CN113025624B - Gene related to drought resistance of rape, overexpression vector, cell line, host bacterium and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant molecular biology, and particularly relates to a gene related to drought resistance of rape, an overexpression vector, a cell line, a host bacterium and application thereof. The gene is BnWRKY255, and the nucleotide sequence is shown as SEQ ID NO: 1 is shown. The BnWRKY255 gene plays a role in negative regulation and control in drought resistance, reduces the sensitivity of an over-expressed plant to ABA, and provides reference basis and related genes for deeply knowing a stress-resistant signal network in which rape WRKY participates.

Description

Gene related to drought resistance of rape, overexpression vector, cell line, host bacterium and application thereof

Technical Field

The invention belongs to the technical field of plant molecular biology, and particularly relates to a gene related to drought resistance of rape, an overexpression vector, a cell line, a host bacterium and application thereof.

Background

Rape (Brassica napus L.) is one of the world important oil crops, and is often affected by various environmental factors during the growth process, so that the yield is reduced or the crop is not harvested, and serious economic loss is caused. The WRKY transcription factor family is one of the largest transcription factor families in plants and is widely involved in the regulation and control of plants on biotic and abiotic stresses, growth and development and metabolic processes. More than 70% of WRKY transcription factors in Arabidopsis have effects on treatment of pathogens and salicylic acid, and the WRKY transcription factors also play a key role in response to low and high temperatures, water stress, high CO2 levels, high ozone concentration, salt stress and the like. Therefore, the research on the function of the WRKY transcription factor of the rape is of great significance to guarantee the production of the rape.

Among the many environmental factors that affect the normal growth of plants, drought is an abiotic stress that occurs at a high frequency and is highly harmful to plants. Drought can cause stomata of plants to close, water content to decrease, photosynthesis to diminish, and can lead to the accumulation of Reactive Oxygen Species (ROS). The WRKY transcription factor plays an important role in the response of plants to drought stress. Taking arabidopsis as an example, arabidopsis AtWRKY46, AtWRKY54 and AtWRKY70 can negatively regulate plant drought tolerance through Brassinosteroid (BRs) approach.

The plant hormone abscisic acid (ABA) plays an important role in regulating the response of plants to adversity stress. ABA plays a great role as an important regulator in all stages of plant growth and in numerous physiological and biochemical reactions. The research on ABA in the aspects of adjusting seed dormancy, fruit maturation and development, root system development and the like is relatively mature, the effect of ABA in the aspect of adjusting the tolerance of plants to abiotic stress is one of the hotspots of the current research, and after the plants are attacked from the outside, external signals are linked and transmitted to the intracellular oxidase system and related genes in the aging process to trigger the regulation reaction of the plant endogenous regulation system. ABA controls stomata aperture and simultaneously regulates stress-controlling related genes in response to drought stress to reduce CO2 entering cells, and the response can limit plant photosynthesis capacity and effectively improve the tolerance of plants to adverse conditions. Taking chrysanthemum as an example, the chrysanthemum CmWRKY10 can positively regulate the drought stress tolerance of plants through an ABA pathway, and the over-expression CmWRKY10 can improve the expression levels of genes such as DREB1A, DREB2A, CuZnSOD, NCED3A and NCED 3B.

The BnWRKY255 gene belongs to one of WRKY family members, and has important theoretical significance and excellent value for obtaining a rape variety with stronger stress resistance by cloning a stress-resistance-related gene BnWRKY255 in rape and researching the potential function of the stress-resistance-related gene BnWRKY255 under the stress condition of rape.

Disclosure of Invention

One of the purposes of the invention is to provide a gene related to rape drought resistance, wherein the gene is BnWRKY255, and the nucleotide sequence is shown as SEQ ID NO: 1 is shown.

The second purpose of the invention is to provide a protein related to drought resistance of rape, wherein the protein is BnWRKY255 and is expressed by SEQ ID NO: 1, and the amino acid sequence thereof is shown as SEQ ID NO: 2, respectively.

The invention also aims to provide an overexpression vector containing the gene.

The fourth purpose of the invention is to provide a cell line containing the gene.

The fifth purpose of the invention is to provide a host bacterium containing the gene.

The sixth purpose of the invention is to provide the application of the gene in transforming dicotyledons to generate drought-sensitive dicotyledons.

