CN113005133A - Preparation, renaturation and preservation method of VacA recombinant protein - Google Patents

Preparation, renaturation and preservation method of VacA recombinant protein Download PDF

Info

Publication number
CN113005133A
CN113005133A CN202110265719.8A CN202110265719A CN113005133A CN 113005133 A CN113005133 A CN 113005133A CN 202110265719 A CN202110265719 A CN 202110265719A CN 113005133 A CN113005133 A CN 113005133A
Authority
CN
China
Prior art keywords
vaca
recombinant protein
bacterial
buffer solution
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110265719.8A
Other languages
Chinese (zh)
Inventor
王芬
袁玲芝
肖士郎
蔡婷
陈冰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Xiangya Hospital of Central South University
Original Assignee
Third Xiangya Hospital of Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Third Xiangya Hospital of Central South University filed Critical Third Xiangya Hospital of Central South University
Priority to CN202110265719.8A priority Critical patent/CN113005133A/en
Publication of CN113005133A publication Critical patent/CN113005133A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a preparation, renaturation and preservation method of VacA recombinant protein. The method comprises the following steps: obtaining a VacA gene sequence, and constructing a VacA recombinant expression vector after PCR amplification; transforming the expression vector into Escherichia coli, performing amplification culture, and adding an inducer to induce protein expression to obtain a bacterial liquid; centrifuging the bacterial liquid, taking a bacterial precipitate, and carrying out ultrasonic lysis on the bacterial precipitate by adopting a lysis buffer solution to obtain a cell lysate; purifying the cell lysate to obtain a VacA recombinant protein; the VacA recombinant protein is dialyzed and renatured by adopting an acetic acid buffer solution with the pH value of 2.9 and is stored, and the preparation, renaturation and storage methods can obtain the high-activity VacA recombinant protein and can induce cell apoptosis.

