CN113025622B - Plant floral organ dominant expression gene JAZ-10, expression product, expression vector and application thereof - Google Patents

Abstract

The invention discloses a plant floral organ dominant expression geneJAZ‑10The expression product, the expression vector and the application thereof, aiming at promoting the deep development of the current technologies of constructing or screening the male sterility plant species and the seed abortion plant species. The present invention identifies a gene capable of regulating and controlling plant reproductive organ developmentJAZ‑10An overexpression vector and a CRISPR/Cas9 vector are constructed and are respectively transformed to obtain a corresponding overexpression strain and a gene knockout strain; microscopic observation of the flower organ showed that,JAZ‑10can regulate and control the development of ovary carpel, stamen and stigma hair of plants, and has important application value in the aspects of molecular breeding, crossbreeding, heterosis, construction or screening of seed abortion plant varieties and the like.

Description

Plant floral organ dominant expression gene JAZ-10, expression product, expression vector and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a plant floral organ dominant expression geneJAZ-10Expression products, expression vectors and applications thereof.

Background

Jasmonic acid (A)JA) Can regulate and control various development processes of plants, such as pollen maturation, anther cracking, embryo maturation, tendril coiling, tuber and trichome development and the like. Inhibitors of the jasmonic acid pathwayJAZProtein (A)Jasmonate ZIM domain，JAZ) Is a key factor for regulating jasmonic acid hormone response.JAZIs a gene family which is peculiar to plants,JAZsthe family members all containNT、 ZIMAndJasthree conserved domains. The N-terminus of the protein contains a weak conservationNTA domain which can be linked toDELLAProtein interaction.ZIMThe domains consist of 36 amino acids, conserved among themTIFYMotif (TIF [ F/Y ] XG),JAZsdependence on formation of homo-or heterodimersTIFYAnd (c) a motif.JAZThe Jas domain at the C-terminus of the family is well conserved, consisting of 12-29 amino acids, in Arabidopsis 12JAZIn members ofJasThe domains are substantially identical in that they are,Jasthe domains can interact with a number of proteins inJA-IleUnder the circumstances ofJAZsDegradation of (2).

MYC2Is composed ofJAResponsive to initiation of transcription factors of genes, of plantsJAInduct byCOI1The control is carried out by controlling the temperature of the air conditioner,JAZidentified as a link between them in 2007 (Chini et al, 2007; Yan et al, 2007) From here onJAA signaling model is disclosed: plants are grown under normal growth conditions, in vivoJA-IleThe level is very low and the level is very low,JAZsbonding ofMYC2Equal transcription factor, inhibitionJAPreventing plant from proceeding in response to gene transcriptionJAResponding; when the plant body is in a certain development process or is stressed by the outside world, the plant body is in vivoJA-IleThe level of (a) is increased,JAZrepressor protein andCOI1by passingJasDomain interaction occurs through SCF ^COI1The degradation of the/26S protease pathway,MYC2equal rotationThe recording factor is released, thereby initiating the correspondingJATranscription of a responsive gene; when it happensJAWhen answeringJAZsAlso induced, expression inducedJAZsRepress the reactionMYC2Transcription factor activity, thereby blockingJAIn response, the regulation process is similar to feedback regulation, so that the plant body does not generate too violent plantJAIn response to the reaction, to avoid excessive consumption of energy by the plant body (Chico et al, 2008; Browse et al, 2009)。

It is reported that Arabidopsis thalianaR2R3-MYBTranscription factormyb21、myb24The double mutant shows defects in pollen maturation, anther dehiscence and filament elongation, resulting in male sterility. In thatcoi1-1Overexpression in mutantsmyb21Can partially rescue male fertility but cannot recoverJAThe regulated root growth inhibition, anthocyanin accumulation and plant defense function. These results show that it is possible to determine,R2R3-MYBtranscription factormyb21Andmyb24act asJAZRegulating male fertility: (Song et al, 2011; Huang et al, 2017). Recent research shows thatIIIe bHLHTranscription factorMYC5May be combined withJAZProtein interactions regulate stamen development, othersIIIe bHLHFactor(s)MYC2，MYC3AndMYC4possibly with similar functionality. Furthermore, theseIIIe bHLHThe factor can be in accordance withmyb21、myb24Interact with each other to formbHLH-MYBThe transcription complex in turn synergistically regulates the development of stamens: (Qi et al, 2015)。

At present, the research on the genes related to the floral organ dominance expression of plants needs to be further developed, and the control of seed abortion genes for regulating and controlling plant male sterility and the action mechanism thereof are still needed to promote the development of seed production technologies such as molecular breeding, hybrid breeding, heterosis utilization and the like of crops at present.

