu.l of rTaq enzyme, 0.3. mu.l of template, and the template is a single colony (i.e., a single colony obtained by heat-shock transformation of the pET22b-CYGBm-8Pro plasmid into DH 5. alpha. competence at 42 ℃). PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, annealing at 46 ℃ for 30s, extension at 72 ℃ for 1min for 30s, and circulation for 25 times; 10min at 72 ℃; storing at 4 ℃. The following steps: primer T7: TAATACGACTCACTATAGG (SEQ ID NO: 4); primer T7 Ter: GCTAGTTATTGCTCAGCGG (SEQ ID NO: 5). Double restriction enzyme identification system (total system volume is 10 μ l): 10 × Hbuffer 1 μ l; the expression vector pET22b-CYGB-Pro 8.4 mul; nde I0.3 μ l; xho I0.3. mu.l. Enzyme cutting conditions are as follows: carrying out water bath at 37 ℃ for 4-5 h. Enzyme linked system (total system volume 10. mu.l): 10 XLigase buffer 1. mu.L; pET22b 1 μ L, CYGBm 7 μ L; t4DNA ligase 1. mu.L. The reaction conditions were 16 ℃ overnight (14h), and the recombinant plasmid was transformed into E.coli DH 5. alpha. strain by heat shock transformation for selection.

Example 2 preparation of protamine from encoding Gene specific for protamine

The method for preparing protamine by using the protamine special encoding gene obtained by the construction of the embodiment 1 comprises the following specific operations:

(1) the engineered bacterium BL21-pET22b-CYGBm-8Pro constructed in example 1 was picked up at 100. mu.l/ml (Amp)⁺) LB medium was cultured for 16h, and the ratio of 1: inoculating 100 volume ratio into a lactose culture medium for inducing for 30h, and screening high expression strains. The high expression strain is subjected to lactose-induced expression for 30h at 31 ℃, 33 ℃, 35 ℃, 37 ℃ and 39 ℃ respectively, and the influence of temperature on protein-induced expression is researched. Height ofThe expression amount of the strain is respectively subjected to lactose induced expression for 30h by the inoculation amounts of 2.5%, 5%, 7.5%, 10% and 12.5%, and the influence of the inoculation amount on protein induced expression is researched.

(2) Selecting the strain with the highest expression quantity in step (1), culturing the strain in 100 mu l/ml (Amp +) LB culture medium for 16h, inoculating the strain into lactose induction culture medium according to the inoculum size of 7.5%, carrying out induction culture at 37 ℃ for 30h, centrifuging lactose induction bacterial liquid at 4 ℃ and 10000rpm for 20min, collecting thalli, discarding supernatant, and storing the precipitate at-80 ℃;

wherein, LB culture medium: 10g/L of Tryptone,5g/L of Yeast Extarch and 10g/L of NaCl; lactose induction medium: 15g/L Tryptone, 12g/L Yeast Extarch, 3g/L NaH2PO 4.2H2O, 7g/L K2HPO 4.3H2O, 2.5g/LNaCl, 0.2% glucose, 2.1mM lactose, 0.05% MgSO 4.7H2O.

(3) And (3) weighing the thallus precipitate collected in the step (2), repeatedly freezing and thawing the collected thallus precipitate at-80 ℃ and 4 ℃ for 3 or 4 times, and mixing the collected thallus precipitate with water according to the weight ratio of 1: 10, adding an inclusion body bacteria-breaking liquid, suspending thalli in ice, carrying out ice bath ultrasound, carrying out ultrasound with the power of 200W for 5s, carrying out 5s intermission, storing for 20min in a refrigerator at 4 ℃ after 30 cycles, carrying out ultrasound according to the conditions, and repeating the steps for 3-4 times. Centrifuging at 4 deg.C and 10000rpm for 20min, discarding supernatant, weighing precipitate, adding inclusion body washing solution by 3 times volume, resuspending precipitate, washing in ice for 10min, and centrifuging at 4 deg.C and 10000rpm for 20 min. This was repeated 3 and 4 times. And weighing the final washing centrifugal precipitate, adding a proper inclusion body dissolving solution, re-suspending the precipitate, gently shaking in an ice bath for 1h, and standing overnight in a refrigerator at 4 ℃ to fully dissolve the precipitate. Centrifuging at 4 deg.C and 10000rpm for 20min, discarding precipitate, keeping supernatant, and storing at 4 deg.C in refrigerator.