Description

Preparation, renaturation and preservation method of VacA recombinant protein
Technical Field
The invention belongs to the field of biological medicine, and particularly relates to a preparation, renaturation and preservation method of VacA recombinant protein.
Background
The VacA toxin is one of the most important virulence factors of Hp, and the VacA protein plays a very important role in the pathogenesis of chronic gastritis-cancer.
The lack of a uniform efficient expression system for the VacA toxin has hampered the fundamental research based on the structure and function of VacA. Research shows that the natural VacA extracted from Hp has low yield, large workload and difficult purification; the components of the crude pure liquid of the VacA toxin collected from the Hp secretion supernatant are complex and various, and the function of the protein is difficult to explain and analyze; however, the conventional VacA recombinant protein has no activity, and has biological activity after being activated in vitro with HCl. Therefore, how to obtain VacA recombinant protein with high yield and biological activity has important scientific significance.
Disclosure of Invention
In order to solve the technical problems, the VacA recombinant plasmid is successfully constructed, recombinant protein is induced and expressed in Escherichia coli, the VacA recombinant protein is renatured and stored in acetic acid buffer solution with the pH value of 2.9, and the renatured and stored VacA recombinant protein has the biological activity of promoting apoptosis.
Based on the above findings, the present invention aims to provide a method for preparing, renaturing and preserving VacA recombinant protein, which is characterized by comprising the following steps:
obtaining a VacA gene sequence, and constructing a VacA recombinant expression vector after PCR amplification;
transforming the expression vector into Escherichia coli, performing amplification culture, and adding an inducer to induce protein expression to obtain a bacterial liquid;
centrifuging the bacterial liquid, taking a bacterial precipitate, and carrying out ultrasonic lysis on the bacterial precipitate by adopting a lysis buffer solution to obtain a cell lysate; purifying the cell lysate to obtain a VacA recombinant protein;
the VacA recombinant protein was dialyzed against acetate buffer at pH2.9, renatured and stored.
Further, the conditions for the PCR amplification of the VacA gene sequence are as follows:
the primer sequence is as follows:
F1:5'caatcgttggcggcatcgctacgggtacggctgttggcacggtttcgggcctgcttagttggggactc3'；
F:5'ctttaagaaggagatatacatatgtttttcaccacggttatcattccggcaatcgttggcggcatcgct3'；
the reaction conditions were as follows: pre-denaturation at 96 ℃ for 5 min; 30 seconds at 96 ℃, 30 seconds at 57 ℃,1 minute and 20 seconds at 72 ℃ and 5 minutes at 72 ℃.
Further, the step of transforming the expression vector into escherichia coli, performing amplification culture, and adding an inducer to induce protein expression to obtain a bacterial liquid specifically comprises the following steps:
transforming the expression vector into Escherichia coli, and coating K+Plating, culturing at 37 deg.C overnight, inoculating single colony to LB culture medium containing kanamycin, culturing overnight, transferring to K-containing medium+Culturing the LB culture medium;
when the cell proliferation growth curve reaches OD 1.2 at 600nm, 0.5mM isopropyl thiogalactoside inducer is added to induce protein expression, and a bacterial solution is obtained.
Further, the step of ultrasonically lysing the bacterial precipitate by using a lysis buffer to obtain a cell lysate specifically comprises:
and (3) performing ultrasonic treatment on the bacterial precipitate by adopting a lysis buffer solution tris (hydroxymethyl) aminomethane hydrochloride buffer solution for 15min at the ultrasonic power of 500W for 3s and at the intermittent time of 3s to obtain a cell lysate.
Further, the bacterial lysate is centrifuged to obtain a first supernatant and an inclusion body precipitate.
Further, purifying the first supernatant of the bacterial lysate to obtain a VacA recombinant protein specifically includes:
adopting Ni-IDA resin, taking lysis buffer as column equilibrium buffer, and gradient elution with imidazole-containing lysis buffer to obtain VacA recombinant protein.
Further, purifying inclusion body precipitates in the bacterial lysate to obtain the VacA recombinant protein specifically comprises:
and dissolving the inclusion body precipitate in a denaturation buffer solution, carrying out ultrasonic lysis, centrifuging to obtain a second supernatant, eluting the second supernatant with a Ni column by using a deformation buffer solution as a column balance buffer solution and a washing buffer solution to remove the hybrid protein, and eluting with a washing buffer solution containing imidazole to obtain the VacA recombinant protein.