Disclosure of Invention

The invention aims to provide a gene capable of regulating and controlling the development of plant reproductive organsJAZ-10The expression vector is used to transform plants so as to promote the development of seed production technologies such as molecular breeding, crossbreeding, heterosis utilization and the like of the current plants, provide a technical means for constructing or screening seed abortive plant varieties and simultaneously search plantsLays a foundation for male sterility and reproductive organ development mechanism.

In order to solve the technical problems, the invention adopts the following technical scheme:

the invention is based on the tobaccoJAZLong-term analysis and research of family members, and identification of a floral organ dominant expression gene capable of regulating and controlling plant male sterilityJAZ-10 (Jasmonate ZIM domain-10) The nucleotide sequence and the amino acid sequence of the coding region are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.JAZ-10CDS has a total length of 534 bp, codes 177 amino acids and 1 stop codon, and has typical characteristicsZIMAndJasa conserved domain.

Inserting plant flower organ dominant expression gene after strong promoter 35SJAZ-10Obtaining an overexpression vector, and transforming a receptor plant to obtain an overexpression plant.

sgRNA primers designed by using conserved sequences and constructionJAZ-10The CRISPR/Cas9 vector of the gene can be obtained after transforming a receptor plantJAZ-10And (4) knocking out plants.

In the specific research process, the tobacco cultivar K326 is respectively transformed by the vector through an agrobacterium-mediated method, and the tobacco cultivar K326 is also respectively obtainedJAZ-10Overexpression lines (K326-T) and knock-out plants (K326-M).

The microscopic morphology observation of the different obtained transgenic strains shows that,JAZ-10the over-expressed lines had no stamens and the ovary was changed from 2 carpels to 3 carpels; whileJAZ-10The phenotype of the gene knockout plant is that stamens and ovaries are basically normal, but pili are deleted;JAZ-10seed abortion occurs in both over-expressed and knockout plants.

The results of the above studies prove that,JAZ-10has a key regulation and control function on the development of plant reproductive organs, and has important application value in plant cross breeding, heterosis utilization and construction or screening of seed abortion plant varieties.

Compared with the prior art, the invention has the main beneficial technical effects that:

1. the invention screens and identifiesJAZ-10Genes based on their overexpression and knockout phenotype and physiology of plantsThe characteristic identification and detection research shows that the plant reproductive organ growth regulator can regulate and control the plant reproductive organ development, and particularly has a key effect on the aspects of regulating and controlling the plant stamen development, the ovary carpel development, the pilus formation and the like, so that the plant reproductive organ growth regulator has important application values in the aspects of plant molecular breeding, cross breeding, heterosis utilization, construction or screening of seed abortion plant varieties and the like.

2. The research and application of the invention lays a solid technical foundation for further research and revelation of the molecular mechanism of the development of plant stamens, the development of ovary carpels and the formation of pilus.

Drawings

FIG. 1 shows dominant expression genes in plant floral organsJAZ-10And Arabidopsis thalianaJAZCluster map of family members.

FIG. 2 shows dominant expression genes in plant floral organsJAZ-10The tissue expression profile of (1).

FIG. 3 shows dominant expression genes in plant floral organsJAZ-10Of overexpression linesSourthernHybridization analysis chart.

FIG. 4 shows dominant expression genes in plant floral organsJAZ-10Analysis of gene mutant sequencing.

FIG. 5 shows control tobacco plants,JAZ-10Gene overexpression lines andJAZ-10and (4) observing and comparing photos of the flower organs of the gene knockout plants.

FIG. 6 shows control tobacco plants,JAZ-10Gene overexpression lines andJAZ-10comparative photographs of carpel observation in the ovary in the floral organ of the gene knockout plant were obtained.

