CN112998008A - Dental pulp stem cell cryopreservation protective solution and dental pulp stem cell cryopreservation method - Google Patents
Dental pulp stem cell cryopreservation protective solution and dental pulp stem cell cryopreservation method Download PDFInfo
- Publication number
- CN112998008A CN112998008A CN202110241198.2A CN202110241198A CN112998008A CN 112998008 A CN112998008 A CN 112998008A CN 202110241198 A CN202110241198 A CN 202110241198A CN 112998008 A CN112998008 A CN 112998008A
- Authority
- CN
- China
- Prior art keywords
- polysaccharide
- dental pulp
- hailsbergii
- pulp stem
- hailsbergia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N1/00—Preservation of bodies of humans or animals, or parts thereof
- A01N1/02—Preservation of living parts
- A01N1/0205—Chemical aspects
- A01N1/021—Preservation or perfusion media, liquids, solids or gases used in the preservation of cells, tissue, organs or bodily fluids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N1/00—Preservation of bodies of humans or animals, or parts thereof
- A01N1/02—Preservation of living parts
- A01N1/0205—Chemical aspects
- A01N1/021—Preservation or perfusion media, liquids, solids or gases used in the preservation of cells, tissue, organs or bodily fluids
- A01N1/0226—Physiologically active agents, i.e. substances affecting physiological processes of cells and tissue to be preserved, e.g. anti-oxidants or nutrients
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/0003—General processes for their isolation or fractionation, e.g. purification or extraction from biomass
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Polymers & Plastics (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Materials Engineering (AREA)
- Sustainable Development (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physiology (AREA)
- Dental Preparations (AREA)
- Medicinal Preparation (AREA)
Abstract
The invention aims to provide a dental pulp stem cell cryopreservation protection liquid and a dental pulp stem cell cryopreservation method, and belongs to the technical field of stem cell cryopreservation. The protective solution provided by the invention comprises the following components: 40% DMEM/F12, 50% FBS, 10% DMSO, 2.5mg/ml-10mg/ml hailsberg polysaccharide. The invention has the advantages that when the cryopreservation protection liquid is used for cryopreservation of dental pulp stem cells, the activity of the dental pulp stem cells can be effectively maintained, and the dental pulp stem cells can have better drying and osteogenesis capabilities.
Description
Technical Field
The invention belongs to the technical field of stem cell cryopreservation, and particularly relates to dental pulp stem cell cryopreservation protective liquid and a dental pulp stem cell cryopreservation method.
Background
Stem cells are a class of cells that have the potential for self-renewal and multipotentiality. The dental pulp stem cells are stem cells derived from soft tissues in the dental pulp cavity, and have good proliferation and differentiation capacities. Because the dental pulp stem cells have the advantages of convenient collection, rich sources, multidirectional differentiation potential, low immunogenicity and the like, the dental pulp stem cells are widely applied to regenerative medicine and tissue engineering repair.
With the widespread use of stem cells, the problem of cryopreservation of stem cells is also becoming a focus of research. At present, dental pulp stem cells are mainly used for repairing teeth through osteogenic differentiation, but at present, no stem cell cryopreservation liquid is specially used for preserving dental pulp stem cells to keep the activity of the dental pulp stem cells and simultaneously keep the dryness and osteogenic capacity of the dental pulp stem cells better.
Hailsbergia hailsbergii is an alga of the hailsbergia genus of the phylum cyanophyta, class of the phycozobium, order of nostalgiales, family of the dinoflagellaceae, and is currently commonly used for eating or treating edema. Currently, there is no relevant content about the application of hailsberg polysaccharide to the dental pulp stem cell cryopreservation liquid.
Disclosure of Invention
The invention aims to provide a dental pulp stem cell cryopreservation protective solution and a dental pulp stem cell cryopreservation method which are specially used for dental pulp stem cells.
In order to achieve the above object, the present invention provides a protective solution for cryopreservation of dental pulp stem cells, comprising the following components: 40% DMEM/F12, 50% FBS, 10% DMSO, 2.5mg/ml-10mg/ml hailsberg polysaccharide.