The seventh object of the present invention is to provide a method for producing a plant containing the gene, which comprises promoting the expression of the gene of claim 1 in a target plant, increasing the activity of the protein of claim 2 in a target plant, or increasing the content of the protein of claim 2 in a target plant to obtain a transgenic plant; the transgenic plant shows drought sensitivity, ABA insensitivity and reduced stress resistance.

Furthermore, the plant is prepared by introducing the gene into a target plant to promote the expression of the gene and increase the protein content.

Further, the target plant is a dicotyledonous plant.

Still further, the dicotyledonous plant is Arabidopsis, tobacco, or oilseed rape.

Compared with the prior art, the invention has the following beneficial effects:

the invention uses the existing plant expression vector to construct the recombinant expression vector containing BnNAC038 gene, wherein the plant expression vector comprises pEarley Gate103 and pEarley Gate103-RFP (pEarley Gate103 vector is modified, red fluorescent gene is added on the vector, and arabidopsis seed specific promoter At2S3A is used for expression) or other derivative plant expression vectors. The constructed recombinant expression vector containing the gene can be transformed into plant tissues or cells by DNA transformation, conductance, Ti plasmid, agrobacterium-mediated transformation and other biological methods, and host dicotyledonous plants can be arabidopsis, tobacco, rape and the like.

The BnNAC038 gene provided by the invention plays a negative regulation and control role in drought resistance, and the overexpression of the gene in the transgenic plant can inhibit the expression of a response gene encoding osmotic or oxidative damage participating in abiotic stress induction, so that the drought resistance of the transgenic plant is reduced.

Drawings

FIG. 1 shows the construction of overexpression vector pEarleyGate103-RFP-BnWRKY255 by using Gateway recombination technology.

FIG. 2 is a semi-quantitative RT-PCR analysis of BnWRKY255 transcript levels in BnWRKY255 line homozygous 35S, ACTIN2 was used as a control.

FIG. 3 is a comparison of primary root growth of WT and OE seedlings grown from BnWRKY255 overexpressing Arabidopsis thaliana on MS plates with 0, 300mM, 350mM mannitol, three independent experiments were performed with similar results, A: a phenotype; b: and (5) counting the growth of the primary roots.

FIG. 4 shows that overexpression of BnWRKY255 in Arabidopsis decreases drought tolerance; a: the normal three-week-old wild type and over-expression plants are subjected to phenotype after being subjected to drought treatment for 14 days and rehydration for three days. B: counting the survival rate of the plants after rehydration; all values are mean values (± SE) from three independent experiments (30 seedlings per experiment), P < 0.05.

FIG. 5 is additional evidence that overexpression of BnWRKY255 in Arabidopsis decreases drought tolerance; a: water loss rate of WT and BnWRKY255 transgenic plants in vitro leaves. B: measuring the content of MDA; c: measuring proline; d: counting the chlorophyll content of the plant leaves after drought treatment; e: and (5) counting the maximum potential photosynthetic efficiency of the plants after the drought treatment.

FIG. 6 is that BnWRKY255 reduces ABA sensitivity and inhibits ABA-induced stomatal closure; a: germination of 0 and 2 μ MABA treated WT and OE lines; b: comparative and quantitative evaluation of germination of WT and OE line seeds treated in a. Data represent mean ± SE values for three independent experiments, 42 seeds per genotype and experiment; c: growing seedlings of different genotypes on a 0.6MS culture medium for a period of time, transferring 4-day-old seedlings to MS culture media respectively added with 1 mu M, 2 mu M or 5 mu MABA for 10 days, and then taking a picture; d: irradiating the BnWRKY255 super-expression plant and the wild type leaves with or without ABA treatment for 3h to induce stomata to be completely opened, and adding ABA for treatment for 0.5h to induce stomata of different genotypes; e: after ABA treatment, the quantitative statistics of root length and biomass of different genotypes is carried out, the data shows the average + -SD value of three independent copies, and the over-expression plants have significant difference with Col-0 under the same treatment condition. (. P <0.05,. P < 0.01).

FIG. 7 shows that BnWRKY255 super-expression rape is sensitive to drought; a: phenotype of BnWRKY255 transgenic rape after drought and rehydration; b: leaf temperature of BnWRKY255 transgenic rape after drought; c: measuring the content of MDA; d: proline content was determined (. about.p <0.05,. about.p < 0.01).