Wherein the bacterial lysate: 1.22g Tris-HCl, 5.85g NaCl, 0.075g EDTA, 3.3mL 30% Triton X100, adding 150mL ultrapure water to dissolve, adjusting the pH to 8.0, and diluting to 200 mL. Filtering with 0.22 μm filter membrane, and storing at 4 deg.C. Inclusion body wash: 3.1g Tris-HCl, 14.63g NaCl, 0.186g EDTA, 8.3mL 30% Triton X100, 60.2g urea were weighed, dissolved in 400mL ultrapure water, the pH was adjusted to 8.0, and the volume was adjusted to 500 mL. Filtering with 0.22 μm filter membrane, and storing at 4 deg.C. Inclusion body dissolution solution: 3.1g Tris-HCl, 14.63g NaCl, 0.186g EDTA, 242.5g urea were weighed, dissolved in 400mL ultrapure water, the pH was adjusted to 8.0, and the volume was adjusted to 500 mL. Filtering with 0.22 μm filter membrane, and preparing in situ.

(4) The lysate was subjected to preliminary Sephadex G-25 decontamination using 20mM Tris-HCl (pH8.0) as eluent (FIG. 3). The received solution was further purified by a heparin Sepharose column chromatography, and sequentially eluted with 50mM NaCl-20mM Tris-HCl (pH8.0), 0.2M NaCl-20mM Tris-HCl (pH8.0), 0.5M NaCl-20mM Tris-HCl (pH8.0), 1M NaCl-20mM Tris-HCl (pH8.0), and 1.5M NaCl-20mM Tris-HCl (pH8.0) buffers (as shown in FIG. 4). The target protein-containing receiving solution was separated and purified by CM cation Sepharose chromatography, and eluted sequentially with 50mM NaCl-20mM Tris-HCl (pH8.0), 0.2M NaCl-20mM Tris-HCl (pH8.0), 0.5M NaCl-20mM Tris-HCl (pH8.0), 1M NaCl-20mM Tris-HCl (pH8.0), and 1.5M NaCl-20mM Tris-HCl (pH8.0), and the eluate finally containing the target protein CYGBm-8Pro was desalted by an ultrafiltration tube (see FIG. 5).

Wherein, the SepHadex G-25 chromatographic conditions are as follows: the Binding Buffer and the Elution Buffer are both 20mM Tris, pH8.0. The conditions of the heparin sepharose gel chromatographic column are as follows: the Binding Buffer is 20mM Tris, pH8.0, the Elution Buffer is 50mM NaCl, 20mM Tris, pH 8.0; 0.2M NaCl, 20mM Tris, pH 8.0; 0.5M NaCl, 20mM Tris, pH 8.0; 1M NaCl, 20mM Tris, pH 8.0; 1.5M NaCl, 20mM Tris, pH 8.0. The CM cation agarose gel chromatographic column conditions are as follows: binding Buffer is 20mM Tris, pH8.0, and Elution Buffer is 50mM NaCl, 20mM Tris, pH8.0; 0.2M NaCl, 20mM Tris, pH 8.0; 0.5M NaCl, 20mM Tris, pH 8.0; 1M NaCl, 20mM Tris, pH 8.0; 1.5M NaCl, 20mM Tris, pH 8.0.