Further, the denaturation buffer is: a compound solution of trihydroxymethyl aminomethane hydrochloride and urea; the washing buffer solution is a compounded solution of tris (hydroxymethyl) aminomethane hydrochloride, urea, polyoxyethylene mono-tert-octyl phenyl ether and sodium chloride.
Has the advantages that:
the invention obtains positive engineering bacteria with stable expression by amplifying VacA toxin gene segments, constructs recombinant plasmids and converts the recombinant plasmids into Escherichia coli to obtain the recombinant proteins, IPTG induces the engineering bacteria to efficiently express the recombinant proteins VacA, target proteins are respectively purified from supernatant and inclusion bodies, through renaturation proteins of different buffers, the VacA recombinant proteins can be renatured and stored through an acetic acid buffer solution with pH of 2.9, the VacA recombinant proteins stored in the acetic acid buffer solution are incubated with GES-1 cells, apoptosis is detected through an inverted microscope, a transmission electron microscope and a TUNEL method, the cell volume is reduced, apoptosis changes such as early nuclear edge condensation, chromatin edge set and the like occur, and the VacA recombinant proteins can induce the cell apoptosis and have biological activity.
The invention firstly provides a renaturation preservation buffer solution which adopts an acetic acid buffer solution with the pH value of 2.9 as the VacA recombinant protein, on one hand, the activity of the VacA recombinant protein can be ensured, on the other hand, the preservation condition is mild, no adverse effect is caused to operators, and the VacA recombinant protein has the advantages of easily obtained raw materials, low cost and environmental friendliness.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 shows the construction of VacA recombinant plasmids provided in the examples of the present invention; A) is a VacA expression vector pET41b-VacA34 -854Constructing a schematic diagram; B) is pET41b-VacA34-854Enzyme digestion identification result; C) is a recombinant plasmid pET41b-VacA34-854Positive clone sequencing graphs of (1);
FIG. 2 is a SDS-PAGE and Westernblot analysis of the VacA recombinant protein expression and purification process provided in the examples of the present invention; A. b): the expression of the VacA protein in Escherichia coli was analyzed by SDS-PAGE and Westernblot, respectively; C. d) purification of the VacA protein in the supernatant with a Ni column by SDS-PAGE and Westernblot analysis, respectively; E) purifying the inclusion body VacA protein by SDS-PAGE analysis using a Ni column;
FIG. 3 is a diagram showing the expression identification SDS-PAGE analysis and Westernblot analysis of VacA recombinant protein according to the present invention; AB. CD was identified after purification of VacA recombinant protein from the first supernatant, inclusion bodies, respectively: SDS-PAGE analysis (left) and Westernblot analysis (right);
FIG. 4 shows the amount of protein after SDS-PAGE and Westernblot to detect renaturation of different renaturators according to the embodiment of the present invention;
FIG. 5 is a diagram of the observation under an inverted microscope of a VacA recombinant protein (65ug/ml) stimulating GES-1 cells provided in the examples of the present invention;
FIG. 6 is a diagram of the change of the microstructure of the GES-1 cell observed by a transmission electron microscope according to the embodiment of the present invention;
FIG. 7 is a TUNEL method for detecting apoptosis induced by VacA recombinant protein according to an embodiment of the present invention, A) is a representative image of TUNEL assay of experimental and control groups, and B) is a comparative graph of quantified apoptosis rates of the experimental and control groups.
Detailed Description
In order to make the technical problems, technical solutions and advantages of the present invention more apparent, the following detailed description is given with reference to the accompanying drawings and specific embodiments, but the scope of the present invention is not limited to the following specific embodiments.
Unless otherwise defined, all terms of art used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.
In the examples of the present invention, the cell lines and strains used were: GES-1 cells, a h.pyri standard strain (strain J99/ATCC 700824), were provided by the institute for tumor research at the university of south and middle university, and escherichia coli TOP10, BL21(DE3), plasmid pET41b were purchased from tokadsry ltd.
In the present example, DNA extraction kit was purchased from Takara, China, and plasmid extraction kit was purchased from Invitrogen, USA, PAGE-MASTER Protein Standard (for SDS-PAGE), EasyWesternprotein Standard, and THETM His tag antibody were purchased from Kingsry, Inc., south China (product numbers M00516, MM0908, and A00186, respectively). Other agents are provided by tumors of the university of south central.