Detailed Description

The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art, and materials, reagents and the like used in the following examples can be commercially available unless otherwise specified.

In the following examples of the present invention, the experimental material used was Brassica napus (Brassica napus L.). Zhongshuang 11 was provided by the institute of oil crops, academy of agricultural sciences, China, K407 was provided by the center for the research of hybrid rape, Shaanxi province, Arabidopsis WT (Arabidopsis thaliana, Col-0; American center for Arabidopsis biological resources), Agrobacterium GV3101 (Shanghai Weidi Biotech Co., Ltd.), and plasmid pEarley-Gate103 (American center for Arabidopsis biological resources).

Example 1 cloning of Brassica napus BnWRKY255 Gene

The method for extracting the total RNA of the brassica napus seedlings by using an RNA extraction and separation reagent (Trizol, Invitrogen) comprises the following steps: collecting about 80-150mg of cabbage type rape seedlings, placing the seedlings into an EP tube marked correspondingly, then adding 1ml of Trizol reagent, quickly mixing uniformly and placing the mixture on ice for 8-10 min; adding 0.2ml chloroform, slightly reversing the mixture at a constant speed for 15-30s, and standing the mixture on ice for 5-8 min; centrifuging at 12000rpm at 4 deg.C for 15-20 min; transferring the supernatant to a new RNase free EP tube, adding 0.5ml of precooled isopropanol, gently mixing, standing for 3-5min, centrifuging at 4 ℃ at 12000g for 20min, and precipitating RNA; the RNA precipitate is washed with 1ml of 75% ethanol, dried for 5min, dissolved in an appropriate amount of DEPC-treated water, and stored at-80 ℃ for later use.

Constructing a gene overexpression vector according to the Gateway recombination technology, and designing primers through Primer 5.0 software to clone a target gene. The cDNA sequence of BnWRKY255 is obtained by PCR amplification, and the reaction system is as follows:

TABLE 1 reverse transcription reaction System

TABLE 2 reverse transcription reaction procedure

And (3) sucking 1 mu l of the reverse transcription product, and taking the reverse transcription product as a template to perform PCR reaction: 5min after 95 ℃ the amplification procedure was entered: 30s at 95 ℃, 30s at 58 ℃ and 30s at 72 ℃ for 5min after 32 cycles. The amplified SEQ ID NO: 1 sequence has a total length of 444 bases, encodes 147 amino acids, and has a calculated isoelectric point of theractical pI/Mw of 9.43/17044.12 according to ExPASy's computer pI/Mw program.

The primers used for PCR were as follows:

BnWRKY 255-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGAAGGATATGATGATGGATC, respectively; the amino acid sequence of SEQ ID NO: 3 is shown in the specification;

BnWRKY 255-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCAAAAGAAGAGTAGATTTGCATTTG, respectively; SEQ ID NO: 4, respectively.

Example 2 obtaining of BnWRKY255 Gene-transferred Arabidopsis thaliana plants

In order to research the effect of BnWRKY255, a transgenic plant over-expressing BnWRKY255 is constructed in Arabidopsis, a transgenic plant line is identified, and 3 independent homozygote T3 transgenic plant lines with high expression of BnWRKY255 are randomly selected for further phenotypic analysis according to a semi-quantitative result as shown in figure 2.

1. Constructing a transgenic plant overexpression vector of the brassica napus BnWRKY 255: the fragment obtained in example 1, which was verified by sequencing, was recombined into pDONR207 vector by BP reaction (BP Clonase II Enzyme Mix, Invitrogen) using the Gateway technology of Invitrogen, E.coli DH 5. alpha. competent cells were transformed, and an entry clone was obtained by gentamily screening 50mg/L, and then the plasmid was extracted and the BnWRKY255 gene was recombined onto pEarleyGate103-RFP vector by LR reaction (LR Clonase II Enzyme Mix, Invitrogen No. 11791. sup. 020) in the Gateway technology, and E.coli DH 5. alpha. competent cells were transformed, and a successfully recombined over-expression vector pEarleyGate 103-RFP-BnKY 255 was obtained by 50mg/L kanamycin screening, as shown in FIG. 1.

