CN114990098B

CN114990098B - Preparation method and application of lyase, encoding gene, composition and bacteriostatic agent

Info

Publication number: CN114990098B
Application number: CN202210642388.XA
Authority: CN
Inventors: 潘强; 任慧英; 于凌云; 孙虎芝; 田延军
Original assignee: Beijing Nuoan Parkway Pharmaceutical Technology Co ltd
Current assignee: Beijing Nuoan Parkway Pharmaceutical Technology Co ltd
Priority date: 2022-06-08
Filing date: 2022-06-08
Publication date: 2023-05-12
Anticipated expiration: 2042-06-08
Also published as: CN114990098A

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a preparation method and application of lyase, coding genes, compositions and bacteriostat. A staphylococcal phage lyase PB50 has an amino acid sequence shown in SEQ ID NO. 1. A gene encoding the staphylococcal lyase PB50 of claim 1 having the sequence shown in SEQ ID No. 2. The lyase provided by the application can rapidly lyse staphylococcus, and the heterologous expression of the lyase is strong in solubility and fewer in inclusion bodies.

Description

Preparation method and application of lyase, encoding gene, composition and bacteriostatic agent

Technical Field

The application belongs to the technical field of molecular biology, and particularly relates to a preparation method and application of lyase, coding genes, compositions and bacteriostat.

Background

Since fleming discovered penicillin, antibiotics have been widely and rapidly applied to medical treatment, agriculture, animal husbandry, farming and the like due to the advantages of broad spectrum and high efficiency, so that pathogenic bacteria with natural drug resistance or acquired drug resistance are propagated in large quantities, and the drug resistance of the bacteria is continuously enhanced. Resulting in bacterial resistance becoming a global problem. There are hundreds of antibiotics developed, the rate of developing new antibiotics is far from the evolution rate of drug-resistant bacteria, and bacterial infection can be treated without drugs with the enhancement of drug resistance. Antibiotics are reported to cause adverse reactions including anaphylaxis, nephrotoxicity, cardiotoxicity, hepatotoxicity, and neurotoxicity, and the like, which has prompted the need for the development of safer, more efficient alternative products for humans.

The existing application and research on more tibody products comprise plant extracts, acidulants, microecologics, phages, lyase and the like. Phage lytic enzymes are a type of cell wall hydrolase that double-stranded DNA phage express in the late stages of infection of host cells. The lyase has the following advantages in terms of "killing" the bacteria: first, the lytic enzyme has a broader lytic spectrum compared to its source phage, and can act on more pathogenic bacteria; secondly, the cleavage rate of the lyase is high, and the cleavage process can be completed in a few minutes; thirdly, the combination effect with other antibacterial agents such as antibiotics, lysozyme and the like is better, the side effect of a single drug can be reduced, and the generation of drug resistance is reduced; fourth, no drug resistance-related report was found. Under the large background of resistance reduction and resistance replacement, the lyase has a plurality of advantages, so that the lyase has higher development value in the fields of agriculture, cultivation, food safety, medical treatment and the like.

Staphylococci are a group of gram-positive cocci, can cause a lot of serious infections of human beings and animals, and have extremely high detection rate in human diseases, livestock and poultry diseases and various environmental microorganisms and food-derived microorganisms. Whereas transmission of methicillin-resistant staphylococcus aureus (MRSA) presents a significant challenge for clinical treatment. It is expected to find a lyase for coping with staphylococcal infection, and from phage genome, more novel and broad-spectrum lyase is mined, so that more possibilities are opened up for the industry of anti-substitution in the fields of agriculture, cultivation, food safety, medical treatment and the like. The high-efficiency broad-spectrum phage lyase has great industrialization value in the aspect of treatment and sterilization of staphylococcus infection. However, phage lyase generally has problems of poor solubility and a large number of inclusion bodies when expressed heterologously. It is necessary to obtain a highly efficient, broad-spectrum phage lyase.

Disclosure of Invention

In order to obtain efficient and broad-spectrum staphylococcus phage lyase, the application provides a lyase, a coding gene, a composition, a preparation method of a bacteriostatic agent and application.