Preferably, the protective solution comprises the following components: 40% DMEM/F12, 50% FBS, 10% DMSO, 5mg/ml haihailsberg polysaccharide.
Preferably, the preparation method of haihailsbergia hailsbergii polysaccharide comprises the following steps:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
In addition, the invention provides hailsberg polysaccharide for a dental pulp stem cell cryopreservation protection solution, and the preparation method of the hailsberg polysaccharide comprises the following steps:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze-drying to obtain hailsbergia hailsbergii polysaccharide;
the hailsbergia hailsbergii polysaccharide is used for maintaining the activity of dental pulp stem cells in the dental pulp stem cell cryopreservation protective solution;
the hailsbergia hailsbergii polysaccharide is used for maintaining the osteogenesis transformation capability of dental pulp stem cells in the dental pulp stem cell cryopreservation liquid.
In addition, the invention provides a preparation method of hailsberg polysaccharide for the dental pulp stem cell cryopreservation protection solution, which comprises the following steps:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
In addition, the invention provides application of hailsbergia hailsbergii polysaccharide in preparation of a pulp stem cell activity maintaining agent.
In addition, the invention provides application of hailsbergia hailsbergii polysaccharide in preparation of a maintenance agent for expressing the Oct4 and Sox2 genes of dental pulp stem cells.
In addition, the invention provides application of hailsbergia hailsbergii polysaccharide in preparation of a dental pulp stem cell osteogenesis transformation maintenance agent.
Preferably, the hailsbergia hailsbergii polysaccharide is prepared by the following preparation method:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
In addition, the invention provides a method for cryopreserving dental pulp stem cells, which comprises the following steps:
(1) preparing a freezing protection solution according to the percentage of 40% DMEM/F12, 50% FBS, 10% DMSO and 2.5-10 mg/ml hailsberg polysaccharide, and filtering and sterilizing to obtain the dental pulp stem cell freezing protection solution;
(2) mixing the dental pulp stem cells and the dental pulp stem cell cryopreservation protection solution in a cryopreservation tube, placing the mixture in a cryopreservation box, placing the box in a refrigerator at minus 80 ℃ for overnight, and then transferring the box to liquid nitrogen for preservation.
The invention has the beneficial effects that:
the invention provides a cell cryopreservation liquid for cryopreservation of dental pulp stem cells, which can effectively maintain the activity of the dental pulp stem cells and enable the dental pulp stem cells to have better drying and osteogenesis capabilities when the cryopreservation liquid is used for cryopreservation of the dental pulp stem cells.
Drawings
Figure 1 expression levels of Sox2 and Oct4 genes in cryopreserved cells of example 2 and example 4;
FIG. 2 ALP enzyme staining results and quantification results of cryopreserved cells of example 2 and example 4.
Detailed Description
In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.
Example 1
(1) Cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing 100g haihaihai hai vegetable powder, adding 2000ml of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 200ml by using a rotary evaporator under pressure, adding 600ml of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
Example 2
(1) The frozen protective solution is prepared according to the following formula, 400ul DMEM/F12,500ul FBS and 100ul DMSO are filtered and sterilized;
(2) will be 1 × 106The individual dental pulp stem cells were mixed with 1ml of the cryopreservation protection solution, placed in a cryopreservation box, placed in a refrigerator at-80 ℃ overnight, and then transferred to liquid nitrogen for storage.
Example 3
(1) The frozen protective solution is prepared according to the following formula, 400ul DMEM/F12,500ul FBS and 100ul DMSO are added with 2.5mg hailsberg polysaccharide, and filtered for sterilization;
(2) will be 1 × 106The individual dental pulp stem cells were mixed with 1ml of the cryopreservation protection solution, placed in a cryopreservation box, placed in a refrigerator at-80 ℃ overnight, and then transferred to liquid nitrogen for storage.