Example 1
Construction of VacA recombinant expression vector
The vcaA gene sequence (mature fragment of VacA toxin, sequence expressing amino acids 34-854) of H.pyrori standard strain (strain J99/ATCC 700824) is used as a template to synthesize mutation primers, and the primers at two ends of the gene are shown as SEQ ID NO.1 and SEQ ID NO. 2. The sequence SEQ ID NO.1 contains a recognition site for the restriction enzyme Nde I, and the sequence SEQ ID NO.2 contains a recognition site for the restriction enzyme Xho I. Under the reaction conditions: pre-denaturation at 96 ℃ for 5 min; PCR amplification was carried out at 96 ℃ for 30 seconds, 57 ℃ for 30 seconds, 72 ℃ for 1 min and 20 seconds, and 72 ℃ for 5 minutes (25 cycles were set).
The PCR product was digested with restriction enzymes Nde I and Xho I, and inserted into an expression vector plasmid pET41b (Novagen) containing a C-terminal histidine tag (8His tag); the PC R product and pET41b plasmids were expressed in 10: 1 was bound in 1 Xligation buffer (50mM Tris-HCl, pH 7.5,10mM MgCl2,1mMATP,1mM DL-Dithioreitol (DTT), 25% (w/v) polyethylene glycol 8000), T4 DNA ligase was added to a final volume of 20. mu.L and incubated overnight at 16 ℃. Mixing 10ul ligation product with 100ul Escherichia coli TOP10 competent cells ((100 uL, 1 × 108 cfu/ug, optical density of cell at 600nm reaches 0.5-0.8)) uniformly, ice-cooling for 30min, heat-shocking at 42 deg.C for 60s, immediately ice-cooling for 2min, adding 800ul LB culture solution preheated to room temperature, shake-culturing at 37 deg.C for 1.5h, centrifuging at 12000r/min for 2min, discarding 800ul culture supernatant, resuspending precipitate, and uniformly spreading on K-containing medium+The cells were cultured in an inverted state in a 37 ℃ incubator overnight in a resistant LB dish. 5 well-growing colonies were picked and inoculated in a medium containing 5ul K+And then cultured overnight at 37 ℃ in a constant temperature shaking table in 5ml of LB medium to obtain a recombinant plasmid, namely the VacA recombinant expression vector.
Extracting plasmid according to the specification of the plasmid extraction kit, carrying out NdeI/XhoI double digestion, carrying out 1% agarose gel electrophoresis, and identifying, wherein the plasmid can be digested to 2502bp positive clone. The correct recombinant clones were identified for sequencing validation. As shown in FIG. 1A, the construction of VacA recombinant plasmid is schematically shown, a single specific band with a size of about 2502bp can be seen in an experimental group using the recombinant plasmid as a template, the band is basically consistent with an expected fragment, and the recombinant plasmid is identified by Ndel + Xhol double enzyme digestion to obtain two corresponding electrophoresis bands which are consistent with the sizes of an expected empty plasmid and a target gene fragment (FIG. 1B), which indicates that the recombinant plasmid is identified as positive by enzyme digestion. The sequencing result of the plasmid is completely consistent with the corresponding sequence of the mature fragment of VacA in GeneBank (FIG. 1C), which proves that the plasmid is a specific target gene PCR product and the construction of the recombinant plasmid is successful.
Example 2
Expression and purification of VacA recombinant proteins
The recombinant plasmid was transformed into Escherichia coli BL21(DE3), and K was applied+Plates were incubated overnight at 37 ℃. Subsequently, the single colonies were inoculated into 50ml of LB medium containing kanamycin (50. mu.g/ml), and the colonies were cultured overnight at 37 ℃ on a shaker at 200 rpm. 100ul of the cells are transferred into the cells containing K+The cells were cultured in 5ml of LB (Becton Dickinson), further cultured at 37 ℃ and 200rpm, and the cell growth density was observed when the cell growth curve reached OD 1 at 600nm2.2, 0.5mM IPTG was added and protein expression was induced under different conditions (20 ℃ for 20h, 37 ℃ for 4h, 15 ℃ for 16h) at 200 rpm. After induction, the cells were resuspended and expression was characterized by SDS-PAGE and Westernblot.
The bacterial liquid obtained by the above culture was collected, centrifuged, and the supernatant was discarded, the cell pellet was resuspended in lysis buffer (50mM Tris-HCl, pH8.0), the cells were ultrasonically lysed (500w, 3s by sonication, 3s by pause, 15min total), and the cell lysate was collected by centrifugation at 13,000rpm for 30min at 4 ℃. Wherein the cell lysate comprises the first supernatant and the inclusion bodies.