In a first aspect, the present application provides a staphylococcal phage lyase PB50 having the amino acid sequence shown in SEQ ID NO. 1.

In a second aspect, the present application provides a gene encoding staphylococcal lyase PB50 according to claim 1, having the gene sequence shown in SEQ ID NO. 2.

In a third aspect, the present application provides the use of a gene encoding staphylococcal phage lyase PB50, when used in recombinant expression of the gene to produce the staphylococcal enzyme of claim 1.

In a fourth aspect, the present application provides a bacteriostatic composition comprising staphylococcal phage lyase PB50 as described above.

In a fifth aspect, the present application provides a bacteriostatic agent, the main active ingredient of which is at least one of staphylococcus phage lyase PB50, a vector containing PB50 expression element, an expression cassette containing PB50 expression element or a host cell containing PB50 expression element, the amino acid sequence of the lyase PB50 is shown as SEQ ID NO.1 or the gene sequence encoding staphylococcus lyase PB50 is shown as SEQ ID NO. 2.

Preferably, the bacteriostasis spectrum is human staphylococcus and animal staphylococcus.

In a sixth aspect, the present application provides a PCR primer set comprising a primer pair pET22b-PB50-F 'and pET22b-PB50-R', pET25b-PB50-F 'and pET25b-PB50-R', pET28a-PB50-F 'and pET28a-PB50-R' or pET32a-PB50-F 'and pET32a-PB50-R',

the nucleotide sequences of the respective primers are respectively:

pET22b-PB50-F': GGAATTCCATATGAAAACAAAAACTCAAGCTCTTGNde I cleavage site

pET22b-PB50-R’：CCGCTCGAGACTAAATGTACCCCATGCAGCAC

Xhol I cleavage site

pET25b-PB50-F': GGAATTCCATATGAAAACAAAAACTCAAGCTCTTGNde I cleavage site

pET25b-PB50-R’：CCGCTCGAGACTAAATGTACCCCATGCAGCAC

Xhol I cleavage site

pET28a-PB50-F’：CGGGATCCATGAAAACAAAAACTCAAGCTCTTG

BamH I cleavage site

pET28a-PB50-R’：CCGCTCGAGTTAACTAAATG TACCCCATGC AGCACCA

Xhol I cleavage site

pET32a-PB50-F’：CGGGATCCATGAAAACAAAAACTCAAGCTCTTG

BamH I cleavage site

pET32a-PB50-R’：CCGCTCGAGTTAACTAAATG TACCCCATGC AGCACCA

The Xhol I enzyme cutting site,

the size of the target fragment for amplification of the primer pair is 798bp.

In a seventh aspect, the present application provides a method for preparing staphylococcal phage lyase PB50 comprising the steps of:

the staphylococcus phage genome is taken as a template, a primer is added for PCR amplification, the coding gene of the staphylococcus phage lyase PB50 is recovered, the coding gene is connected with the expression vector skeleton after the same digestion, after the positive recombinant expression vector pET-PB50 is verified to transform an expression host BL21 (DE 3), the recombinant expression vector pET-PB50 is cultured by a liquid culture medium for induced expression, thalli are collected, and the staphylococcus phage lyase PB50 is extracted and purified and has an amino acid sequence shown as SEQ ID NO. 1.

Preferably, the digestion adopts Nde I/Xho I or BamH I/Xho I double digestion.

Preferably, the expression vector skeleton is pET22b, pET25b, pET28a or pET32a.

In summary, the present application has at least the following beneficial effects.

1. The lyase can rapidly lyse staphylococcus, heterologous expression of the lyase is strong in solubility, inclusion bodies are fewer, and the technical problems that the existing phage lyase is poor in solubility and more in inclusion bodies usually exist when the existing phage lyase is in heterologous expression are solved.

2. Compared with phage from which the lyase is derived, the lyase has a broader cleavage spectrum and can act on more pathogenic bacteria.