(5) CNBr cracking is carried out on the purified fusion protein CYGBm-8Pro obtained in the step (4), and concretely: placing the purified fusion protein CYGBm-8Pro in a fume hood, adding 0.2M concentrated hydrochloric acid to obtain CNBr with the final concentration of 50mg/ml in the fume hood, cracking for 24h at room temperature in a dark place, and then adding equal volume of ddH2O to inactivate the CNBr; and desalting and purifying by adopting a G-25 molecular sieve with the flow rate of 3mL/min to obtain the recombinant protamine, wherein the balance liquid and the eluent used for desalting and purifying are deionized water.

EXAMPLE 3 verification of the bacteriostatic Activity of the protamine obtained

The bacteriostatic activity of the protamine obtained in the embodiment 2 is as follows: the bacteriostatic activity of the purified recombinant protamine solution on Escherichia coli (culture temperature 37 ℃, rotation speed 220rpm) is detected by using different concentrations (338 mu g/mL, 169 mu g/mL, 84.5 mu g/mL, 42.25 mu g/mL, 21.12 mu g/mL, 10.563 mu g/mL, 5.28 mu g/mL, 2.64 mu g/mL), and the higher the concentration of the purified recombinant protamine, the stronger the bacteriostatic activity is, thereby proving that the recombinant protamine has the bacteriostatic activity (as shown in FIG. 6).

Example 4 application of the protamine obtained in shrimp storage

The application of the protamine obtained in the embodiment 2 in shrimp storage comprises the following specific steps:

(1) TVB-N value determination method: weighing 5g of untreated shrimp tails soaked by 21.12 mu g/mL recombinant protamine, cutting the shrimp tails into fine pieces by using clean scissors, putting the shrimp tails into a triangular flask containing 50mL of recombinant protamine, adding 50mL of deionized water, stirring for shaking at intervals, soaking for 30min, filtering, and storing the filtrate at 4 ℃ in a refrigerator for later use, wherein the storage time is not suitable for too long. 5-6 drops of indicator liquid are added into a beaker containing 10ml of 2% boric acid solution, the beaker is placed at the lower end of a condenser tube, and the lower end of the condenser tube is inserted below the liquid level of the absorbent liquid in the beaker. Sucking the sample filtrate into a distillation flask, adding 5ml of 1% magnesium oxide, rapidly adding a plug, sealing tightly, wrapping cotton on the outer end of a cold static tube, heating and distilling for 30min to stop distilling, titrating the absorption liquid with 0.0100N hydrochloric acid standard solution, and stopping titrating when the endpoint is blue-purple. The amount of hydrochloric acid standard solution was recorded. Meanwhile, a blank experiment is carried out, and the content of the volatile basic nitrogen is calculated according to the dosage of the hydrochloric acid standard solution.

(2) The pH value measuring method comprises the following steps: weighing 5g of untreated shrimp tails infiltrated with 21.12 mu g/mL of recombinant protamine, placing the shrimp tails into a mortar after shearing, grinding the sample into muddy flesh, adding 50mL of distilled water, fully stirring, filtering to obtain filtrate, and measuring the pH value by using a pH meter.

(3) The pH value of the fish processed by protamine and untreated and the TVB-N value are measured every 24h, and the pH value is generally more than 7, and the TVB-N value is more than 20mg/100g, so that the fish cannot be eaten. The protamine treated samples were stored at 4 ℃ for longer periods than the untreated samples (as shown in FIGS. 7 and 8).