Example 4
(1) The frozen protective solution is prepared according to the following formula, 400ul DMEM/F12,500ul FBS and 100ul DMSO are added with 5mg hailsberg polysaccharide, and filtered for sterilization;
(2) will be 1 × 106The individual dental pulp stem cells were mixed with 1ml of the cryopreservation protection solution, placed in a cryopreservation box, placed in a refrigerator at-80 ℃ overnight, and then transferred to liquid nitrogen for storage.
Example 5
(1) The frozen protective solution is prepared according to the following formula, 400ul DMEM/F12,500ul FBS and 100ul DMSO, 7.5mg hailsberg polysaccharide is added, and filtration sterilization is carried out;
(2) will be 1 × 106The individual dental pulp stem cells were mixed with 1ml of the cryopreservation protection solution, placed in a cryopreservation box, placed in a refrigerator at-80 ℃ overnight, and then transferred to liquid nitrogen for storage.
Example 6
(1) The frozen protective solution is prepared according to the following formula, 400ul DMEM/F12,500ul FBS and 100ul DMSO are added with 10mg hailsberg polysaccharide, and filtered for sterilization;
(2) will be 1 × 106The individual dental pulp stem cells were mixed with 1ml of the cryopreservation protection solution, placed in a cryopreservation box, placed in a refrigerator at-80 ℃ overnight, and then transferred to liquid nitrogen for storage.
Experimental example 1
Survival detection
(1) Example 2-6 after 12 months of cryopreservation, cells were thawed in a 37 ℃ water bath;
(2) the cell viability was calculated using talofen blue staining, which was repeated 3 times for each example, and the results obtained are given in the following table:
| group of | Survival rate after resuscitation | P value |
| Example 2 | 79.82±2.76 | |
| Example 3 | 87.10±3.14 | 0.0399 |
| Example 4 | 93.50±3.29 | 0.0054 |
| Example 5 | 94.62±2.53 | 0.0024 |
| Example 6 | 94.47±2.56 | 0.0026 |
As can be seen from the above table, the survival rate of the cells of examples 3-6 is significantly increased compared to example 2, and the differences are statistically significant, which indicates that the hailsberg polysaccharide added in the present invention can effectively maintain the activity of the human dental pulp stem cells. In the method, the survival rate differences of the examples 3,4 and 5 have no statistical significance, so that the hailsbergia hailsbergii polysaccharide with the concentration of 5mg/ml is obtained as the optimal concentration.
Experimental example 2
Oct4 and Sox2 gene expression level detection
(1) The cells frozen for 12 months according to the method of the embodiment 2 and the embodiment 4 are placed in a water bath kettle at 37 ℃ for cell recovery;
(2) inoculating the P6 generation human dental pulp stem cells into a 6-hole cell culture plate after recovery, extracting RNA according to Trizol instructions, and detecting the quality and concentration of the RNA for subsequent experiments;
(2) preparing cDNA according to the instruction of TaKaRa reverse transcription kit;
(3) reaction reagents are prepared according to a TAKARA fluorescent quantitative PCR kit:
SYBR Green Premix Ex Taq（2×） 10μl，
the forward primer was added in an amount of 0.4. mu.l,
the reverse primer was added in an amount of 0.4. mu.l,
mu.l of the cDNA template was added,
ddH2O 7.2μl。
the parameters of the fluorescent quantitative PCR instrument are set as follows: 5min at 95 ℃; at 95 ℃ for 15s and at 60 ℃ for 30s for 40 cycles, the primer sequences are as follows:
| name of Gene | Primer sequences | Size of product |
| Sox2 | AGATGCACAACTCGGAGATCAG，SEQ ID NO.1 | 131 |
| ATAATCCGGGTGCTCCTTCATG,SEQ ID NO.2 | ||
| Oct4 | TGGAGGAAGCTGACAACAATGA,SEQ ID NO.3 | 126 |
| GGAACAAATTCTCCAGGTTGCC,SEQ ID NO.4 | ||
| β-actin | GGTCATCACCATTGGCAATGAG,SEQ ID NO.5 | 128 |
| TGTCCACGTCACACTTCATGAT,SEQ ID NO.6 |
(4) Beta-actin as a reference Gene, 2-△△CtThe method calculates the relative expression of the genes Sox2 and Oct 4.