3. The cleavage rate of the lyase is fast.

4. The combination effect with other antibacterial agents such as antibiotics, lysozyme and the like is better, the side effect of a single drug can be reduced, and the generation of drug resistance is reduced.

5. Under the large background of resistance reduction and resistance replacement, the lyase has a plurality of advantages, so that the lyase has higher development value in the fields of agriculture, cultivation, food safety, medical treatment and the like.

Drawings

Fig. 1: electrophoretogram of PB50 expression in different expression strains (one).

Fig. 2: electrophoretogram of PB50 expression in different expression strains (II).

Fig. 3: and a diagram of the antibacterial effect of PB50 crude enzyme liquid.

Fig. 4: PB50 protein purification electrophoresis diagram.

Fig. 5: the cleavage effect of 100ul of enzyme solution on 5ml of bacterial solution.

In fig. 1:

M：marker。

pET22b-PB50/BL21 induced group disruption supernatant.

pET22b-PB50/BL21 induced group disruption precipitation.

The supernatant was crushed by pET22b-PB50/BL21 control.

pET25b-PB50/BL21 induced group disruption supernatant.

pET25b-PB50/BL21 induced group disruption precipitation.

In fig. 2:

M：marker。

pET25b-PB50/BL21 induced group disruption supernatant.

pET25b-PB50/BL21 induced group disruption precipitation.

pET32a-PB50/BL21 induced group disruption supernatant.

pET32a-PB50/BL21 induced group disruption precipitation.

pET28a-PB50/BL21 induced group disruption supernatant.

pET28a-PB50/BL21 induced group disruption precipitation.

pET28a-PB50/BL21 induced group disruption supernatant.

pET28a-PB50/BL21 induced group disruption precipitation.

In fig. 4:

M：Marker。

CL: crude enzyme solution;

and (3) FT: a flow-through liquid;

W1-W4: a hybrid protein wash;

E1-E7: the target protein eluent.

Detailed Description

Strains, plasmids, culture media and reagents

Large intestine competent BL21 (DE 3): purchased from beijing tiangen biochemical technology limited.

Expression vector: purchased from Novengen corporation.

NB medium: purchased from BD company. 10g of tryptone, 5g of yeast extract, 10g of sodium chloride and 1L of water are added. Solid NB medium: 15g of agar powder was added to the NB medium. Autoclaving at 121℃for 20min.

1. Isolation of phages

The staphylococcus phage was isolated from the lungs of minks in the city farms of the Weifang at 12 months 2021, the specific procedure: a biological sample (5 g) was taken and immersed in 10mL phage buffer (phage buffer) for 30min. Phage were well taken into buffer, centrifuged for 10min at 4500g, the supernatant carefully aspirated, and filter sterilized with 0.22 μm filter.

2. Whole genome sequencing

The phage was purified and subjected to whole genome sequencing. Through RAST online prediction, 297 open reading frames are obtained, and a hypothetical protein sequence is mined and named as gene PB50. The PB50 gene has the total length of 798bp and codes 265 amino acids. The protein sequence has CHAP and SH3 domains.

3. Construction of recombinant expression vectors

Four recombinant plasmids of pET22b-PB50, pET25b-PB50, pET28a-PB50 and pET32a-PB50 were constructed. It is provided with a histidine purification tag or other amino acid modification to promote expression, in this example, it is provided with a histidine purification tag. The phage genome was used as a template, and primers were designed as follows:

