CN113025691B

CN113025691B - Pre-amplification nucleic acid and application thereof

Info

Publication number: CN113025691B
Application number: CN202110575231.5A
Authority: CN
Inventors: 张�浩
Original assignee: Guangdong Pinbo Yishi Biotechnology Co ltd
Current assignee: Guangdong Pinbo Yishi Biotechnology Co ltd
Priority date: 2021-05-26
Filing date: 2021-05-26
Publication date: 2021-08-06
Anticipated expiration: 2041-05-26
Also published as: CN113025691A

Abstract

The invention discloses a preamplification nucleic acid and application thereof, wherein the preamplification nucleic acid comprises a 5 'end base sequence, a first complementary region, a repetitive sequence, a second complementary region and a 3' end base sequence; the 5 'end base sequence, the first complementary region, the repetitive sequence, the second complementary region and the 3' end base sequence are connected in sequence; the first complementary region and the second complementary region are paired; the base sequence at the 5 'end and the base sequence at the 3' end are both paired with a detection probe; the difference between the Tm value of the base sequence at the 5 'end and the Tm value of the base sequence at the 3' end is less than or equal to 1 ℃; pairing the repetitive sequence with a labeled probe or an amplifier; the preamplification nucleic acid is used for carrying out signal amplification detection on the target nucleic acid; through the pairing of the first complementary region and the second complementary region, the repeated sequence forms a stem-loop secondary structure, so that the amplification factor can be increased, meanwhile, the secondary structure of the pre-amplified nucleic acid is more stable, and a background signal generated by non-specific hybridization is not easy to increase, so that the signal-to-noise ratio of detection is improved.

Description

Pre-amplification nucleic acid and application thereof

Technical Field

The invention relates to a pre-amplification nucleic acid and application thereof, belonging to the technical field of molecular biology.

Background

The PCR technology is used for nucleic acid detection by taking an amplified target to be detected as a means, but is easily influenced by nonspecific hybridization and pollution to generate a false positive result. The nineties of the last century invented the bDNA technology, which hybridized to the target nucleic acid through a probe set, and then amplified the signal through the cascade hybridization of pre-amplifying and amplifying two single-stranded nucleic acids, avoiding the generation of false positives.

The bDNA technology uses one end of single-stranded preamplification nucleic acid to be hybridized with a detection probe, and the other end of the single-stranded preamplification nucleic acid is a short repetitive sequence; then one end of the single-stranded amplifier is hybridized with the short repeat sequence of the preamplified nucleic acid, and the other end of the single-stranded amplifier is also the short repeat sequence which can be used for combining a certain labeled probe. In this way, the bDNA technique allows amplification of the detection signal without amplification of the target nucleic acid as in PCR, thereby avoiding false positives of detection. However, since the hybridization complex is too large, it cannot be stabilized by simple hybridization of 20-30 bases, the amplification is limited in practical application, and the background problem is caused to decrease the signal-to-noise ratio, so that the b-DNA technology cannot be widely used as the PCR technology.

Disclosure of Invention

In order to overcome the defects of the prior art, the first object of the present invention is to provide a pre-amplifying nucleic acid, wherein the first complementary region and the second complementary region are paired, the repeated sequence forms a stem-loop secondary structure, so that the amplification factor can be increased, and the secondary structure of the pre-amplifying nucleic acid is more stable and is not easy to increase the background signal generated by non-specific hybridization, so as to improve the signal-to-noise ratio of the detection.

The second object of the present invention is to provide a use of the above-mentioned preamplified nucleic acid.

The first purpose of the invention can be achieved by adopting the following technical scheme: a preamplified nucleic acid comprising a 5 'terminal base sequence, a first complementary region, a repeat sequence, a second complementary region, and a 3' terminal base sequence; the 5 'end base sequence, the first complementary region, the repetitive sequence, the second complementary region and the 3' end base sequence are connected in sequence; the first complementary region and the second complementary region are paired; the base sequence at the 5 'end and the base sequence at the 3' end are both paired with a detection probe; the difference between the Tm value of the base sequence at the 5 'end and the Tm value of the base sequence at the 3' end is less than or equal to 1 ℃; the repeat sequence is paired with a labeled probe or amplifier.