The purification of the VacA recombinant protein from the first supernatant comprises in particular: the target protein was purified from the supernatant using Ni-IDA resin. The above lysis buffer (Tris-HCl 50mmol, NaCl 150mmol, pH8.0) was used as a column equilibration buffer, and the target protein was gradient-eluted with imidazole buffer (Tris-HCl 50mmol, NaCl 150mmol, pH8.0+ gradient concentration of imidazole 20, 50, 100, 500mmol, respectively), washed with a washing solution (Tris-HCl 50mmol, NaCl 150mmol, 1% TritonX-114, pH8.0), and analyzed by Western-blot and SDS-PAGE. Based on the Western-blot and SDS-PAGE results, the bands with the highest expression level of the target protein were pooled and dialyzed into 1 XPBS buffer at pH 7.4. Dialysis was performed for 4 hours in a 14kDa dialysis membrane and the above buffer was replaced with the same fresh buffer (1 XPBS, pH 7.4) and dialysis was performed for 16 hours. After dialysis, the sample was centrifuged at 13000rpm for 30 minutes and filtered through a 0.22 μm filter to obtain the VacA recombinant protein.
The purification of VacA recombinant proteins from inclusion bodies specifically includes: the inclusion body pellet was dissolved in a denaturation buffer (50mM Tris-HCl,8M Urea, pH8.0), sonicated, and the cell pellet was centrifuged at 13000rpm at 4 ℃ for 30min to obtain a second supernatant, which was used for further purification. The target protein in the supernatant was purified using a Ni column (NTA). The VacA recombinant protein was obtained by eluting the hybrid protein with a denaturing buffer as a column equilibration buffer (50mM Tris-HCl,8MUrea, pH8.0) and a washing buffer (50mM Tris-HCl, 1% TritonX-114, 8MUrea, 150mM NaCl, pH8.0), then eluting the target protein with different concentrations of imidazole elution buffers (Tris-HCl 50mmol, NaCl 150mmol, pH8.0+ different concentrations of imidazole, e.g., 20, 500mmol), collecting the fractions for SDS-PAGE and WesternBlot analysis.
The induction conditions are as follows: the bacterial solution obtained by the overnight induction at 15 ℃ was used as an example, and the recombinant protein was purified by the above method and analyzed by SDS-PAGE and Westernblot, and the results are shown in FIGS. 2 and 3, and A, B in FIG. 2): the expression of the VacA protein in Escherichia coli was analyzed by SDS-PAGE and Westernblot, respectively: lane M: protein labeling; lane NC: no induced cell lysate; lane 1: cell lysates induced at 15 ℃ for 16 hours; lane 2: supernatant of cell lysate induced at 15 ℃ for 16 hours; lane 3: precipitation of cell lysates was induced at 15 ℃ for 16 hours. C. D) purification of the VacA protein in the supernatant by means of a Ni column by SDS-PAGE and Westernblot analysis, respectively, lane M: protein marker; lane 1: supernatant after centrifugation of the cell lysate; and (2) a step: flowing out; lanes 3-5: eluting with 50mM Tris-HCl, 20mM imidazole, 150mM NaCl, pH 8.0; lanes 6-7: eluting with 50mM Tris-HCl, 50mM imidazole, 150mM NaCl, pH 8.0; lanes 8-9: eluting with 50mM Tris-HCl, 100mM imidazole, 150mM NaCl, pH 8.0; lanes 10-11: eluted with 50mM Tris-HCl, 500mM imidazole, 150mM NaCl, pH 8.0. E) Inclusion body VacA protein purified by Ni column by SDS-PAGE analysis, lane M: protein marker; and (2) a step: flowing out; lane 3: precipitation of the cell lysate after centrifugation; lane 4: eluting with 50mM Tris-HCl, 20mM imidazole, 8M urea, pH 8.0; lane 5: elution was performed with 50mM Tris-HCl, 300mM imidazole, 8M urea, pH 8.0. In FIG. 3, AB and CD are identified after purifying VacA recombinant protein from supernatant and inclusion body, respectively: SDS-PAGE analysis (left) and Westernblot analysis (right); lane 1 BSA (2.00. mu.g); lane 2, vacA34-854 (2.00. mu.g); lane 3, vacA 34-854; m1 and M2 are both protein markers. As can be seen from the above, the VacA recombinant protein can be obtained by the separation and purification method of the present invention, and more recombinant protein can be obtained from inclusion bodies than by supernatant purification.
Example 3
The VacA recombinant protein purified from inclusion bodies was renatured and the buffers shown in table 1 were selected. The recombinant proteins were renatured in the buffer as shown in Table 1, and the renaturation analysis of the proteins was carried out by the solubility of the proteins (when the proteins were dissolved in the buffer, the renaturation failed if the precipitate appeared, and the renaturation succeeded if the precipitate was completely dissolved), or by the results of SDS-PAGE and Western-blot analysis (collection of the lysates, and further analysis of the protein content by SDS-PAGE and Western-blot).
TABLE 1 selection of renaturation buffer solutions
Figure BDA0002971689930000071
Figure BDA0002971689930000081