FIG. 7 shows control tobacco plants,JAZ-10Gene overexpression lines andJAZ-10and (3) observing and comparing photos of stigmas in the ovary in the floral organ of the gene knockout plant.

In the above FIGS. 4 to 7, K326 is a control tobacco strain, and K326-T is an overexpression strain; K326-M isJAZ-10A gene mutant plant.

Detailed Description

The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.

The plasmid vectors referred to in the following examples are, unless otherwise specified, conventional commercial vectors; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods involved are conventional methods unless otherwise specified.

Inhibitors of the jasmonic acid pathwayJAZProteins are key factors in regulating jasmonic acid hormone response. The inventor of the present invention relates to common tobacco (Nicotiana tobacum) InJAZThe gene is subjected to tissue expression characteristic analysis, and research finds thatJAZ-10The gene is predominantly expressed in the floral organs.

The first embodiment is as follows: flower organ dominant expression geneJAZ-10Cloning and tissue expression analysis of

1. TobaccoJAZ-10Cloning of (2)

(1) By usingTRIZOLExtracting total RNA of Nicotiana tabacum, and usingPrimerScript RT reagent Kit(TaKaRa, Japan) reverse transcribes the RNA into cDNA.

(2) Cloning of the genes: the PCR reaction condition is 5 min at 95 ℃; at 95 deg.C for 40 s, at 57 deg.C for 50 s, at 72 deg.C for 1 min, and for 35 cycles; at 72 deg.C for 10 min. The amplification primers are (shown in SEQ ID NO. 3-4):

5'- GAATATAATTTAGCAGTGTATAAACATGTC-3'；

5'- CCTGTACATATATAATCCAAGCTGAA-3'。

(3) after the PCR amplification is finished, gel electrophoresis detection is carried out, and the result shows that an obvious band exists at the position of about 550 bp.

(4) After the electrophoresis is finished, the band in the gel is cut off, and the DNA fragment is recovered by using a DNA recovery kit.

(5) Mixing the recovered DNA with pMD19-T vector: (Takara) The connection is made.

(6) And thermally shocking the ligation product into an Escherichia coli DB3.1 strain, screening positive clones by using an ampicillin-resistant LB plate, and extracting plasmids for sequencing analysis.

2. Prediction of sequence conserved domains

Tobacco obtained by sequencing analysisJAZ-10The amino acid sequence of (A) is submitted to NCBI: (https:// www.ncbi.nlm.nih.gov/) Tblastn analysis was performed to query and tobaccoJAZ-10And Arabidopsis thalianaJAZThe clustering relationship of the members.

The results are shown in FIG. 1, and the obtained tobacco was clonedJAZ-10And Arabidopsis thalianaJAZ-1AndJAZ-2the sequence similarity is highest.

3. Analysis of tissue expression characteristics

Collecting roots, stems, leaves and flowers of a common tobacco variety K326 with excellent growth vigor, extracting total RNA of the sample, and synthesizing cDNA through reverse transcription. To be provided withL25 as reference gene, analyzing tobacco by implementing quantitative PCR methodJAZ-10Tissue expression characteristics of the gene. The amplification primers are (shown in SEQ ID NO. 5-8):

JAZ-10-F: 5'-GAGTCAGTATCTCAATGGAAAGGC-3'；

JAZ-10-R: 5'-TGCTGGCTTTATTTATTGACGC-3'；

L25-F: 5'-CCCCTCACCACAGAGTCTGC-3'；

L25-R: TTCTAACTCCTGTTGTTGTGGGAA。

and (3) PCR reaction conditions: 5 min at 95 ℃; 50 s at 95 ℃, 50 s at 60 ℃ and 30 s at 72 ℃ for 35 cycles; at 72 deg.C for 10 min.

The results are shown in FIG. 2:JAZ-10the gene has the highest expression level in flowers, and has only trace expression in roots, stems and leaves. The results show thatJAZ-10The gene is a flower organ dominant expression gene.

Example two:JAZ-10obtaining over-expressed strains of genes

1. Construction of overexpression vectors

TobaccoJAZ-10The gene (the nucleotide sequence is shown in SEQ ID NO.1, and the expression vector adopts a pCAMBIA-NPT vector).