Furthermore, the complementary binding site of the 5 'end base sequence and the 3' end base sequence is less than or equal to 4 continuous bases; the complementary binding sites of the first complementary region and the second complementary region and the 5' end base sequence are respectively less than or equal to 4 continuous bases; the complementary binding sites of the first complementary region and the second complementary region with the 3' end base sequence are respectively less than or equal to 4 continuous bases.

Further, the 5 '-end base sequence and the 3' -end base sequence cannot be complementarily combined.

Further, the Tm values of the first complementary region and the second complementary region differ from the Tm value of the base sequence at the 5 'end or the base sequence at the 3' end by not more than 1 ℃.

Further, the length of the 5 '-end base sequence and the 3' -end base sequence is 20 to 40 bases.

Further, the first and second complementary regions are each 26-34 bases in length.

Further, both the Tm value of the base sequence at the 5 'end and the Tm value of the base sequence at the 3' end are 65 to 67 ℃.

Further, the base sequence at the 5 'end and the base sequence at the 3' end are each paired with an independent detection probe.

Further, the repeated sequence is at least 5 segments.

Further, the repetitive sequence is 5-160 segments.

Further, the repetitive sequence is 18 to 25 bases.

The second purpose of the invention can be achieved by adopting the following technical scheme: use of a preamplifying nucleic acid as described above for signal amplification detection of a target nucleic acid.

Further, the signal amplification detection of the target nucleic acid comprises:

a first hybridization step: binding one end of the detection probe to the target nucleic acid;

a second hybridization step: combining the other end of the detection probe with the 5 'end base sequence and/or the 3' end base sequence of the preamplified nucleic acid, and combining the first complementary sequence and the second complementary sequence of the preamplified nucleic acid in a pairing way;

a third hybridization step: binding a labeled probe to the repeat sequence of the preamplified nucleic acid; or the amplifier is bound to the repeat sequence of the preamplifiers and then the label probe is bound to the amplifier.

Further, the first hybridization step is: reacting the immobilized target nucleic acid and the detection probe at 38-45 ℃ for 1-16h under the conditions of 6 XSSC, 25-50wt% formamide, 50mg/uL heparin, 1mg/mL tRNA and 0.1-0.5wt% SDS; the second hybridization step is: adding preamplified nucleic acid, and reacting at 38-45 deg.C for 1-2h under the conditions of 5 XSSC, 25-50wt% formamide, and 0.1-0.5wt% SDS.

Further, the method also comprises the following determination steps: after the third hybridization step is completed, the labeled signal of the labeled probe is detected, whereby a quantitative value of the target nucleic acid is obtained.

The design principle of the invention is as follows:

the amplification factor of the preamplified nucleic acid used in the prior bDNA technology is only about 5-20 times, which is mainly limited by two aspects, one is that the length of the preamplified nucleic acid cannot be continuously increased (the amplification factor is increased) under the common hybridization conditions and temperature because the paired segment of the preamplified nucleic acid neutralizing detection probe generally has only 20-40 bases, and the total length of the preamplified nucleic acid is about 150-700 bases, because only one end of the preamplified nucleic acid is connected with the detection probe, and the rest part is in a free state and is unstable in the reaction process, thereby causing the instability of the whole complex. Secondly, longer single stranded DNA leads to more severe non-specific hybridization, increasing background signal, and thus detection cannot be improved even if the amplification of the detection signal is increased, because the signal-to-noise ratio is not improved. Therefore, the total amplification factor of the existing bDNA signal amplification technology can only reach 500-4000 times, and the sensitivity of nucleic acid detection can not be compared with that of PCR.

According to the application, the first complementary region and the second complementary region are paired, the repeated sequence between the first complementary sequence and the second complementary sequence forms a stem-loop-shaped secondary structure, both ends of the 5 'end base sequence and the 3' end base sequence of the pre-amplified nucleic acid are connected with the detection probe, the stem-loop structure of the pre-amplified nucleic acid is more stable than that of the traditional linear primary structure in that only one end of the pre-amplified nucleic acid is connected with the detection probe, the immobilization is better and not in a free state during reaction, the background signal generated by non-specific hybridization is not easy to increase, and therefore the signal-to-noise ratio of detection is improved. And the repetitive sequence of the structure can be in multiple sections, so that the magnification can be increased, a longer pre-amplified nucleic acid is formed, and the magnification is greatly improved.