The renatured VacA recombinant protein was collected, passed through a dialysis membrane with a molecular weight cut-off of 14kDa for 4 hours, then dialyzed against fresh buffer of the same type as described above for 16 hours, and finally dialyzed into the final buffer for 16 hours. The most suitable final protein preservation solution is selected according to the protein renaturation result and the buffer solvent used in the solution. The final preservation solution must not interfere with the detection of the biological activity of the target protein. After dialysis, the target protein was centrifuged at 13000rpm for 30 minutes and filtered through a 0.22 μm filter. The effect of protein renaturation was identified by SDS-PAGE and WesternBlot.
As shown in fig. 4, wherein lane M: protein marker; lane 1: before protein renaturation; lane 2: 50mM Tris, 10% Gly, 150mM NaCl, pH 8; lane 3: 50mM Tris, 10% Gly, 150mM NaCl,0.1mM DTT, pH 8.0; lane 4: 1 XPBS, pH 7.4; lane 5: 1 XPBS, 10% GLy,500mM NaCl, pH 7.4; lane 6: 1 XPBS, 10% GLy,500mM NaCl,0.1mM DTT, pH 7.4; lane 7: 20mM Tris,2M Urea,400 mMAGg, 2.5mM cysteamine,0.25mM cystamine, pH 8.5, lane 8: 50mM acetic acid, pH 2.9. From 4, the VacA recombinant protein has different renaturation effects in different buffer solutions, wherein the renaturation is not successful in the buffer solutions 1-5, and after the renaturation is successful in the buffer solutions 6 and 7, the buffer solution 6 and the buffer solution 7 are adopted as final buffer solutions for dialysis storage; the buffer solution 6 contains various substances such as tris (hydroxymethyl) aminomethane hydrochloride, urea, arginine, cysteamine, cystamine and the like, the preparation process is complex, and the arginine in the buffer solution can interfere the apoptosis-promoting biological activity of the VacA recombinant protein, so the buffer solution 6 is not suitable for the final preservation solution of the VacA recombinant protein; the buffer solution 7 is 50mM acetic acid, the preparation is simple, the contained compound is only acetic acid, the raw material source is wide, the cost is low, the environment-friendly property is realized, and the VacA recombinant protein can be successfully renatured and stored.
The recombinant protein obtained in example 4 was used to stimulate GES-1 cells (VacA group) with a final concentration of 65ug/ml of VacA recombinant protein, incubated for 24h, and an equal volume of Buffer (50mM acetic acid, pH2.9) was used as a control (Buffer) while a standard medium was used as a blank (Normal control). Observing the morphological change of the cells under an inverted microscope after incubation for 6h, 12h and 24h respectively, as shown in FIG. 5; and observing the GES-1 cell fiber structures of the blank control group, the buffer control group and the experimental group with different amplification degrees after 24 hours by adopting a transmission electron microscope, as shown in figure 6. As can be seen from FIG. 5, the VacA protein stimulates apoptosis of the histiocytes obviously, and a large amount of nuclear condensation and edge-to-edge condensation of chromatin in the nucleus occur, but no obvious vacuolation of the cells is observed at any time point. As can be seen from fig. 6, no abnormality occurred in the buffer control group and the blank control group, whereas in the VacA recombinant protein group, C1: the cell volume is reduced, and the surface microvilli disappears (magnification times 5000); c2: nuclei were condensed and aggregated toward the periphery (magnification × 10000); c3 and C4: the cytoplasm disintegrates, and a large number of vacuoles (magnification × 10000) appear. In addition, apoptosis induced by VacA recombinant protein was detected by TUNEL method, nuclei were counterstained with DAPI (blue), TUNEL positive cells (red) represent apoptosis, and the results are shown in fig. 7. The VacA recombinant protein preserved by acetic acid dialysis has the activity of promoting apoptosis.
The invention obtains positive engineering bacteria with stable expression by amplifying VacA toxin gene segments, constructs recombinant plasmids, converts the recombinant plasmids into Escherichia coli, induces the engineering bacteria to efficiently express recombinant protein VacA by IPTG, purifies target proteins from supernatant and inclusion bodies respectively, adopts renaturation buffer solution (pH2.9 acetic acid buffer solution) to carry out renaturation treatment to obtain renaturated protein, adopts pH2.9 acetic acid buffer solution to dialyze and store, and carries out biological activity test on the preserved VacA recombinant protein, wherein the VacA protein has apoptosis promoting activity. Therefore, the acetate buffer solution with the pH value of 2.9 can be used as renaturation and preservation solution of the recombinant VacA recombinant protein, on one hand, the activity of the VacA recombinant protein can be ensured, on the other hand, the preservation condition is mild, no adverse effect is caused to operators, and the acetate buffer solution has the advantages of easily obtained raw materials, low cost and environmental friendliness.
While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims (8)