(1) Choose to useSpeI andNrui two restriction sites are ligase sites and are designed as followsJAZ-10Adding cloning primers (shown as SEQ ID NO. 9-10) of the enzyme cutting sites to perform PCR amplification:

F：5'- AGGACTAGTCAATATAATTTAGCAGTGTATAAACATGTC-3'，

R：5'- GAGATCGCGACCTGTACATATATAATCCAAGCTGAA-3'；

the enzyme sites marked in bold are respectivelySpeI andNru I。

the PCR reaction system is as follows: 2. mu.l genomic DNA (100 ng/. mu.l); 1 μ l Primer Star DNA polymerase; 2 μ l primer 1 (10 μ M); 2 μ l primer 2 (10 μ M); 10 μ l of 5 XPCR reaction Buffer; mu.l dNTPs (2.5 mM); 29 μ l of water; the total volume was 50. mu.l.

The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; at 95 ℃ for 50 s, at 57 ℃ for 50 s, at 72 ℃ for 1 min, for 35 cycles; extension at 72 ℃ for 10 min.

(2) After the PCR amplification is finished, gel electrophoresis detection is carried out, and the result shows that an obvious band exists at the position of about 750 bp.

(3) Cutting the gel to recover the target fragment, and recovering the DNA fragment.

(4) By usingSpeI andNrui, respectively carrying out enzyme digestion on the recovered DNA fragment and the pCAMBIA-NPT vector.

An enzyme digestion reaction system: 10 ul DNA (100 ng/. mu.l); 1 ul restriction enzyme 1 (15U/. mu.l); 1 ul restriction enzyme 2 (15U/. mu.l); 5 ul restriction enzyme reaction 10 Xbuffer; the total volume is 50 mul; the enzyme was cleaved at 37 ℃ for 5 hours.

(5) Performing gel electrophoresis, cutting and recoveringJAZ-10And a plasmid fragment;

(6) will be recoveredJAZ-10Carrying out ligation reaction with the plasmid fragment;

connecting a reaction system: 1 μ l of vector backbone; 3 μ lJAZ-10(ii) a 1 μ l T4 ligase; 1. mu.l of 10 XT 4 ligase Buffer; 4 μ l of water; the total volume is 10 mul; ligation was carried out overnight at 16 ℃;

(7) heat shock transformed Escherichia coli DB3.1 strain, Kan resistance screening, selection of positive clone and extraction of recombinant vector named 35S-JAZ-10And storing at-20 ℃ for later use.

2. Recombinant vector 35S-JAZ-10Transformation of Agrobacterium

(1) Add 5. mu.l plasmid (about 500 ng) into the competent cell of Agrobacterium GV3101, mix well, put on ice for 30 min, transfer to liquid nitrogen to quick freeze for 8 min, put into 37 deg.C water bath to heat shock for 5 min.

(2) After heat shock, the competent cells were quickly placed on ice for 5 min and activated for 2h at 160 rmp/min in a shaker at 28 ℃.

(3) Coating the bacteria solution on a container containingKanThe resistant plates were cultured to obtain positive colonies.

3. Obtaining transgenic plants

And adopting a leaf disc transformation method to infect the common tobacco cultivar K326 by agrobacterium. In the presence of 30 mg/LKanIs/are as followsMSScreening of transgenic plants is carried out on the resistance culture medium. Obtaining T3 pure line and utilizingSourthernAnd (3) detecting the copy number of the foreign gene in the transformed plant of the target gene by hybridization.

Using 35S promoter sequence as probeSourthernThe hybridization results are shown in FIG. 3: 2 obtainedJAZ- 10The genome of the over-expression strain has a hybridization band, which indicates that T1 and T2 are both positive strains, and 1 copy of the foreign gene is inserted into each strain.

Example three:JAZ-10obtaining of Gene knockout plants

1. Construction of knockout vectors

Tobacco obtained by sequencingJAZ-10The genomic sequence of (1), designed and synthesized as followsgRNATarget sequence (see SEQ ID NO. 11):

GCGCAGTTGTCTATATTCTATTGthe underline is marked as PAM zone and is done by Hangzhou Baige Biotechnology, Inc.