pET22b-PB50-F’：GGAATTCCATATGAAAACAAAAACTCAAGCTCTTG

nde I cleavage site

pET22b-PB50-R’：CCGCTCGAGACTAAATGTACCCCATGCAGCAC

Xhol I cleavage site

pET25b-PB50-F’：GGAATTCCATATGAAAACAAAAACTCAAGCTCTTG

Nde I cleavage site

pET25b-PB50-R’：CCGCTCGAGACTAAATGTACCCCATGCAGCAC

Xhol I cleavage site

pET28a-PB50-F’：CGGGATCCATGAAAACAAAAACTCAAGCTCTTG

BamH I cleavage site

pET28a-PB50-R’：CCGCTCGAGTTAACTAAATG TACCCCATGC AGCACCA

Xhol I cleavage site

pET32a-PB50-F’：CGGGATCCATGAAAACAAAAACTCAAGCTCTTG

BamH I cleavage site

pET32a-PB50-R’：CCGCTCGAGTTAACTAAATG TACCCCATGC AGCACCA

Xhol I cleavage site

2ul genome is used as a template, 1ul primer is added respectively, and Prime STAR Max is adopted to carry out PCR amplification on target genes. The PCR procedure was as follows: (1) 98 ℃ for 2min; (2) 98 ℃,10s,58 ℃,10s,72 ℃,5s,30 cycles; (3) 72℃for 10min. And (5) carrying out gel electrophoresis recovery on the PCR product, and determining that the size of the band meets the expectations. The PB50 gene was ligated into 4 plasmids using double digestion, T4 ligase overnight ligation at 16℃to construct different recombinant plasmids, and the recombinant plasmids were transformed into expression strain BL21 (DE 3) using conventional heat shock. PB50 protein expression was induced with 0.1mM IPTG, after 24h induction at 20℃the cells were washed 2 times with PBS (50 mM, pH 7.0), resuspended in 1/10 of the volume of PBS, and the intracellular proteins were released by sonication at 200W for 3s with 5s intermittent and 70 cycles. The supernatant from the disruption was collected by centrifugation and the precipitate was analyzed for protein solubility by SDS-PAGE.

Referring to FIG. 1, PB50 can be expressed in soluble form in pET22b-SA210/BL21 and pET25b-SA210/BL21 strains, and referring to FIG. 2, PB50 can be expressed in soluble form in pET25b-SA210/BL21, pET28a-SA210/BL21 and pET32a-SA210/BL21 strains. When expressed in the pET28a-SA210/BL21 strain, the inclusion bodies are more and are about 2 times of soluble proteins; almost all are soluble when expressed in pET32a-SA210/BL21 strain; when expressed in pET22b-SA210/BL21 and pET25b-SA210/BL21 strains, the soluble protein is 2-3 times that of inclusion body. Taken together, PB50 is capable of soluble expression in different expression strains, and selection of plasmids and cleavage sites affects the relative specific gravity of soluble proteins and inclusion bodies. Phage lyase generally has poor solubility and more inclusion bodies when expressed in a heterologous manner, but the present application uses plasmids and cleavage sites of the present application, which have strong solubility and fewer inclusion bodies when expressed in a heterologous manner.

The pET22b-PB50/BL21 (DE 3) strain was selected for the following steps:

referring to FIG. 3, the disrupted supernatant was spotted on a solid plate of a human staphylococcus strain, and obvious plaques were observed, confirming that the PB50 crude enzyme solution had cleavage activity.

4. Purification of phage lytic enzymes

The constructed expression strain was induced at low temperature for 24 hours with 0.1mM IPTG, and the supernatant of the disruption solution was collected. The purification was performed using the Biyun protein purification kit (purchased from Biyun, product number P2226). Taking 1ml of 50% Beyogold His-tag Purification Resin which are uniformly mixed, centrifuging at 4 ℃ to remove liquid; adding non-denatured lysate to the centrifuge tube to equilibrate the gel twice; 4ml of the crushed supernatant was added thereto and slowly shaken overnight at 4 ℃. Transferring the crushed liquid and the mixture into an affinity chromatography column tube, and collecting the flowing liquid. The column was washed 6 times with 0.5ml of non-denaturing washing solution each to remove the contaminating proteins. Eluting target protein 10 times, and adding 0.5ml non-denaturing eluent each time until no protein is in the penetrating fluid. All the permeate was collected and analyzed by SDS-PAGE to determine the purification conditions.

Referring to FIG. 4, the crude enzyme solution was allowed to bind completely to the gel after shaking overnight at 4℃and the flow-through solution was free of the target protein. The chromatographic column is washed four times, namely W1-W4 in figure 4, so that the impurity protein can be completely removed, and the influence of the impurity protein is avoided. The purified target protein was eluted completely by 7-10 times of elution (E1-E7 in FIG. 4), and the active permeate was dialyzed overnight against PBS buffer (50 mM, pH 7.0) at 4℃to obtain a purified enzyme solution. And the purity of the protein obtained by analysis can reach more than 90% by using Biovision software and matching with a Quantum CX5 Edge 18.02a imaging system.