2. Agrobacterium-mediated transformation: cleaning the electric rotating cup, sterilizing the electric rotating cup in 75% ethanol, soaking the electric rotating cup in absolute ethyl alcohol, drying the electric rotating cup in the air, and placing the electric rotating cup on ice for precooling for later use. The agrobacterium-infected competent state is placed on ice to be melted, about 100ng of successfully constructed over-expression plasmid pEarleyGate103-RFP-BnWRKY255 is added into the competent state, the mixture is gently mixed evenly, and the mixture is added into an electric rotor cup for click conversion (voltage is 2400V, capacitance is 25F, impedance is 200 omega, and the electric rotor cup is 1 mm). The competence in the electric cuvette was transferred to 700. mu.L of SOC medium, mixed well, and cultured for 3 hours at 28 ℃ in a shaking incubator at 180 rpm. The cells were removed from the incubator, centrifuged at 4000rpm for 5min, discarded in an ultraclean bench to leave about 100. mu.L of the supernatant, pipetted and mixed well, spread on YEP solid medium with the corresponding resistance (50mg/L rifampicin +50mg/L kanamycin), and subjected to inverted culture at 28 ℃ for 72h in an incubator. The positive agrobacterium colony is cultured by YEP culture medium in a shaking incubator at 28 ℃ at 220rpm until the OD600 is about 1.0, the positive agrobacterium colony is placed in a centrifuge for 15min at 4000rpm, and the supernatant is discarded. Resuspending the precipitate with resuspension solution, adjusting OD600 to 0.8, adding 0.03% Silwet L77 surfactant, mixing well, and standing for 2 h. Selecting wild arabidopsis thaliana with good growth state and large flowering, immersing inflorescences into a heavy suspension containing agrobacterium for about 30s, covering with a mulching film for moisturizing, standing for 24h in a dark place, and taking out the arabidopsis thaliana. And the transformation is carried out again after one week, so that the transformation efficiency is improved.

3. Screening of transgenic Arabidopsis lines: observing the seed coat color of the seeds harvested from the transgenic arabidopsis thaliana under a body type microscope, selecting positive seeds capable of observing red fluorescence on the seed coats, planting, carrying out passage and semi-quantitative PCR verification, and finally obtaining a homozygous BnWRKY255 over-expressed arabidopsis thaliana T3 generation transgenic plant line as shown in figure 2.

Example 3 determination of drought sensitivity of transgenic BnWRKY255 Arabidopsis

The influence of mannitol on root growth of transgenic BnWRKY255 Arabidopsis is researched, and the method comprises the following steps: sowing the transgenosis and wild type arabidopsis seeds harvested in the same period after disinfection and cleaning in 1/2MS solid culture medium, vernalizing at 4 ℃ for 2 days, then putting the seeds into a long-day culture chamber (22 ℃, illuminating for 16h and darkness for 8h), culturing in a long-day culture chamber, germinating for 3 days, then respectively transferring the seedlings with consistent growth state to 1/2MS solid culture medium containing 200mM and 300mM mannitol, putting the seedlings into the long-day culture chamber, vertically placing the seedlings, and counting the root length and taking a picture after culturing for 7 days. The experimental results show that: under the influence of mannitol, the growth of the root system of the BnWRKY255 overexpression strain is obviously inhibited. Statistics of root length revealed that the roots of the over-expressed lines were significantly shorter than the WT plants (FIG. 3).

In order to further study the drought resistance of the transgenic plants, the 3-week-old soil transgenic plants were subjected to continuous water-holding stress treatment. After 14 days of drought, the transgenic plants withered, necrosed and bleached, while the WT plants showed mild symptoms. After restoration of watering, 30% of the WT plants survived, whereas the survival rate of the transgenic lines was significantly lower than the wild type (fig. 4).

The reduced drought tolerance of plants may be due to reduced water retention capacity of the plants, so we determined the water loss rate of wild type and BnWRKY255 overexpression lines: according to the conventional general method for culturing the arabidopsis thaliana materials, a wild type plant and a corresponding transgenic plant line are respectively planted, plant nutrient solution is poured irregularly, leaves of the plants grow to be large enough, arabidopsis thaliana seedlings with the same growth vigor among the plant lines are selected for water loss measurement after the plants grow for about one month (namely, the bolting seedlings), wherein the wild type plant is a facing group, and the transgenic plant is an experimental group. Selecting 3-5 plants from each strain at about 10 am, placing the plants in a water loss measuring balance, counting the weight change of each strain by a computer every 5min, testing to close the water loss measuring system at 3 pm, and storing the counted data. The difference in water loss between wild type and transgenic plants was analyzed by a graph. Three biological replicates were performed at different time periods and significant differences were calculated. After statistical results, the water loss rate of the transgenic line is found to be significantly higher than that of the WT, and the water retention capacity of the transgenic line is proved to be weaker than that of the wild type, which also corresponds to the drought-sensitive phenotype (FIG. 5A).