Compared with the prior art, the invention has the beneficial effects that:

1. the pre-amplified nucleic acid is paired through the first complementary region and the second complementary region, and the repeated sequence between the first complementary region and the second complementary region forms a stem-loop secondary structure, so that the amplification factor can be increased, and meanwhile, the secondary structure is more stable and is not easy to increase background signals generated by non-specific hybridization, so that the signal-to-noise ratio of detection is improved;

2. the length of the repetitive sequence of the preamplified nucleic acid can be adjusted without limitation, so that the signal amplification factor can be greatly increased;

3. the preamplification nucleic acid is used for signal amplification detection of target nucleic acid, and has a good application prospect.

Drawings

FIG. 1 is a schematic diagram of an embodiment pre-amplification nucleic acid;

FIG. 2 is a schematic diagram of an embodiment of binding a label probe to an amplifier;

FIG. 3 is a schematic diagram of a conventional linear pre-amplifier nucleic acid;

FIG. 4 is a diagram showing the detection of the localization and expression amount of mRNA of the PPIB gene in a comparative example;

FIG. 5 is a graphic representation of the localization and expression of mRNA of PPIB gene detected in example 1;

FIG. 6 is a diagram showing the detection of the localization and expression amount of mRNA of ARBP gene in comparative example;

FIG. 7 is a graphic representation of the localization and expression of mRNA of ARBP gene detected in example 2;

in the figure, the nucleotide sequence of L1 and 5' end; a1, first complementary region; C. a repeat sequence; a2, second complementary region and L2; a 3' -terminal base sequence; d1, detection probe; d2, detection probe; d3, labeled probe; d4, amplifier; t, target nucleic acid; l, a binding domain.

Detailed Description

The invention will be further described with reference to the accompanying drawings and the detailed description below:

as shown in FIG. 1, a preamplified nucleic acid comprises a base sequence L1 at the 5 'end, a first complementary region A1, a repetitive sequence C, a second complementary region A2 and a base sequence L2 at the 3' end; the 5 'end base sequence L1, the first complementary region A1, the repetitive sequence C, the second complementary region A2 and the 3' end base sequence L2 are connected in sequence;

the complementary binding site of the 5 'end base sequence L1 and the 3' end base sequence L2 is less than or equal to 4 continuous bases, and the optimal mode is a region without complementary binding; first complementary region a1 and second complementary region a2 are paired; the complementary binding sites of the first complementary region A1 and the second complementary region A2 and the 5' terminal base sequence L1 are respectively less than or equal to 4 continuous bases; the complementary binding sites of the first complementary region A1 and the second complementary region A2 and the 3' terminal base sequence L2 are respectively less than or equal to 4 continuous bases; to avoid the preamplifiers from forming self-complementary binding that results in failure to bind to the detection probes; the Tm values of the first complementary region A1 and the second complementary region A2 are different from the Tm value of the 5 '-end base sequence L1 or the 3' -end base sequence L2 by not more than 1 ℃; the length of the first complementary region and the second complementary region is 26-34 bases;

the 5 'end base sequence L1 and the 3' end base sequence L2 are respectively paired with an independent detection probe D1 and D2; the difference between the Tm value of the 5 '-end base sequence L1 and the Tm value of the 3' -end base sequence L2 is not more than 1 ℃; the length of the 5 'end base sequence L1 and the length of the 3' end base sequence L2 are both 20-40 bases; both the Tm value of the 5 '-terminal base sequence L1 and the Tm value of the 3' -terminal base sequence L2 were 65 to 67 ℃ (Na + was 50mM, probe concentration was 250 pM);

the repeat sequence C is paired with a label probe D3 or an amplifier D4; the repetitive sequence C is at least 5 segments, and each segment is 18-25 bases.

The preamplification nucleic acid is applied to signal amplification detection of target nucleic acid T (including but not limited to DNA, RNA, mRNA, LncRNA and the like) and comprises the following steps:

target nucleic acid immobilization step: target nucleic acid is captured (fixed) on the surfaces of a micro-porous plate, a magnetic bead, a chip or a hybridization film and the like by a known biochemical method, and then is washed at normal temperature to remove various impurities;

a first hybridization step: reacting the immobilized target nucleic acid and a detection probe (Capture extender) for 1-16h at 38-45 ℃ under the conditions of 6 XSSC, 25-50wt% formamide, 50mg/uL heparin, 1mg/mL tRNA and 0.1-0.5wt% SDS to combine one end of the detection probe with the target nucleic acid;