SEQ ID NO.1:5’-AACATATGGAGAAAGTGCCAGGCGAG-3’

SEQ ID NO.2:5’-GGCCCAGATAGCCTGCACCGCCTTCC-3’

SEQ ID NO.3:5’-CGGTGCAGGCTATCTGGGCCCGGCTC-3’

SEQ ID NO.4:5’-CTCCAGGGGATCTTCGATGTGCTTGAACTGGC-3’

SEQ ID NO.5:5’-CACATCGAAGATCCCCTGGAGATCGAGCGGAGC-3’

SEQ ID NO.6:5’-GAGGGCCCCGATGACTCGGCAGGCGTGC-3’

SEQ ID NO.7:5’-GCCGAGTCATCGGGGCCCTCAACAC-3’

SEQ ID NO.8:5’-CAGGATCCCGGCCCCGAAGAGGGCAGTG-3’

SEQ ID NO.9(CYGBm-8Pro)：

CATATGGAGAAAGTGCCAGGCGAGATCGAGATCGAGCGCAGGGAGCGGAGCGAGGAGCTGTCCGAGGCGGAGAGGAAGGC GGTGCAGGCTATCTGGGCCCGGCTCTATGCCAACTGCGAGGACGTGGGGGTGGCCATCCTGGTGAGGTTCTTTGTGAACT TCCCCTCGGCCAAGCAGTACTTCAGCCAGTTCAAGCACATCGAGGATCCCCTGGAGATCGAGCGGAGCCCCCAGCTGCGG AAGCACGCCTGCCGAGTCATCGGGGCCCTCAACACTGTCGTGGAGAACCTGCATGACCCCGACAAGGTGTCCTCTGTGCT CGCCCTTGTGGGGAAAGCCCACGCCCTCAAGCACAAGGTGGAACCGGTGTACTTCAAGATCCTCTCTGGGGTCATTCTGG AGGTGGTCGCCGAGGAATTTGCCAGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGCGTGGCCTCATCTAC AGCCACGTGACCGCTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGGTCCCCAACGCCACCACCCCACCGGCCACACTGCC CTCTTCGGGGCCGAGATCCATGCCTCGTCGCAGACGCTCTTCATCTCGTCCGGTTCGCCGAAGACGTCGTCCTCGTGTCA GTCGCAGACGTCGTCGTCGCGGTGGAAGACGCCGTCGAAGATCCATGCCTCGTCGCAGACGCTCTTCATCTCGTCCGGTT CGCCGAAGACGTCGTCCTCGTGTCAGTCGCAGACGTCGTCGTCGCGGTGGAAGACGCCGTCGAAGATCCATGCCTCGTCG CAGACGCTCTTCATCTCGTCCGGTTCGCCGAAGACGTCGTCCTCGTGTCAGTCGCAGACGTCGTCGTCGCGGTGGAAGAC GCCGTCGAAGATCCATGCCTCGTCGCAGACGCTCTTCATCTCGTCCGGTTCGCCGAAGACGTCGTCCTCGTGTCAGTCGC AGACGTCGTCGTCGCGGTGGAAGACGCCGTCGAAGATCCATGCCTCGTCGCAGACGCTCTTCATCTCGTCCGGTTCGCCG AAGACGTCGTCCTCGTGTCAGTCGCAGACGTCGTCGTCGCGGTGGAAGACGCCGTCGAAGATCC ATGCCTCGTCGCAGACGCTCTTCATCTCGTCCGGTTCGCCGAAGACGTCGTCCTCGTGTCAGTCGCAGACGTCGTCGTCG CGGTGGAAGACGCCGTCGAAGATCCATGCCTCGTCGCAGACGCTCTTCATCTCGTCCGGTTCGCCGAAGACGTCGTCCTC GTGTCAGTCGCAGACGTCGTCGTCGCGGTGGAAGACGCCGTCGAAGATCCATGCCTCGTCGCAGACGCTCTTCATCTCGT CCGGTTCGCCGAAGACGTCGTCCTCGTGTCAGTCGCAGACGTCGTCGTCGCGGTGGAAGACGCCGTCGATAAGAATTC 。

Sequence listing

<110> university of Chinese

<120> a special coding gene for recombinant protamine and preparation method

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aacatatgga gaaagtgcca ggcgag 26

<210> 2

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggcccagata gcctgcaccg ccttcc 26