After the content of the drought regulating substance proline is measured, the increment of the MDA accumulation of the transgenic line after drought treatment is found to be increased, the increment of the proline accumulation is found to be reduced, and the increment of the proline accumulation is consistent with the drought sensitive phenotype (figures 5B and C).

The method comprises the following steps of determining the content of Proline (Proline) by adopting a sulfosalicylic acid method, respectively taking 0.2g of leaf blades at the same positions of a control group and arabidopsis thaliana subjected to stress treatment, cleaning the leaf blades with deionized water, quickly freezing the leaf blades with liquid nitrogen, grinding the leaf blades, adding 5mL of 3% sulfosalicylic acid, carrying out boiling water bath for 10min, centrifuging the leaf blades at 3000rpm after cooling for 5min, taking 2mL of supernatant into a new centrifuge tube, adding 2mL of acidic ninhydrin and glacial acetic acid, carrying out boiling water bath for 30min, adding 4mL of toluene after cooling, uniformly mixing the mixture by oscillation, taking the supernatant after standing, centrifuging the supernatant at 3000rpm for 5min, determining the absorbance of a sample at the wavelength of 520nm, finding out the corresponding Proline concentration according to a standard curve, and calculating the content of the Proline by using a formula:

the method for determining the drought-regulating substance MDA is as follows:

and (3) detecting the content of Malondialdehyde (MDA) by adopting a thiobarbituric acid reaction method. Respectively taking 0.1g of leaf blades of the control group and the arabidopsis thaliana at the same position subjected to stress treatment, washing with deionized water, quickly freezing by using liquid nitrogen, grinding, adding 5mL of 5% TCA, uniformly mixing, centrifuging at 3000rpm for 10min, transferring 2mL of supernatant into a new 5mL of centrifuge tube, adding 2mL of 0.67% TBA, uniformly mixing, carrying out boiling water bath for 30min, cooling, and centrifuging at 3000rpm for 5 min. Measuring the light absorption values of the supernatant at 450nm, 532nm and 600nm respectively, and calculating the MDA content by the following formula:

MDA concentration C (. mu. mol/L) 6.45X (A532-A600) -0.56X A450

Drought stress affects the photosynthetic efficiency of plants, the potential maximum photosynthetic capacity of the plants after drought is measured by a photosynthetic rate tester, and the photosynthetic capacity of the BnWRKY255 overexpression strain is found to be remarkably lower than that of the wild type (figure 5D).

And further determining the chlorophyll content of the plant leaves after drought: measuring the chlorophyll content by ultraviolet spectrophotometry. Respectively taking 0.2g of leaves of the control group and the stressed arabidopsis thaliana at the same position, cleaning with deionized water, cutting into pieces, putting into a 5mL centrifuge tube, adding 3mL of 95% ethanol solution, keeping out of the sun until the leaves are completely whitened, and extracting chlorophyll. Measuring the absorbance of the chlorophyll solution at 663nm and 645nm respectively, and calculating the chlorophyll content by the following formula:

chlorophyll a concentration (Ca) of 12.7 xA 663-2.59 xA 645

Chlorophyll b concentration (Cb) ═ 22.9 xA 645-4.67 xA 663

According to the experimental results, the chlorophyll content of the leaves of the transgenic lines after drought was also significantly lower than that of the WT (fig. 5E). Accordingly, we speculate that the existence of BnWRKY255 can reduce the drought tolerance of plants, namely that BnWRKY255 has negative regulation effect on drought.