5. PB50 protein antibacterial active agent antibacterial rate and antibacterial spectrum detection

(1) 100ul of pure enzyme solution is added into 5ml of bacterial solution and mixed uniformly, and bacterial solution can be changed from turbidity to obvious clarification after about 10min. Referring to FIG. 5, the left tube in FIG. 5 is a control of 5ml of bacterial liquid; the right test tube is 5ml bacterial liquid, 100ul pure enzyme liquid is added for uniform mixing, and the state diagram after 10min can be seen, so that the clear test tube shows that the cleavage rate of the lyase is high.

(2) 200 μl of the test staphylococcal proliferation solution was mixed with solid NB medium thawed to about 60deg.C, and the plates were quickly poured. After solidification, a puncher with the diameter of 6mm is used for punching on a culture medium, 50 μl of purified PB50 enzyme solution is sucked into spot sample holes, the mixture is kept stand at 4 ℃ for about 2 hours, after the enzyme solution is completely absorbed, the mixture is kept stand at 37 ℃ for culture overnight, and the diameter of a bacteriostasis zone is measured. The specific cleavage spectrum results are shown in Table 1.

TABLE 1 cleavage Profile of PB50 lyase

/>

/>

/>

All tested strains were from this unit, with standard strains being given by the Qingdao university of agriculture.

As shown in Table 1, the lyase PB50 has good cracking effect on staphylococci from different sources such as human sources, pet sources, pig sources, cattle sources and the like, the total cracking rate reaches 89%, and the cracking activity is high.

Based on phage genome analysis, we obtained a protein with high cleavage activity against staphylococci. The broad-spectrum efficient bactericidal activity of the lyase PB50 in various infections caused by staphylococci in the fields of human medicine, pet diseases and livestock breeding is of great significance in developing novel anti-staphylococcal drugs and controlling staphylococcal infections in vitro.

6. Staphylococcus phage antimicrobial profile detection

200. Mu.l of the test staphylococcal proliferation solution was mixed with NB medium which had been thawed to about 60℃and rapidly poured into a plate. After clotting, the cells were proliferated with fresh staphylococcal phage (titer 10 ⁸ PFU/ml), blotted 5ul spot onto a plate, allowed to stand at 4℃for about 0.5 hour, allowed to stand at 37℃overnight after complete absorption, and recorded with no plaque formation. The specific cleavage spectrum results are shown in Table 2.

TABLE 2 lytic spectra of staphylococcal phages

/>

/>

/>

All tested strains were from this unit, with standard strains being given by the Qingdao university of agriculture. "+"

Indicating plaque presence, "-" indicates plaque absence.

As shown in Table 1, the lyase PB50 has good cracking effect on staphylococci from different sources such as human sources, pet sources, pig sources, cattle sources and the like, the total cracking rate reaches 89%, and the cracking activity is high. Under the same conditions, as shown in Table 2, the lysis rate of the staphylococcus phage from which it was derived was only 39% for 92 test strains.

6. Antibacterial composition of staphylococcus phage lyase PB50

PB50 has a good cracking effect on tested human staphylococci, and the cracking rate reaches 91.3%, so that the composition can be used for various infections of facial skin caused by staphylococci. To a skin cream mixture containing 0.5% of PEG-20 methyl glucose sesquistearate, 0.5% of glycerol stearate, 0.5% of hydrogenated lecithin, 0.8% of cetostearyl alcohol, 2.0% of polydimethylsiloxane, 2% of hydrogenated rice bran oil, 5% of caprylic triglyceride, 4% of propylene glycol, 5% of glycerol, 0.05% of sodium hyaluronate, 0.2% of hydroxyethyl acrylate/sodium acryloyldimethyl taurate copolymer and 54% of deionized water, 1% of PB50 pure enzyme solution is added, and after uniform mixing, the antibacterial effect is measured by adopting a flat plate coating method, and the emulsion mixture added with PB50 has cleavage activity and can form cleavage spots on bacterial membranes.