a second hybridization step: adding preamplifiers to react for 1-2h at 38-45 ℃ under the conditions of 5 XSSC, 25-50wt% formamide and 0.1-0.5wt% SDS, wherein the other end of the detection probe is combined with the base sequence at the 5 'end and/or the base sequence at the 3' end of the preamplifiers, and the first complementary sequence and the second complementary sequence of the preamplifiers are combined in a pairing way; washing at normal temperature to remove non-hybridized monomers;

a third hybridization step: binding labeled probes (Label probes) to the repetitive sequence of the preamplified nucleic acid with 50 ℃ as the hybridization temperature and the rest of the parameter conditions being conventional DNA-DNA hybridization conditions; or binding an amplifier to the repeat sequence of the preamplifiers and then binding a label probe to the amplifiers (as shown in FIG. 2); washing off un-hybridized matter at normal temperature;

the determination step comprises: after the third hybridization step is completed, the labeled signal of the labeled probe is detected, whereby a quantitative value of the target nucleic acid is obtained.

In the currently commonly used in situ detection and capture detection of nucleic acid, the preamplified nucleic acid and the probe only have an L binding region (as shown in FIG. 3), and finally form a linear binding, which has two problems, namely, as the sequence of the repetitive fragment is lengthened and the stability is reduced, generally only 20-30 repeats (500-800 bases) are limited, even if the signal is increased, the signal is reduced; secondly, the single-stranded nucleic acid structure, especially in situ hybridization, the longer the sequence, the more prone it is to non-specifically bind to cytoplasmic components, resulting in increased background signal and decreased signal-to-noise ratio, so the typical old design magnification is usually not more than 20 times. The preamplified nucleic acid has a 5 'end base sequence and a 3' end base sequence which are combined with a detection probe, a closed loop structure is actually formed, the stability of a combined body is improved, and a stem-loop structure which is very stable and is common in natural nucleic acid is formed by complementary pairing of a first complementary region and a second complementary region, so that even if a repeated sequence is very long (5-160 sections are repeated), the linear amplification factor can be stably displayed.

Example 1:

human PPIB (NM — 00942) gene mRNA expression was detected on sections using fluorescently labeled marker probes:

the structures of the preamplifiers used are as follows:

the 5 ' -terminal base sequence L1 was 5 ' cgagtgtatattctccgaagataatcgt3 ' (SEQ ID NO. 1) (Tm value: 65 ℃);

the 3 ' -terminal base sequence L2 was 5 ' agcgtgtcttattagtccctagagaaat3 ' (SEQ ID NO. 2) (Tm value: 66 ℃);

the first complementary region A1 was 5 'gaatgttttgaaagttatagatagtccgagc 3' (SEQ ID NO. 3) (Tm 65 ℃);

the second complementary region A2 was 5 'gctcggactatctataactttcaaaacattc 3' (SEQ ID NO. 4) (Tm 65 ℃);

repeat C is 5 'aagcatgcaaacccaatc 3' (SEQ ID No. 5) (set to 10, 80, 160, respectively);

the pre-amplification nucleic acid is applied to signal amplification detection of target nucleic acid, and the steps are as follows:

target nucleic acid immobilization step: preparing a human lung tissue paraffin section by a conventional method, and performing conventional treatments such as dewaxing, boiling pretreatment, protease digestion and the like;

a first hybridization step: reacting the immobilized target nucleic acid and the detection probe (final concentration: 3 uM) in the presence of 6 XSSC, 40wt% formamide, 50mg/uL heparin, 1mg/mL tRNA, 0.2wt% SDS at 40 ℃ for 2 h; the 5' end of the detection probe binds to the target nucleic acid;

the detection probes are grouped into two and six in three groups, and the sequence (5 '-3') is as follows, including a region (lower case sequence part) which is combined with the target nucleic acid and a region (upper case sequence part) which is combined with the preamplification nucleic acid:

detection probe D1-1: cggacagctgaggccACGATTATCTTCGGAGAATATACACTCG (SEQ ID NO. 6);

detection probe D2-1: ggaggcgaaagcagccATTTCTCTAGGGACTAATAAGACACGCT (SEQ ID NO. 7);

detection probe D1-2: cgcagcatccacaggcACGATTATCTTCGGAGAATATACACTCG (SEQ ID NO. 8);

detection probe D2-2: tcatgttgcgttcggagaggATTTCTCTAGGGACTAATAAGACACGCT (SEQ ID NO. 9);