Oligo dimer and CRISPR/Cas9 vector ligation: 2.0 μ L of CRISPR/Cas9 vector,Oligothe dimer was 1.0. mu.L,Enzyme Mix1.0 μ L of sterile water H₂O was supplemented to 10.0. mu.L. The ligation product is transformed into escherichia coli, plasmids are extracted for sequencing and screeningJAZ-10-knock out gene editing vector.

2. JAZ-10-knock out vector transformation of Agrobacterium

The implementation method and the process are basically the same as the second embodiment.

3. Obtaining of Gene knockout plants

And adopting a leaf disc transformation method to infect the agrobacterium with the common tobacco cultivar K326. Transgenic plants were selected on MS resistant plates of 30 mg/L Kan.

4. JAZ-10Screening of mutant plants

In order to detect the mutation condition of the target site, the following detection primers (shown in SEQ ID No. 12-13) are designed on two sides of the target site, and the genome DNA of the positive transformation plant is subjected to PCR amplification respectively:

F: AGACATAGATCAAAATGGCACAACA，

R: AGCAGAATTAGGTGGACCAGTTTTA。

purifying, sequencing and screening the amplified bandJAZ-10Mutating the plant to obtain K326-M.

The results are shown in FIG. 4: a T is inserted into the SG sequence of the K326-M mutant so thatJAZ-10A mutation occurs.

Example four: identification and detection of phenotypic and physiological characteristics of individual strains

The common tobacco variety K326 is used as a reference, the recombinant tobacco transgenic strain constructed in the first embodiment is used as a test group K326-T, and the recombinant tobacco constructed in the second embodiment is usedJAZ-10The mutant plants were test group K326-M, and morphological observation of flower organs was performed, and the results are shown in FIGS. 5 to 7.

As can be seen from a combination of the figures,JAZ-10the over-expressed lines had no stamens and the ovary was changed from 2 carpels to 3 carpels; whileJAZ-10Stamens and ovaries of the gene knockout plants are basically normal, but piloerection is lost;JAZ-10both over-expressed and gene-knocked out plants fail to be fertilized and seeds can not be obtained.

Among them, FIG. 5 is a floral organ map from which it can be seen that the control K326 has 5 stamens;JAZ-10mutant K326-M and control K326 are similar, have no stamen mutation, have 5 stamens;JAZ-10the two lines K326-T1 and K326-T2 that were over-expressed had no stamens. FIG. 6 is a map of carpels within the ovary from which it can be seen that there are 2 carpels within the ovary of control K326;JAZ-10mutant K326-M and control K326 were similar with 2 carpels in the ovary;JAZ-10two strains K326-T1 and K326-T2 that were overexpressed exhibited an atrial-carpel malformation, appearing as 3 carpels, of which K326-T1 had ovules in all 3 carpels, whereas K326-T2 had ovules in 1 carpel and the other 2 carpels had no ovules. FIG. 7 is a stigma chart from which it can be seen that control K326 has stigma pili;JAZ-10the mutation plant K326-M has pilus mutation and has no pilus;JAZ-10the two lines K326-T1 and K326-T2 that were overexpressed were similar to the control K326 and had pili.

The above test results prove that,JAZ-10has a key regulation and control function on the development of plant reproductive organs, and has important application value in the construction or screening of seed abortion plant varieties.

Although the present invention has been described with reference to specific embodiments, it will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and various changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principle of the present invention are also intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Henan university of agriculture

<120> plant floral organ dominant expression gene JAZ-10, expression product, expression vector and application thereof