1. A preparation, renaturation and preservation method of VacA recombinant protein is characterized by comprising the following steps:
obtaining a VacA gene sequence, and constructing a VacA recombinant expression vector after PCR amplification;
transforming the expression vector into Escherichia coli, performing amplification culture, and adding an inducer to induce protein expression to obtain a bacterial liquid;
centrifuging the bacterial liquid, taking a bacterial precipitate, and carrying out ultrasonic lysis on the bacterial precipitate by adopting a lysis buffer solution to obtain a cell lysate; purifying the cell lysate to obtain a VacA recombinant protein;
the VacA recombinant protein was dialyzed against acetate buffer at pH2.9, renatured and stored.
2. The method for the preparation, renaturation and preservation of the VacA recombinant protein according to claim 1, characterized in that the conditions for the PCR amplification of the VacA gene sequence are:
the primer sequence is as follows:
F1:5'caatcgttggcggcatcgctacgggtacggctgttggcacggtttcgggcctgcttagttggggactc3'；
F:5'ctttaagaaggagatatacatatgtttttcaccacggttatcattccggcaatcgttggcggcatcgct3'；
the reaction conditions were as follows: pre-denaturation at 96 ℃ for 5 min; 30 seconds at 96 ℃, 30 seconds at 57 ℃,1 minute and 20 seconds at 72 ℃ and 5 minutes at 72 ℃.
3. The method for preparing, renaturing and preserving the VacA recombinant protein according to claim 1, wherein the step of transforming the expression vector into escherichia coli, performing amplification culture and adding an inducer to induce protein expression to obtain a bacterial solution comprises:
transforming the expression vector into Escherichia coli, and coating K+Plating, culturing at 37 deg.C overnight, inoculating single colony to LB culture medium containing kanamycin, culturing overnight, transferring to K-containing medium+Culturing the LB culture medium;
when the cell proliferation growth curve reaches OD 1.2 at 600nm, 0.5mM isopropyl thiogalactoside inducer is added to induce protein expression, and a bacterial solution is obtained.
4. The method for preparing, renaturing and preserving the VacA recombinant protein according to claim 1, wherein the step of ultrasonically lysing the bacterial pellet with lysis buffer to obtain a cell lysate specifically comprises:
and (3) performing ultrasonic treatment on the bacterial precipitate by adopting a lysis buffer solution tris (hydroxymethyl) aminomethane hydrochloride buffer solution for 15min at the ultrasonic power of 500W for 3s and at the intermittent time of 3s to obtain a cell lysate.
5. The method for the preparation, renaturation and preservation of VacA recombinant protein according to claim 1, characterized in that said bacterial lysate is centrifuged to obtain a first supernatant and an inclusion body pellet.
6. The method for preparing, renaturing and preserving the VacA recombinant protein according to claim 5, wherein the purifying the first supernatant from the bacterial lysate to obtain the VacA recombinant protein comprises:
adopting Ni-IDA resin, taking lysis buffer as column equilibrium buffer, and gradient elution with imidazole-containing lysis buffer to obtain VacA recombinant protein.
7. The method for preparing, renaturing and preserving the VacA recombinant protein according to claim 5, wherein the purification of the inclusion body precipitate from the bacterial lysate to obtain the VacA recombinant protein comprises:
and dissolving the inclusion body precipitate in a denaturation buffer solution, carrying out ultrasonic lysis, centrifuging to obtain a second supernatant, eluting the second supernatant with a Ni column by using a deformation buffer solution as a column balance buffer solution and a washing buffer solution to remove the hybrid protein, and eluting with a washing buffer solution containing imidazole to obtain the VacA recombinant protein.
8. The method for the preparation, renaturation and preservation of VacA recombinant protein according to claim 7, characterized in that said denaturing buffer is: a compound solution of trihydroxymethyl aminomethane hydrochloride and urea; the washing buffer solution is a compounded solution of tris (hydroxymethyl) aminomethane hydrochloride, urea, polyoxyethylene mono-tert-octyl phenyl ether and sodium chloride.
CN202110265719.8A 2021-03-11 2021-03-11 Preparation, renaturation and preservation method of VacA recombinant protein Pending CN113005133A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110265719.8A CN113005133A (en) 2021-03-11 2021-03-11 Preparation, renaturation and preservation method of VacA recombinant protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110265719.8A CN113005133A (en) 2021-03-11 2021-03-11 Preparation, renaturation and preservation method of VacA recombinant protein

Publications (1)

Publication Number Publication Date
CN113005133A true CN113005133A (en) 2021-06-22

Family

ID=76405226

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110265719.8A Pending CN113005133A (en) 2021-03-11 2021-03-11 Preparation, renaturation and preservation method of VacA recombinant protein

Country Status (1)

Country Link
CN (1) CN113005133A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110846335A (en) * 2018-12-22 2020-02-28 波音特生物科技（南京）有限公司 Preparation method of antibody kit capable of detecting highly pathogenic strains of helicobacter pylori

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110846335A (en) * 2018-12-22 2020-02-28 波音特生物科技（南京）有限公司 Preparation method of antibody kit capable of detecting highly pathogenic strains of helicobacter pylori

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DIRK KUCK等: "Vacuolating Cytotoxin of Helicobacter pylori Induces Apoptosis in the Human Gastric Epithelial Cell Line AGS", 《INFECTION AND IMMUNITY》 *
LING-ZHI YUAN等: "Construction and preservation of a stable and highly expressed recombinant Helicobacter pylori vacuolating cytotoxin A with apoptotic activity", 《BMC MICROBIOLOGY》 *
MARINA DE BERNARD等: "Low pH Activates the Vacuolating Toxin of Helicobacter pylori, Which Becomes Acid and Pepsin Resistant", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 *
NCBI: "GenBank登录号：AE001439.1", 《NCBI GENBANK》 *
NCBI: "GenBank登录号：MZ369157.1", 《NCBI GENBANK》 *
VIET Q. NGUYEN等: "Carboxy-Terminal Proteolytic Processing of Helicobacter pylori Vacuolating Toxin", 《INFECTION AND IMMUNITY》 *
常辉等: "幽门螺杆菌分泌与重组表达的VacA蛋白的分离纯化及其致细胞空泡效应与凋亡的对比研究", 《军事医学》 *
朱红音等: "三种幽门螺杆菌疫苗候选抗原的蛋白制备与复性研究", 《中华检验医学杂志》 *
段秀杰等: "幽门螺杆菌VacA重组蛋白对SGC7901胃癌细胞的作用", 《世界华人消化杂志》 *

Similar Documents

Publication Publication Date Title
CN111423486A (en) Renaturation method of new type coronavirus recombinant protein inclusion body
Wachter et al. Activation of interspecies-hybrid Rubisco enzymes to assess different models for the Rubisco–Rubisco activase interaction
WO2022089573A1 (en) Recombinant vector and expression purification method for heat-labile ung fusion protein
CN110078791B (en) Method for realizing protein crosslinking based on amino acid specificity recognition
CN113005133A (en) Preparation, renaturation and preservation method of VacA recombinant protein
CN109486779B (en) DNA methyltransferase and soluble heterologous expression and separation and purification method thereof
CN113234747B (en) Expression and purification method of heat shock protein HSP60 and application thereof
CN114276417B (en) Method for identifying whole genome DNA guanine tetrad site under normal physiological condition of plant
CN107746432A (en) A kind of modified proteins of A β 42 and its expression and purification method
CN115725551A (en) Application of MmBBK2 in preparation of trypsin and chymotrypsin inhibitors
WO2023019832A1 (en) Expression and purification method for main protease of coronavirus
CN108753753B (en) Purification method of LRR receptor kinase-PXY
CN108864273B (en) Simulated human-derived antibacterial peptide and preparation method thereof
CN113430220A (en) Synthesis method, construction method and application of genetic engineering bacteria for expressing soluble feline omega interferon
CN106188311B (en) Preparation method and application of recombinant tumor necrosis factor-related apoptosis-inducing ligand protein
CN107893059B (en) Preparation and application of tilapia disease-resistant immune gene recombinant protein
CN110628746A (en) Method for preparing BEM for purifying immobilized recombinant protein with AcmA
CN111826366A (en) Direct-amplification type hot-start DNA polymerase and preparation method and application thereof
CN110777138A (en) Method for removing recombinant protein endotoxin by using GEM
CN114990098B (en) Preparation method and application of lyase, encoding gene, composition and bacteriostatic agent
CN112391367A (en) Preparation method of Cas9 protein for gene editing of human primary cells
CN104761644A (en) Fusion protein MBP-MART-1 expressed by Escherichia coli, and preparation method and application thereof
CN115181736B (en) Protease PCK capable of being combined with lipopolysaccharide and preparation and application thereof
RU2795623C2 (en) Method for producing serratia marcescens recombinant endonuclease
CN117645659B (en) Mutant of mango NAC transcription factor and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210622

RJ01 Rejection of invention patent application after publication