<210> 3

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggtgcaggc tatctgggcc cggctc 26

<210> 4

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctccagggga tcttcgatgt gcttgaactg gc 32

<210> 5

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cacatcgaag atcccctgga gatcgagcgg agc 33

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gagggccccg atgactcggc aggcgtgc 28

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gccgagtcat cggggccctc aacac 25

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caggatcccg gccccgaaga gggcagtg 28

<210> 9

<211> 1422

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

catatggaga aagtgccagg cgagatcgag atcgagcgca gggagcggag cgaggagctg 60

tccgaggcgg agaggaaggc ggtgcaggct atctgggccc ggctctatgc caactgcgag 120

gacgtggggg tggccatcct ggtgaggttc tttgtgaact tcccctcggc caagcagtac 180

ttcagccagt tcaagcacat cgaggatccc ctggagatcg agcggagccc ccagctgcgg 240

aagcacgcct gccgagtcat cggggccctc aacactgtcg tggagaacct gcatgacccc 300

gacaaggtgt cctctgtgct cgcccttgtg gggaaagccc acgccctcaa gcacaaggtg 360

gaaccggtgt acttcaagat cctctctggg gtcattctgg aggtggtcgc cgaggaattt 420

gccagtgact tcccacctga gacgcagaga gcctgggcca agctgcgtgg cctcatctac 480

agccacgtga ccgctgccta caaggaagtg ggctgggtgc agcaggtccc caacgccacc 540

accccaccgg ccacactgcc ctcttcgggg ccgagatcca tgcctcgtcg cagacgctct 600

tcatctcgtc cggttcgccg aagacgtcgt cctcgtgtca gtcgcagacg tcgtcgtcgc 660

ggtggaagac gccgtcgaag atccatgcct cgtcgcagac gctcttcatc tcgtccggtt 720

cgccgaagac gtcgtcctcg tgtcagtcgc agacgtcgtc gtcgcggtgg aagacgccgt 780

cgaagatcca tgcctcgtcg cagacgctct tcatctcgtc cggttcgccg aagacgtcgt 840

cctcgtgtca gtcgcagacg tcgtcgtcgc ggtggaagac gccgtcgaag atccatgcct 900

cgtcgcagac gctcttcatc tcgtccggtt cgccgaagac gtcgtcctcg tgtcagtcgc 960

agacgtcgtc gtcgcggtgg aagacgccgt cgaagatcca tgcctcgtcg cagacgctct 1020

tcatctcgtc cggttcgccg aagacgtcgt cctcgtgtca gtcgcagacg tcgtcgtcgc 1080

ggtggaagac gccgtcgaag atccatgcct cgtcgcagac gctcttcatc tcgtccggtt 1140

cgccgaagac gtcgtcctcg tgtcagtcgc agacgtcgtc gtcgcggtgg aagacgccgt 1200

cgaagatcca tgcctcgtcg cagacgctct tcatctcgtc cggttcgccg aagacgtcgt 1260

cctcgtgtca gtcgcagacg tcgtcgtcgc ggtggaagac gccgtcgaag atccatgcct 1320

cgtcgcagac gctcttcatc tcgtccggtt cgccgaagac gtcgtcctcg tgtcagtcgc 1380

agacgtcgtc gtcgcggtgg aagacgccgt cgataagaat tc 1422

Claims

1. A special encoding gene CYGBm-8Pro for recombinant protamine, the base sequence of which is shown as SEQ ID NO: shown at 9.

2. A method for preparing recombinant protamine by using a special encoding gene for the recombinant protamine comprises the following steps:

3. The method of claim 2, wherein: in the step (1), mutation is to obtain CYGBm by mutating all codons ATG corresponding to methionine in CYGB to codons ATC corresponding to isoleucine except for the initiation codon.