The experimental result is shown in fig. 1, wherein the relative expression of Sox2 gene is 1.448 ± 0.138, and the relative expression of Oct4 is 1.540 ± 0.199, and it can be seen from the above results that the addition of hailsberg polysaccharide is more helpful for the expression of Sox2 gene and Oct4 gene of human dental pulp stem cells.
Example 3
Osteogenic capacity testing
(1) The cells frozen for 12 months according to the method of the embodiment 2 and the embodiment 4 are placed in a water bath kettle at 37 ℃ for cell recovery;
(2) after recovery, inoculating the P6 generation human dental pulp stem cells into a 6-hole cell culture plate, adding an osteogenic transformation culture medium, and performing osteogenic induction;
(3) culturing for 7 days, adding 4% paraformaldehyde into a part of cells, fixing for 30min, washing with PBS, adding ALP enzyme staining solution for staining, washing cells after 30min, and taking pictures;
(4) adding 200ul TritonX-100 into a part of cells to lyse the cells, collecting the cells after 30 minutes, placing the cells in a centrifuge, centrifuging at 12000r/min to collect supernatant, taking 10ul supernatant into a 96-well plate, adding 40ul ALP enzyme detection buffer solution and 50ul chromogenic substrate, uniformly mixing, detecting OD value at 405nm, and setting for 3 times;
the experimental results are shown in fig. 2, wherein the relative activity of ALP enzyme is 1.387 ± 0.076, and it can be seen that the addition of hailsberg polysaccharide can better maintain the osteogenic ability of human dental pulp stem cells.
In summary, when the cryopreservation protection solution of the present invention is used for cryopreservation of human dental pulp stem cells, the activity of the human dental pulp stem cells can be effectively maintained, and the human dental pulp stem cells have better drying and osteogenesis capabilities.
Claims (10)
1. The protective solution for freezing and storing the dental pulp stem cells is characterized by comprising the following components: 40% DMEM/F12, 50% FBS, 10% DMSO, 2.5mg/ml-10mg/ml hailsberg polysaccharide.
2. The protective solution according to claim 1, characterized in that it comprises the following components: 40% DMEM/F12, 50% FBS, 10% DMSO, 5mg/ml haihailsberg polysaccharide.
3. The protective solution according to claim 1 or 2, wherein the hailsberg polysaccharide is prepared by a method comprising the following steps:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
4. The hailsbergia hailsbergii polysaccharide used for the dental pulp stem cell cryopreservation protection solution is characterized in that the preparation method of the hailsbergia hailsbergii polysaccharide comprises the following steps:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze-drying to obtain hailsbergia hailsbergii polysaccharide;
the hailsbergia hailsbergii polysaccharide is used for maintaining the activity of dental pulp stem cells in the dental pulp stem cell cryopreservation protective solution;
the hailsbergia hailsbergii polysaccharide is used for maintaining Oct4 and Sox2 gene expression in a dental pulp stem cell cryopreservation protective solution;
the hailsbergia hailsbergii polysaccharide is used for maintaining the osteogenesis capacity of dental pulp stem cells in the dental pulp stem cell cryopreservation liquid.
5. A preparation method of hailsberg polysaccharide for protecting the freezing storage of dental pulp stem cells is characterized by comprising the following steps:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
6. Application of hailsbergia hailsbergii polysaccharide in preparation of dental pulp stem cell activity maintaining agent.
7. Application of hailsbergia hailsbergii polysaccharide in preparation of dental pulp stem cell Oct4 and Sox2 gene expression maintenance agent.
8. Application of hailsbergia hailsbergii polysaccharide in preparation of dental pulp stem cell osteogenesis transformation maintenance agent.