detection probe D1-3: cggcggcaaggagcacctACGATTATCTTCGGAGAATATACACTCG (SEQ ID NO. 10);

detection probe D2-3: ggaccccgcgatgagggATTTCTCTAGGGACTAATAAGACACGCT (SEQ ID NO. 11);

the target nucleic acid sequence bound to the detection probe D1-1 is the PPIB base 131-145 ggcctcagctgtccg (SEQ ID NO. 12);

the target nucleic acid sequence bound to the detection probe D2-1 is the ggctgctttcgcctcc (SEQ ID NO. 13) at the 146-161 of PPIB;

the target nucleic acid sequence bound to the detection probe D1-2 was the PPIB 162-177 base gcctgtggatgctgcg (SEQ ID NO. 14);

the target nucleic acid sequence bound to the detection probe D2-2 was the 178-197 base cctctccgaacgcaacatga (SEQ ID NO. 15) of PPIB;

the target nucleic acid sequence bound to the detection probe D1-3 was the PPIB base aggtgctccttgccgccg (SEQ ID NO. 16) from 198-215;

the target nucleic acid sequence combined with the detection probe D2-3 is ccctcatcgcggggtcc (SEQ ID NO. 17) of the 216 th and 232 th bases of PPIB;

a second hybridization step: adding preamplifiers and reacting at 40 ℃ for 1.5h under the conditions of 5 XSSC, 40wt% formamide and 0.2wt% SDS, wherein the 3 'end of the detection probe D1-1 is combined with the 5' end base sequence of the preamplifiers, the 3 'end of the detection probe D2-1 is combined with the 3' end base sequence of the preamplifiers, the first complementary sequence and the second complementary sequence of the preamplifiers are combined in a matched mode, the detection probe D1-2 and the detection probe D2-2 are combined with another independent preamplifiers, the detection probe D1-3 and the detection probe D2-3 are combined with another independent preamplifiers, and three preamplifiers are used in total in example 1; washing at normal temperature to remove non-hybridized monomers;

a third hybridization step: binding a labeled probe (probe sequence 5 'gattgggtttgcatgtt 3' SEQ ID NO.18 labeled with Alexa-488 fluorescent dye) to the repeat sequence of the preamplified nucleic acid with 2 XSSC, 40wt% formamide, 0.3wt% SDS at 50 ℃ as the hybridization temperature; washing off un-hybridized matter at normal temperature;

the determination step comprises: after the third hybridization step is completed, the fluorescence intensity is observed under a fluorescence microscope, whereby a quantitative value of the target nucleic acid is obtained.

The comparative example was set to 5' -terminal base sequence + repeat sequence (repeat sequences were set to 10, 80, and 160, respectively) using a linear conventional preamplifying nucleic acid, human-derived PPIB (NM — 00942) gene mRNA expression was detected using the same method as in example 1, and the results are shown in table 1:

table form

Comparison of test results of comparative example and example 1

As a result, it can be seen that the experimental results are more stable (CV values are reduced) and the signal to noise ratio is increased after the stem-loop structure is increased in example 1 as compared with the comparative example. The advantages of this embodiment are not obvious at 10 times pre-magnification. As the pre-magnification is increased to 80-160 times, the signal value and the signal-to-noise ratio are far superior to those of the comparative examples, and thus the examples can detect the target nucleic acid more sensitively and stably.

FIG. 4 shows the localization and expression of PPIB gene mRNA measured by the comparative example (80-fold magnification), and FIG. 5 shows the localization and expression of PPIB gene mRNA measured by example 1 (80-fold magnification). As can be seen from fig. 4, although the signal is detectable, the signal is very weak after background subtraction. Whereas the signal of example 1 is much enhanced.

Example 2:

rat-derived ARBP (NM-022402) gene mRNA expression was detected on sections using alkaline phosphatase-labeled probes:

using rat kidney sections, the pre-amplified nucleic acid sequence was identical to that of example 1, and the procedure was carried out as in example 1. The labeled probe was the same as in example 1, and an alkaline phosphatase-labeled probe was used. In the measurement step, a normal temperature color reaction is performed using an alkaline phosphatase specific substrate fast red.

detection probe D1-4: cacattgtctgctcccacaatGGAGAATATACACTCG (SEQ ID NO. 19);

detection probe D2-4: tgctgcatctgcttggagccATTTCTCTAGGGACTAATAAGACACGCT (SEQ ID NO. 20);

detection probe D1-5: cgcggagggacatgcggatcACGATTATCTTCGGAGAATATACACTCG (SEQ ID NO. 21);

detection probe D2-5: ccatcagcaccacagccttccATTTCTCTAGGGACTAATAAGACACGCT (SEQ ID NO. 22);

detection probe D1-6: gcgcatcatggtgttcttgcACGATTATCTTCGGAGAATATACACTCG (SEQ ID NO. 23);

detection probe D2-6: tggccccggatggccttATTTCTCTAGGGACTAATAAGACACGCT (SEQ ID NO. 24);

the target nucleic acid sequence bound to the detection probe D1-4 is ARBP base ATTGTGGGAGCAGACAATGTG (SEQ ID NO. 25) at 158-178;

the target nucleic acid sequence bound to the detection probe D2-4 was ARBP 179 th and 198 th bases GGCTCCAAGCAGATGCAGCA (SEQ ID NO. 26);

the target nucleic acid sequence that binds to the detection probe D1-5 is ARBP 199-218 base GATCCGCATGTCCCTCCGCG (SEQ ID NO. 27);

the target nucleic acid sequence bound to the detection probe D2-5 is ARBP position 219-239 base GGAAGGCTGTGGTGCTGATGG (SEQ ID NO. 28);

the target nucleic acid sequence bound to the detection probe D1-6 is ARBP position 240-259 base CAAGAACACCATGATGCGC (SEQ ID NO. 29);

the target nucleic acid sequence that binds to the detection probe D2-6 is ARBP base 260-276 base AAGGCCATCCGGGGCCA (SEQ ID NO. 30).

FIG. 6 shows the localization and expression amount of mRNA of ARBP gene measured by comparative example (160-fold magnification), and FIG. 7 shows the localization and expression amount of mRNA of ARBP gene measured by example 2 (160-fold magnification). As can be seen from fig. 6, although the signal is detectable, the signal is very weak after background subtraction. Whereas the signal of example 2 is much enhanced.

Various other changes and modifications to the above-described embodiments and concepts will become apparent to those skilled in the art from the above description, and all such changes and modifications are intended to be included within the scope of the present invention as defined in the appended claims.

Sequence listing

<110> Guangdong article Boyi Vision Biotechnology Ltd

<120> a preamplification nucleic acid and uses thereof

<130> 2021

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 1

cgagtgtata ttctccgaag ataatcgt 28

<210> 2

<211> 28

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 2

agcgtgtctt attagtccct agagaaat 28

<210> 3

<211> 31

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 3

gaatgttttg aaagttatag atagtccgag c 31

<210> 4

<211> 31

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 4

gctcggacta tctataactt tcaaaacatt c 31

<210> 5

<211> 18

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 5

aagcatgcaa acccaatc 18

<210> 6

<211> 43

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 6

cggacagctg aggccacgat tatcttcgga gaatatacac tcg 43

<210> 7

<211> 44

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 7

ggaggcgaaa gcagccattt ctctagggac taataagaca cgct 44

<210> 8

<211> 44

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 8

cgcagcatcc acaggcacga ttatcttcgg agaatataca ctcg 44

<210> 9

<211> 48

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 9

tcatgttgcg ttcggagagg atttctctag ggactaataa gacacgct 48

<210> 10

<211> 46

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 10

cggcggcaag gagcacctac gattatcttc ggagaatata cactcg 46

<210> 11

<211> 45

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 11

ggaccccgcg atgagggatt tctctaggga ctaataagac acgct 45

<210> 12

<211> 15

<212> DNA

<213> PPIB

<400> 12

ggcctcagct gtccg 15

<210> 13

<211> 16

<212> DNA

<213> PPIB

<400> 13

ggctgctttc gcctcc 16

<210> 14

<211> 16

<212> DNA

<213> PPIB

<400> 14

gcctgtggat gctgcg 16

<210> 15

<211> 20

<212> DNA

<213> PPIB

<400> 15

cctctccgaa cgcaacatga 20

<210> 16

<211> 18

<212> DNA

<213> PPIB

<400> 16

aggtgctcct tgccgccg 18

<210> 17

<211> 17

<212> DNA

<213> PPIB

<400> 17

ccctcatcgc ggggtcc 17

<210> 18

<211> 17

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 18

gattgggttt gcatgtt 17

<210> 19

<211> 37

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 19

cacattgtct gctcccacaa tggagaatat acactcg 37

<210> 20

<211> 48

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 20

tgctgcatct gcttggagcc atttctctag ggactaataa gacacgct 48

<210> 21

<211> 48

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 21

cgcggaggga catgcggatc acgattatct tcggagaata tacactcg 48

<210> 22

<211> 49

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 22

ccatcagcac cacagccttc catttctcta gggactaata agacacgct 49

<210> 23

<211> 48

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 23

gcgcatcatg gtgttcttgc acgattatct tcggagaata tacactcg 48

<210> 24

<211> 45

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 24

tggccccgga tggccttatt tctctaggga ctaataagac acgct 45

<210> 25

<211> 21

<212> DNA

<213> ARBP

<400> 25

attgtgggag cagacaatgt g 21

<210> 26

<211> 20

<212> DNA

<213> ARBP

<400> 26

ggctccaagc agatgcagca 20

<210> 27

<211> 20

<212> DNA

<213> ARBP

<400> 27

gatccgcatg tccctccgcg 20

<210> 28

<211> 21

<212> DNA

<213> ARBP

<400> 28

ggaaggctgt ggtgctgatg g 21

<210> 29

<211> 19

<212> DNA

<213> ARBP

<400> 29

caagaacacc atgatgcgc 19

<210> 30

<211> 17

<212> DNA

<213> ARBP

<400> 30

aaggccatcc ggggcca 17

Claims

1. A preamplification nucleic acid comprising a 5 'terminal base sequence, a first complementary region, a repetitive sequence, a second complementary region and a 3' terminal base sequence; the 5 'end base sequence, the first complementary region, the repetitive sequence, the second complementary region and the 3' end base sequence are connected in sequence; the first and second complementary regions are paired; the 5 'end base sequence and the 3' end base sequence are both paired with a detection probe; the difference between the Tm value of the base sequence at the 5 'end and the Tm value of the base sequence at the 3' end is less than or equal to 1 ℃; pairing the repetitive sequence with a labeled probe or an amplifier; the repeat sequence between the first complementary sequence and the second complementary sequence forms a stem-loop secondary structure.

2. The preamplifying nucleic acid of claim 1, wherein the complementary binding site of the 5 'terminal base sequence to the 3' terminal base sequence is less than or equal to 4 consecutive bases; the complementary binding sites of the first complementary region and the second complementary region and the 5' end base sequence are respectively less than or equal to 4 continuous bases; the complementary binding sites of the first complementary region and the second complementary region with the 3' end base sequence are respectively less than or equal to 4 continuous bases.

3. The preamplifying nucleic acid of claim 1, wherein the Tm of the first and second complementary regions differs from the Tm of the 5 'or 3' terminal base sequence by 1 ℃ or less.

4. The preamplifying nucleic acid of claim 1, wherein the 5 'and 3' terminal base sequences are each 20 to 40 bases in length.

5. The preamplification nucleic acid according to claim 1, wherein the Tm value of the 5 '-end base sequence and the Tm value of the 3' -end base sequence are each 65 to 67 ℃.

6. The preamplifier of claim 1, wherein said repetitive sequence is at least 5 segments.

7. The preamplifier of claim 1, wherein said repetitive sequence is 18 to 25 bases.

8. Use of a preamplifying nucleic acid as claimed in claim 1 for signal amplification detection of a target nucleic acid.

9. The use of preamplifiers according to claim 8, wherein the signal amplification detection of the target nucleic acid comprises:

a second hybridization step: combining the other end of the detection probe with the 5 'end base sequence and the 3' end base sequence of the preamplified nucleic acid, and combining the first complementary sequence and the second complementary sequence of the preamplified nucleic acid in a pairing way;

10. Use of a preamplifier according to claim 9, wherein the first hybridization step is: reacting the immobilized target nucleic acid and the detection probe at 38-45 ℃ for 1-16h under the conditions of 6 XSSC, 25-50wt% formamide, 50mg/uL heparin, 1mg/mL tRNA and 0.1-0.5wt% SDS; the second hybridization step is: adding preamplified nucleic acid, and reacting at 38-45 deg.C for 1-2h under the conditions of 5 XSSC, 25-50wt% formamide, and 0.1-0.5wt% SDS.