4. The method of claim 2, wherein: in the step (1), PCR is carried out by taking pET22b-CYGB as a template, SEQ ID NO.1 as an upstream and SEQ ID NO.6 as a downstream to obtain segments 1-6; PCR is carried out by taking SEQ ID NO.7 as an upstream and SEQ ID NO.8 as a downstream to obtain a segment 7-8; recovering purified fragments 1-6 and 7-8 after nucleic acid electrophoresis; PCR is carried out by taking the recovered fragments 1-6 and 7-8 as templates, taking SEQ ID NO.1 as an upstream and taking SEQ ID NO.8 as a downstream to obtain a fragment (1-8) 67; recovering purified fragments (1-8)67 after nucleic acid electrophoresis; PCR is carried out to obtain segments 1-4 by taking the recovered segment (1-8)67 template, SEQ ID NO.1 as an upstream and SEQ ID NO.4 as a downstream; PCR is carried out by taking SEQ ID NO.5 as an upstream and SEQ ID NO.8 as a downstream to obtain a fragment 5-8; recovering purified fragments 1-4 and 5-8 after nucleic acid electrophoresis; using the recovered fragments 1-4 and 5-8 as templates, using SEQ ID NO.1 as an upstream and SEQ ID NO.8 as a downstream, and carrying out PCR to obtain a fragment (1-8) 45; recovering purified fragments (1-8)45 after nucleic acid electrophoresis; using the recovered fragment (1-8)45 template, using SEQ ID NO.1 as an upstream and SEQ ID NO.2 as a downstream, and carrying out PCR to obtain a fragment 1-2; PCR is carried out by taking SEQ ID NO.3 as an upstream and SEQ ID NO.8 as a downstream to obtain a fragment 3-8; recovering purified fragments 1-2 and 3-8 after nucleic acid electrophoresis; and (3) carrying out PCR by taking the recovered fragments 1-2 and 3-8 as templates, taking SEQ ID NO.1 as an upstream and taking SEQ ID NO.8 as a downstream to obtain a fragment (1-8)23, namely CYGBm.

5. The method of claim 2, wherein: in the step (4), selecting (3) the strain with the highest expression level to be screened out at 100 mu l/ml Amp⁺Culturing in LB culture medium for 16h, inoculating into lactose inducing culture medium with inoculum size of 7.5%, inducing and culturing at 37 deg.C for 30h, centrifuging lactose inducing bacteria liquid at 4 deg.C and 10000rpm for 20min, collecting thallus, removing supernatant, and storing the precipitate at-80 deg.C.

6. The method of claim 2, wherein: in the step (5), the thallus precipitate collected in the step (4) is weighed, and the collected thallus precipitate is repeatedly frozen and thawed for 3 and 4 times at minus 80 ℃ and 4 ℃, and the weight ratio of the collected thallus precipitate to the total weight of the thallus precipitate is 1: 10, adding an inclusion body lysate, suspending thalli in ice, carrying out ice bath ultrasound, carrying out ultrasound with the power of 200W for 5s, carrying out 5s intermission, storing for 20min in a refrigerator at 4 ℃ after 30 cycles, carrying out ultrasound according to the conditions, and repeating the steps for 3-4 times; centrifuging at 4 deg.C and 10000rpm for 20min, discarding supernatant, weighing precipitate, adding inclusion body washing solution according to 3 times volume amount, resuspending precipitate, washing in ice for 10min, centrifuging at 4 deg.C and 10000rpm for 20 min; repeating the steps for 3 and 4 times; weighing the final washing centrifugal precipitate, adding a proper inclusion body dissolving solution, re-suspending the precipitate, gently shaking in an ice bath for 1h, and standing overnight in a refrigerator at 4 ℃ to fully dissolve; centrifuging at 4 deg.C and 10000rpm for 20min, discarding precipitate, keeping supernatant, and storing at 4 deg.C in refrigerator.