The foregoing are all preferred embodiments of the present application, and are not intended to limit the scope of the present application in any way, therefore: all equivalent changes in structure, construction and principle of the present application should be covered by the protection scope of the present application.

Sequence listing

<110> Beijing Noan Baihui pharmaceutical technology Co., ltd

<120> preparation method and application of lyase, coding gene, composition and bacteriostat

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 265

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Lys Thr Lys Thr Gln Ala Leu Asp Trp Val Asn Ser Arg Ile Gly

1 5 10 15

Arg Arg Leu Asp Phe Asp Gly Trp Tyr Gly Ala Gln Cys Met Asp Leu

20 25 30

Thr Ile Gly Tyr Cys Asn Tyr Ile Ser Gly Gly Ser Phe Arg Pro Trp

35 40 45

Gly Asn Ala Ile Asn Leu Lys Asp Asn Thr Met Pro Ala Gly Trp Lys

50 55 60

Leu Ile Lys Asn Thr Pro Ser Phe Leu Pro Gln Pro Gly Asp Ile Ala

65 70 75 80

Ile Trp Ala Tyr Ala Pro Tyr Asp Val Tyr Gly His Thr Gly Ile Ile

85 90 95

Thr Ser Ala Asn Leu Asn Asn Phe Tyr Ser Val Asp Gln Asn Trp Phe

100 105 110

Asn Ala Gly Ser Asn Gly Ser Pro Ala Ala Lys Val Phe His Asp Tyr

115 120 125

Thr Gly Phe Trp Gly Val Ile Arg Pro Ala Phe Gly Ser Thr Ser Thr

130 135 140

Lys Lys Ala Thr Pro Lys Lys Ala Ala Pro Lys Lys Lys Val Val Lys

145 150 155 160

Lys Ala Ala Thr Lys Lys Ala Ala Thr Thr Ala Thr Trp Lys Arg Asn

165 170 175

Ser Ala Gly Ile Leu Trp Lys Thr Glu Lys Ala Lys Phe Thr Cys Asn

180 185 190

Val Ser Ser Gly Ile Ile Thr Arg Lys Asn Gly Pro Trp Thr Gly Trp

195 200 205

Ala Gln Gly Pro Phe Met Lys Lys Gly Asp Thr Ile Lys Tyr Asp Glu

210 215 220

Ile Gln Asp Phe Asp Gly His Ile Trp Val Ser Gly Asn Phe Lys Gly

225 230 235 240

Gln Tyr Val Tyr Val Pro Ile Gly Lys Ser Asn Gly Lys Gly Gln Arg

245 250 255

Ile Gly Ala Ala Trp Gly Thr Phe Ser

260 265

<210> 2

<211> 798

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgaaaacaa aaactcaagc tcttgattgg gttaatagtc gtattggtcg tagactagat 60