Example 4 ABA sensitivity assay of overexpression Arabidopsis thaliana with overexpression of BnWRKY255 Gene

The germination conditions of BnWRKY255 overexpression Arabidopsis thaliana and wild type under ABA treatment are counted, and the method comprises the following steps: adding 1mL of 0.1% mercuric chloride into the Arabidopsis seeds in a super clean bench, uniformly mixing and disinfecting for 5min, discarding the supernatant, adding 1mL of sterile water for cleaning, and repeating for 7 times. Inoculating the sterilized and cleaned Arabidopsis seeds on a 0.6MS solid culture medium, sealing with a sealing film, and vernalizing in a refrigerator at 4 ℃ in the dark for 2 days. Placing the seeds into a culture chamber, culturing the seeds at 22 ℃ for 7 days, and counting the germination condition of the seeds every day. Under normal conditions, the germination rates of over-expressed (OE) lines and WT plants were similar. However, in ABA supplemented medium, the germination rate of OE lines was lower than that of WT plants. When the concentration of ABA was 2. mu.M, the germination rate of the over-expressed lines was significantly lower than that of the wild type by the fourth day (FIG. 6A, B).

The response of WT and BnWRKY255 transgenic plants to ABA at post-emergence growth stage was evaluated: seedlings were germinated on normal MS medium for 4d and then transferred to media supplemented with different concentrations of ABA. Root growth was significantly similar for OE and WT lines in the absence of exogenously applied ABA. In the presence of different concentrations of ABA, the growth of roots was significantly inhibited. The elongation of the main roots of the transgenic plants was significantly less affected than the wild type (fig. 6C, E). ABA-mediated stomatal closure determines the transpiration level and the water retention capacity of plants under water deficit conditions, so we explore whether overexpression of BnWRKY255 affects the sensitivity of guard cells to ABA treatment by the pore size of ABA-treated stomata. After 3h of illumination treatment, stomata are completely opened, the stomata aperture is measured after ABA is applied externally, the ratio of the width of the stomata of the OE plant to the length of the stomata is higher than that of the WT plant, the result shows that the stomata closing capability of the BnWRKY255 transgenic line after ABA treatment is obviously weakened compared with that of a wild type, and the overexpression of BnWRKY255 inhibits ABA mediated stomata closing (FIGS. 6D and 6F). In conclusion, the BnWRKY255 can inhibit the effect of ABA, so that the sensitivity of plants to ABA is reduced.

Example 5 acquisition of transgenic plants of Brassica napus and determination of drought sensitivity

And (3) dropping the disinfected rape seeds into an MS culture medium, and culturing for 5 days under the long-day condition of 16 hours of illumination and 8 hours of darkness. The hypocotyl is cut into 2mm long sections after the growing point is removed, the cut hypocotyl is inserted into a pre-culture medium at 28 ℃, and the hypocotyl is pre-cultured for 2d in long days. The Agrobacterium transformed strain containing the desired vector was inoculated into 5mL of YEP liquid medium containing 50mg/L kanamycin and 20mg/L streptomycin, cultured at 28 ℃ for 1-2 days with shaking at 200rpm, and the OD600 was measured to be about 0.5. 500. mu.L of the above cell suspension was added to 50mL of YEP liquid medium at 28 ℃ and cultured with shaking at 200rpm until OD600 was about 0.5. Suspending the lower strain with equal volume of MS liquid culture medium after centrifugation, adding 100 μmol/L acetosyringone, and shake culturing at 28 deg.C and 200rpm for 2-3 h. The liquid MS culture medium containing 100. mu. mol/L acetosyringone was diluted with different fold to form a suspension for transformation. And (3) putting the pre-cultured hypocotyls into the transformation liquid, soaking for 8-10min, and continuously shaking the transformation liquid during the soaking to fully and uniformly mix the hypocotyls. Taking out hypocotyls, placing on sterile filter paper, sucking to dry surface bacteria liquid, then placing in a culture dish paved with co-culture medium, performing dark culture at 25 ℃ for 2d, and performing light/dark culture for 16/8 h. Putting the co-cultured hypocotyl into a degerming culture medium, culturing at 25 ℃ for 16/8h in light/dark for 5-7 d. Transferring hypocotyls after degerming culture to a differentiation screening culture medium, culturing at 25 ℃, 16/8h in light/dark, subculturing once for 2-3 weeks until green buds are differentiated, and continuously culturing under normal conditions until seeds are harvested.