7. The method of claim 2, wherein: primarily removing impurities from the dissolved solution in the step (6) by SepHadex G-25, wherein the eluent is 20mM Tris-HCl and pH8.0, the receiving solution is purified by a heparin sepharose gel chromatographic column, and the eluent is sequentially eluted by 50mM NaCl-20mM Tris-HCl, pH8.0, 0.2M NaCl-20mM Tris-HCl, pH8.0, 0.5M NaCl-20mM Tris-HCl, pH8.0, 1M NaCl-20mM Tris-HCl, pH8.0, 1.5M NaCl-20mM Tris-HCl and pH8.0; separating and purifying the target protein-containing receiving solution by a CM cation agarose gel chromatographic column, sequentially eluting 50mM NaCl-20mM Tris-HCl, pH8.0, 0.2M NaCl-20mM Tris-HCl, pH8.0, 0.5M NaCl-20mM Tris-HCl, pH8.0, 1M NaCl-20mM Tris-HCl, pH8.0, 1.5M NaCl-20mM Tris-HCl and pH8.0 buffer solution, and desalting the target protein CYGBm-8Pro contained eluent by an ultrafiltration tube.

8. The method of claim 2, wherein: the thallus lysate in the step (5) is as follows: 1.22g of Tris-HCl, 5.85g of NaCl, 0.075g of EDTA and 3.3mL of 30% Triton X100, adding 150mL of ultrapure water for dissolving, adjusting the pH value to 8.0, and fixing the volume to 200 mL; filtering with 0.22 μm filter membrane, and storing at 4 deg.C; the inclusion body washing solution is: weighing 3.1g of Tris-HCl, 14.63g of NaCl, 0.186g of EDTA, 8.3mL of 30% triton X100 and 60.2g of urea, adding 400mL of ultrapure water for dissolving, adjusting the pH value to 8.0, and fixing the volume to 500 mL; filtering with 0.22 μm filter membrane, and storing at 4 deg.C; the inclusion body dissolving solution is as follows: weighing 3.1g of Tris-HCl, 14.63g of NaCl, 0.186g of EDTA and 242.5g of urea, adding 400mL of ultrapure water for dissolving, adjusting the pH value to 8.0, and fixing the volume to 500 mL; filtering with 0.22 μm filter membrane, and preparing in situ.

9. The method of claim 7, wherein: the SepHadex G-25 chromatographic conditions are as follows: the Binding Buffer and the Elution Buffer are both 20mM Tris, pH8.0; the heparin sepharose affinity chromatography conditions are as follows: the Binding Buffer is 20mM Tris, pH8.0, the Elution Buffer is 50mM NaCl, 20mM Tris, pH 8.0; 0.2M NaCl, 20mM Tris, pH 8.0; 0.5M NaCl, 20mM Tris, pH 8.0; 1M NaCl, 20mM Tris, pH 8.0; 1.5M NaCl, 20mM Tris, pH 8.0; the CM cation agarose gel chromatographic column conditions are as follows: binding Buffer is 20mM Tris, pH8.0, and Elution Buffer is 50mM NaCl, 20mM Tris, pH8.0; 0.2M NaCl, 20mM Tris, pH 8.0; 0.5M NaCl, 20mM Tris, pH 8.0; 1M NaCl, 20mM Tris, pH 8.0; 1.5M NaCl, 20mM Tris, pH 8.0.

10. The method of claim 2, wherein: in the step (6), CNBr cracking is carried out on the purified fusion protein CYGBm-8 Pro: placing the purified fusion protein CYGBm-8Pro in a fume hood, adding concentrated hydrochloric acid with the concentration of 0.2M and CNBr with the final concentration of 50mg/ml in the fume hood, cracking for 24 hours at room temperature in a dark place, and then adding ddH2O with the same volume to inactivate the CNBr; and desalting and purifying by adopting a G-25 molecular sieve with the flow rate of 3mL/min to obtain the recombinant protamine, wherein the balance liquid and the eluent used for desalting and purifying are deionized water.