<130> /

<160> 13

<170> PatentIn version 3.2

<210> 1

<211> 534

<212> DNA

<213> tobacco

<400> 1

atggattttt tgacaaacat agaagagcaa tcaactaaga caatgggcca agacaagaaa 60

ttaatagatc atgttcctcg aaatgcaaca agaaattctt ttagagaaat ggaagtgtcc 120

ataaataaag ccagcaacag tagtaaagag acacaaaagg agttaaaggc agcgcagttg 180

tctatattct atggtggtaa agtaatagta tttgatgatt tcccagctga taaagccaga 240

gcaatgatgt tattagctag caaaggaagc cctcagaatt cttgtgctgt ttttcagacg 300

gctaacattg acaaaactgg tcctcttaag ctcggctcta attctgctgc taacaacttt 360

gatttaccta ttgcaagaag atcttcactt cataggttcc ttggcaggag gaaagataga 420

gacacggcta gagcgccata ccaagtgcag aatccattgc catcatcttc aaagaataag 480

gaatcaactt ccatgattcg tgatcagagc tttgatctca acttcacgtt atag 534

<210> 2

<211> 177

<212> PRT

<213> tobacco

<400> 2

Met Asp Phe Leu Thr Asn Ile Glu Glu Gln Ser Thr Lys Thr Met Gly

1 5 10 15

Gln Asp Lys Lys Leu Ile Asp His Val Pro Arg Asn Ala Thr Arg Asn

20 25 30

Ser Phe Arg Glu Met Glu Val Ser Ile Asn Lys Ala Ser Asn Ser Ser

35 40 45

Lys Glu Thr Gln Lys Glu Leu Lys Ala Ala Gln Leu Ser Ile Phe Tyr

50 55 60

Gly Gly Lys Val Ile Val Phe Asp Asp Phe Pro Ala Asp Lys Ala Arg

65 70 75 80

Ala Met Met Leu Leu Ala Ser Lys Gly Ser Pro Gln Asn Ser Cys Ala

85 90 95

Val Phe Gln Thr Ala Asn Ile Asp Lys Thr Gly Pro Leu Lys Leu Gly

100 105 110

Ser Asn Ser Ala Ala Asn Asn Phe Asp Leu Pro Ile Ala Arg Arg Ser

115 120 125

Ser Leu His Arg Phe Leu Gly Arg Arg Lys Asp Arg Asp Thr Ala Arg

130 135 140

Ala Pro Tyr Gln Val Gln Asn Pro Leu Pro Ser Ser Ser Lys Asn Lys

145 150 155 160

Glu Ser Thr Ser Met Ile Arg Asp Gln Ser Phe Asp Leu Asn Phe Thr

165 170 175

Leu

<210> 3

<211> 30

<212> DNA

<213> Artificial primer

<400> 3

gaatataatt tagcagtgta taaacatgtc 30

<210> 4

<211> 26

<212> DNA

<213> Artificial primer

<400> 4

cctgtacata tataatccaa gctgaa 26

<210> 5

<211> 24

<212> DNA

<213> Artificial primer

<400> 5

gagtcagtat ctcaatggaa aggc 24

<210> 6

<211> 22

<212> DNA

<213> Artificial primer

<400> 6

tgctggcttt atttattgac gc 22

<210> 7

<211> 20

<212> DNA

<213> Artificial primer

<400> 7

cccctcacca cagagtctgc 20

<210> 8

<211> 24

<212> DNA

<213> Artificial primer

<400> 8

ttctaactcc tgttgttgtg ggaa 24

<210> 9

<211> 39

<212> DNA

<213> Artificial primer

<400> 9

aggactagtc aatataattt agcagtgtat aaacatgtc 39

<210> 10

<211> 36

<212> DNA

<213> Artificial primer

<400> 10

gagatcgcga cctgtacata tataatccaa gctgaa 36

<210> 11

<211> 23

<212> DNA

<213> Artificial primer

<400> 11

gcgcagttgt ctatattcta ttg 23

<210> 12

<211> 25

<212> DNA

<213> Artificial primer

<400> 12

agacatagat caaaatggca caaca 25

<210> 13

<211> 25

<212> DNA

<213> Artificial primer

<400> 13

agcagaatta ggtggaccag tttta 25

Claims (2)

1. A method of obtaining a male sterile tobacco material, comprising the steps of:

(1) cloning plant floral organ dominant expression gene with nucleotide sequence shown as SEQ ID NO.1JAZ-10Inserting strong promoter 35S into the expression vector to obtain an overexpression vector;

(2) transforming it into receptor tobacco and culturing to obtain male sterile plant material.

2. A method for obtaining seed abortion tobacco material is characterized by comprising the following steps:

(1) design based on conserved sequencessgRNAPrimer, and constructs plant floral organ dominant expression gene with nucleotide sequence as shown in SEQ ID NO.1JAZ-10The CRISPR/Cas9 vector of (a);

(2) transforming the plant material into receptor tobacco and culturing to obtain plant material without stigma hair and seed abortion.

Images