9. Use according to any one of claims 6 to 8, wherein hailsberg polysaccharide is prepared by the following preparation method:
(1) cleaning and drying hailstone vegetables, and crushing by using a crusher to obtain hailstone vegetable powder;
(2) weighing a certain amount of haihailstone powder, adding 20 times of water, and soaking for 24 h;
(3) filtering to remove residue, placing the supernatant in a centrifuge, centrifuging at 4000r/min for 20min, and collecting the supernatant;
(4) concentrating the supernatant to 10% of the original volume by using a rotary evaporator, adding 3 times of 95% ethanol, and precipitating with ethanol for 12 h;
(5) placing in a centrifuge, centrifuging at 4000r/min for 20min, and removing supernatant to obtain crude polysaccharide of haihailsbergia hailsbergii;
(6) dissolving crude hailsbergia hailsbergii polysaccharide in water, adding Sevage reagent for deproteinization, centrifuging at 4000r/min for 20min, repeating for 3 times, concentrating under reduced pressure, and freeze drying to obtain hailsbergia hailsbergii polysaccharide.
10. A method for cryopreserving dental pulp stem cells, which is characterized by comprising the following steps:
(1) preparing a freezing protection solution according to the percentage of 40% DMEM/F12, 50% FBS, 10% DMSO and 2.5-10 mg/ml hailsberg polysaccharide, and filtering and sterilizing to obtain the dental pulp stem cell freezing protection solution;
(2) mixing the dental pulp stem cells and the dental pulp stem cell cryopreservation protection solution in a cryopreservation tube, placing the mixture in a cryopreservation box, placing the box in a refrigerator at minus 80 ℃ for overnight, and then transferring the box to liquid nitrogen for preservation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110241198.2A CN112998008B (en) | 2021-03-04 | 2021-03-04 | Dental pulp stem cell cryopreservation protective solution and dental pulp stem cell cryopreservation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110241198.2A CN112998008B (en) | 2021-03-04 | 2021-03-04 | Dental pulp stem cell cryopreservation protective solution and dental pulp stem cell cryopreservation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112998008A true CN112998008A (en) | 2021-06-22 |
| CN112998008B CN112998008B (en) | 2021-12-21 |
Family
ID=76405557
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110241198.2A Active CN112998008B (en) | 2021-03-04 | 2021-03-04 | Dental pulp stem cell cryopreservation protective solution and dental pulp stem cell cryopreservation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112998008B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113754790A (en) * | 2021-10-15 | 2021-12-07 | 山东元裕生物科技有限公司 | Biological agent for promoting cell growth |
| CN114032209A (en) * | 2021-11-23 | 2022-02-11 | 广东普罗凯融生物医药科技有限公司 | Kit for separating dental pulp stem cells and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002215131A1 (en) * | 2000-11-22 | 2002-08-08 | The Leeds Teaching Hospitals Nhs Trust | Flush preservation solution |
| CN103275234A (en) * | 2013-04-27 | 2013-09-04 | 上海市农业科学院 | Rhodiola polysaccharide and preparation method thereof |
| CN106417250A (en) * | 2016-07-28 | 2017-02-22 | 广州赛莱拉干细胞科技股份有限公司 | Dental pulp mesenchymal stem cell cryopreservation solution and cryopreservation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0028414D0 (en) * | 2000-11-22 | 2001-01-03 | Univ Leeds | Flush preservation solution |
-
2021
- 2021-03-04 CN CN202110241198.2A patent/CN112998008B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002215131A1 (en) * | 2000-11-22 | 2002-08-08 | The Leeds Teaching Hospitals Nhs Trust | Flush preservation solution |
| CN103275234A (en) * | 2013-04-27 | 2013-09-04 | 上海市农业科学院 | Rhodiola polysaccharide and preparation method thereof |
| CN106417250A (en) * | 2016-07-28 | 2017-02-22 | 广州赛莱拉干细胞科技股份有限公司 | Dental pulp mesenchymal stem cell cryopreservation solution and cryopreservation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 杨俊杰 等: "《中药化学实用技术》", 31 January 2016, 重庆大学出版社 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113754790A (en) * | 2021-10-15 | 2021-12-07 | 山东元裕生物科技有限公司 | Biological agent for promoting cell growth |