tttgatggtt ggtatggagc tcagtgtatg gatttaacta taggttactg taattatatc 120

tcaggtggtt ctttccgtcc ttggggtaat gcaattaatc ttaaagacaa cacaatgcca 180

gctggatgga aattaattaa aaatactcca tcattcttac ctcaacctgg tgatattgct 240

atttgggctt atgcacctta tgatgtttat ggtcatacag gtattattac ttcagctaac 300

ttaaataact tctattcagt tgaccaaaac tggtttaatg caggaagtaa cggttcaccg 360

gcagctaaag tatttcatga ttatacaggt ttctggggag taattcgtcc agcttttggt 420

agtacatcta ctaagaaagc aactcctaag aaagcggctc ctaagaaaaa agtagttaaa 480

aaagcagcta ctaagaaagc agctacaact gctacttgga aacgtaattc tgcaggaatt 540

ctatggaaaa ctgaaaaagc taaattcaca tgtaatgttt cttcaggaat tattactcgt 600

aaaaatggtc catggactgg atgggctcaa ggtccattta tgaagaaagg tgatactatt 660

aaatatgatg aaattcaaga tttcgatgga catatttggg tatcaggtaa ctttaaaggt 720

caatatgttt atgtaccaat tggtaaatca aatggtaaag gacaacgtat tggtgctgca 780

tggggtacat ttagttaa 798

Claims

1. A staphylococcal phage lyase PB50, characterized by: the amino acid sequence is shown as SEQ ID NO. 1.

2. A gene encoding the staphylococcal lyase PB50 of claim 1, characterized by: the gene sequence is shown as SEQ ID NO. 2.

3. Use of the gene encoding staphylococcal phage lyase PB50 according to claim 2, characterized by: the recombinant expression of the gene is used for producing the staphylococcus phage lyase PB50 of claim 1.

4. A bacteriostatic composition characterized by: comprising a staphylococcal phage lyase PB50 according to claim 1.

5. A bacteriostatic agent, characterized in that: the main active components of the recombinant staphylococcus phage lyase are at least one of staphylococcus phage lyase PB50, a vector containing a PB50 expression element, an expression cassette containing the PB50 expression element or a host cell containing the PB50 expression element, wherein the amino acid sequence of the lyase PB50 is shown as SEQ ID NO.1 or the gene sequence of the encoding staphylococcus phage lyase PB50 is shown as SEQ ID NO. 2.

6. A bacteriostatic agent according to claim 5, characterized in that: the antibacterial spectrum is human staphylococcus and animal staphylococcus.

7. The preparation method of the staphylococcus phage lyase PB50 is characterized by comprising the following steps of:

taking a staphylococcus phage genome as a template, adding a primer, carrying out PCR amplification, recovering a coding gene of staphylococcus phage lyase PB50, connecting with an expression vector skeleton after the same digestion, culturing a recombinant expression vector pET-PB50 with positive verification after converting an expression host BL21 by a liquid culture medium, carrying out induced expression, collecting thalli, extracting and purifying, wherein the staphylococcus phage lyase PB50 has an amino acid sequence shown as SEQ ID NO. 1;

the primer pair for specifically amplifying the staphylococcus phage PB50 gene is one of the following four primer pairs:

(1) pET22b-PB50-F 'and pET22b-PB50-R'

The nucleotide sequence is:

pET22b-PB50-F’：GGAATTCCATATGAAAACAAAAACTCAAGCTCTTG

nde I cleavage site

pET22b-PB50-R’：CCGCTCGAGACTAAATGTACCCCATGCAGCAC

Xhol I cleavage site;

(2) pET25b-PB50-F 'and pET25b-PB50-R'

The nucleotide sequence is:

pET25b-PB50-F’：GGAATTCCATATGAAAACAAAAACTCAAGCTCTTG

nde I cleavage site

pET25b-PB50-R’：CCGCTCGAGACTAAATGTACCCCATGCAGCAC

Xhol I cleavage site;

(3) pET28a-PB50-F 'and pET28a-PB50-R'

The nucleotide sequence is:

pET28a-PB50-F’：CGGGATCCATGAAAACAAAAACTCAAGCTCTTG

BamH I cleavage site

pET28a-PB50-R’：CCGCTCGAGTTAACTAAATG TACCCCATGC AGCACCA

Xhol I cleavage site;

(4) pET32a-PB50-F 'and pET32a-PB50-R'

The nucleotide sequence is:

pET32a-PB50-F’：CGGGATCCATGAAAACAAAAACTCAAGCTCTTG

BamH I cleavage site

pET32a-PB50-R’：CCGCTCGAGTTAACTAAATG TACCCCATGC AGCACCA

Xhol I cleavage site.

8. The method for preparing staphylococcal phage lyase PB50 as claimed in claim 7, wherein: the digestion adopts Nde I/Xho I or BamH I/Xho I double digestion.

9. The method of preparing staphylococcal phage lyase PB50 according to claim 7 or 8, wherein the expression vector backbone is pET22b, pET25b, pET28a or pET32a.