In order to determine the drought traits of WRKY255 over-expressed rape, rape seedlings growing to two true leaf periods are transferred to soil for culture, natural drought treatment is carried out after continuous growth for about one week, obvious withering and wilting can be observed in about two weeks compared with three OE plants of WT, and the survival rate of over-expressed Line is lower after seven days of rehydration (FIG. 7A). This conclusion demonstrates that the BnWRKY255 transgenic rape exhibits a drought sensitive phenotype. The leaf temperature of the BnWRKY255 transgenic rape material is counted by using a portable infrared scanner, and the result shows that the leaf temperature of the transgenic line is obviously lower than that of the wild type, which indicates that the water exchange in the leaves of the transgenic line is more active (FIG. 7B). The accumulation of malondialdehyde and proline in the transgenic material and wild type after PEG treatment was determined (see example 3 for a method), and the results showed that the transgenic material accumulated more malondialdehyde than the wild type, but the accumulation of the drought-regulating substance proline was significantly lower than the wild type (fig. 7C, 7D).

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> university of Henan

<>

<120> gene related to rape drought resistance, over-expression vector, cell line, host bacterium and application thereof

<>

<160> 4

<>

<170> SIPOSequenceListing 1.0

<>

<210> 1

<211> 444

<212> DNA

<213> Brassica napus

<>

<400> 1

atggaaggat atgatgatgg atcgttgtat gctccgttcc tgtcgctgaa accacatcaa 60<>

agcctttcta agtcggagtt agaacaaggc agagaagaag cctcaaaagt tagcgaaggt 120<>

tcctcgagaa gcagggattt gaaaaagaag aaggggaaga aacaaaagtt tgcgtttcag 180<>

acaaggagcc aagttgatat tcttgatgat ggctatcgtt ggagaaaata tggccaaaaa 240<>

gctgtcaaga acaacaagtt ccctaggagt tactataggt gcacatatgg aggatgcaat 300<>

gtaaagaagc aagtgcaaag attaacatca gaccaagaag ttgtagtcac gacctacgaa 360<>

ggagtacact cgcatcccat cgaaaaatct acagaaaatt tcgaacatat tctcacccaa 420<>

atgcaaatct actcttcttt ttaa 444<>

<>

<210> 2

<211> 147

<212> PRT

<213> Brassica napus

<>

<400> 2

Met Glu Gly Tyr Asp Asp Gly Ser Leu Tyr Ala Pro Phe Leu Ser Leu <>

1 5 10 15 <>

Lys Pro His Gln Ser Leu Ser Lys Ser Glu Leu Glu Gln Gly Arg Glu <>

20 25 30 <>

Glu Ala Ser Lys Val Ser Glu Gly Ser Ser Arg Ser Arg Asp Leu Lys <>

35 40 45 <>

Lys Lys Lys Gly Lys Lys Gln Lys Phe Ala Phe Gln Thr Arg Ser Gln <>

50 55 60 <>

Val Asp Ile Leu Asp Asp Gly Tyr Arg Trp Arg Lys Tyr Gly Gln Lys <>

65 70 75 80 <>

Ala Val Lys Asn Asn Lys Phe Pro Arg Ser Tyr Tyr Arg Cys Thr Tyr <>

85 90 95 <>

Gly Gly Cys Asn Val Lys Lys Gln Val Gln Arg Leu Thr Ser Asp Gln <>

100 105 110 <>

Glu Val Val Val Thr Thr Tyr Glu Gly Val His Ser His Pro Ile Glu <>

115 120 125 <>

Lys Ser Thr Glu Asn Phe Glu His Ile Leu Thr Gln Met Gln Ile Tyr <>

130 135 140 <>

Ser Ser Phe <>

145 <>

<>

<210> 3

<211> 52

<212> DNA

<213> Artificial sequence

<>

<400> 3

ggggacaagt ttgtacaaaa aagcaggcta tggaaggata tgatgatgga tc 52<>

<>

<210> 4

<211> 54

<212> DNA

<213> Artificial sequence

<>

<400> 4

ggggaccact ttgtacaaga aagctgggtc aaaagaagag tagatttgca tttg 54<>

<>

<>

<>

Claims (1)

1. Use of a gene for transforming a dicot to produce a drought-sensitive dicot, wherein the gene isBnWRKY255And the nucleotide sequence is shown as SEQ ID NO: 1 is shown in the specification; ammonia of protein encoded by said geneThe amino acid sequence is shown as SEQ ID NO: 2 is shown in the specification;

the transformed dicotyledonous plants are sensitive to drought, are insensitive to ABA and have reduced drought resistance;

the dicotyledonous plant is arabidopsis thaliana, tobacco or rape.

Images