| CN113754790B (en) * | 2021-10-15 | 2022-03-18 | 山东元裕生物科技有限公司 | Biological agent for promoting cell growth |
| CN115010821A (en) * | 2021-10-15 | 2022-09-06 | 山东元裕生物科技有限公司 | Application of polysaccharide in promoting growth of umbilical cord mesenchymal stem cells |
| CN115010821B (en) * | 2021-10-15 | 2023-10-20 | 北京恒生佳合细胞科技有限公司 | Application of polysaccharide in promoting growth of umbilical cord mesenchymal stem cells |
| CN114032209A (en) * | 2021-11-23 | 2022-02-11 | 广东普罗凯融生物医药科技有限公司 | Kit for separating dental pulp stem cells and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112998008B (en) | 2021-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112998008B (en) | Dental pulp stem cell cryopreservation protective solution and dental pulp stem cell cryopreservation method | |
| AU2002326901B2 (en) | Preservation of non embryonic cells from non hematopoietic tissues | |
| AU2002326901A1 (en) | Preservation of non embryonic cells from non hematopoietic tissues | |
| CN106982821A (en) | Umbilical cord mesenchymal stem cells clinic freezes protection liquid composition and application thereof | |
| CN104770363A (en) | Cryopreservation solution and cryopreservation method for mesenchymal stem cells | |
| CN110684722A (en) | Preparation method of mesenchymal stem cells derived from placenta chorion plate tissue | |
| CN113287524B (en) | Method for detoxifying radix tetrastigme by virtue of vitrification ultra-low temperature therapy | |
| WO2020151097A1 (en) | Method for separating and culturing ginseng cambium stem cells | |
| CN111973547A (en) | Stem cell active factor and its freeze-dried powder | |
| CN112646775A (en) | Isolated culture method of human umbilical cord mesenchymal stem cells | |
| CN111248193A (en) | Human amniotic mesenchymal stem cell cryopreservation solution and cryopreservation method thereof | |
| CN110643572A (en) | Separation and purification method of umbilical cord mesenchymal stem cells | |
| CN108753712B (en) | Method for extracting adipose-derived stem cells | |
| CN108753876B (en) | Method for enhancing expression of stem cell surface receptor CXCR4 by using sheep placenta extract | |
| CN115305232B (en) | Adipose-derived mesenchymal stem cell resuscitating culture solution and resuscitating method | |
| CN114736856A (en) | Preparation method and application of canine placenta mesenchymal stem cells | |
| CN112831463B (en) | Culture medium for efficiently inducing adipose-derived stem cell bone differentiation, preparation method, induced differentiation method and application | |
| CN115044544A (en) | Recovery method of dental pulp mesenchymal stem cells | |
| CN115068593A (en) | Long-shelf-life high-activity mesenchymal stem cell extracting solution and preparation method thereof | |
| WO2022056991A1 (en) | Mesenchymal stem cells derived from umbilical cord, and preparation method therefor and use thereof | |
| CN110564678B (en) | Method for osteogenic directional differentiation of umbilical cord Wharton's jelly mesenchymal stem cells | |
| CN106190837B (en) | A kind of kit and cultural method for cultivating mescenchymal stem cell | |
| CN109845644B (en) | Method for removing pseudostellaria heterophylla fava bean wilting virus by using micro-stem tip and ultralow temperature | |
| CN107079677A (en) | A kind of method of promotion Snakegourd Fruit root division | |
| CN113150996A (en) | Lactic acid bacteria composite freeze-drying protective agent and application method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20211027 Address after: 251100 101, first floor, building 2, accelerator, Qihe science and Technology City, Zhongguancun, Qilu high tech Development Zone, Qihe County, De Zhou City, Shandong Province Applicant after: Shandong Carson cell therapy Engineering Technology Co.,Ltd. Address before: 251100, two floor, B block, Qilu science and technology incubator, Qilu hi tech Development Zone, Qihe, Dezhou, Shandong Applicant before: SHANDONG BOSEN MEDICAL ENGINEERING TECHNOLOGY Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |