CN112982012B - Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment - Google Patents
Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment Download PDFInfo
- Publication number
- CN112982012B CN112982012B CN202110187013.4A CN202110187013A CN112982012B CN 112982012 B CN112982012 B CN 112982012B CN 202110187013 A CN202110187013 A CN 202110187013A CN 112982012 B CN112982012 B CN 112982012B
- Authority
- CN
- China
- Prior art keywords
- filter paper
- nucleic acid
- solution
- acid extraction
- extraction column
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
- D21H27/00—Special paper not otherwise provided for, e.g. made by multi-step processes
- D21H27/08—Filter paper
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
- D21H13/00—Pulp or paper, comprising synthetic cellulose or non-cellulose fibres or web-forming material
- D21H13/36—Inorganic fibres or flakes
- D21H13/38—Inorganic fibres or flakes siliceous
- D21H13/40—Inorganic fibres or flakes siliceous vitreous, e.g. mineral wool, glass fibres
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
- D21H17/00—Non-fibrous material added to the pulp, characterised by its constitution; Paper-impregnating material characterised by its constitution
- D21H17/20—Macromolecular organic compounds
- D21H17/33—Synthetic macromolecular compounds
- D21H17/46—Synthetic macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
- D21H17/54—Synthetic macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds obtained by reactions forming in the main chain of the macromolecule a linkage containing nitrogen
- D21H17/55—Polyamides; Polyaminoamides; Polyester-amides
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
- D21H21/00—Non-fibrous material added to the pulp, characterised by its function, form or properties; Paper-impregnating or coating material, characterised by its function, form or properties
- D21H21/14—Non-fibrous material added to the pulp, characterised by its function, form or properties; Paper-impregnating or coating material, characterised by its function, form or properties characterised by function or properties in or on the paper
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment. The polyacrylamide derivative modified filter paper is fiber filter paper modified with a modifier, and the modifier is a polymer of one or more acrylic acid derivative monomers. The invention provides a nucleic acid extraction method based on polyacrylamide derivative modified filter paper, which can be used for DNA separation and enrichment and RNA separation and enrichment, takes the polyacrylamide derivative modified filter paper as a core, and comprises a set of DNA extraction reagent, RNA extraction reagent and a device, wherein the reagent mainly comprises lysis solution, cleaning solution and nucleic acid releasing agent, the device consists of a nucleic acid extraction column, a filter paper fixing base, a centrifugal tube and a PCR tube, and comprises four basic steps of lysis, nucleic acid capture, cleaning and filter paper transfer.
Description
Technical Field
The invention relates to polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment, and belongs to the technical field of nucleic acid extraction.
Background
The extraction of nucleic acid is widely applied to the aspects of infectious disease detection, tumor diagnosis, prenatal screening, forensic identification, food safety detection, molecular biology research and the like. The novel coronavirus epidemic situation which is developed at the end of 2019 fully shows the huge role of nucleic acid detection in epidemic situation prevention and control, and also reveals numerous problems in nucleic acid detection. For example, screening for low risk populations is difficult to deploy over large areas, limited by the ability to detect nucleic acids. The method can greatly improve the detection capability by mixing a plurality of samples for detection, can also reduce the screening cost, and is a scheme which can be used for expanding the infectious disease nucleic acid screening capability. However, after a large amount of collected samples are mixed, the total volume and the total nucleic acid amount of the samples are greatly increased, so that the extraction efficiency of the viral nucleic acid is greatly reduced, the detection sensitivity is greatly reduced, and the reliability of the screening result is influenced. In addition, due to the insufficient detection sensitivity of virus nucleic acid, a small number of people carrying virus are missed, so that the event of epidemic situation re-propagation occurs frequently. The limiting factor of these problems is mainly the low enrichment rate of nucleic acids, and the existing nucleic acid extraction technology is difficult to adapt to the extraction of nucleic acids from large-volume samples. Therefore, it is an urgent technical problem to develop a method for extracting nucleic acid from a large volume of biological sample.
The current nucleic acid extraction methods include phenol chloroform extraction, silica solid phase extraction, magnetic bead method, and the like. However, the methods still have the defects that interference substances such as chloroform, ethanol and the like which have inhibition on subsequent amplification are required to be introduced in the extraction process, the enrichment rate is low, and the methods are difficult to adapt to the efficient enrichment of nucleic acid in a large-volume sample. In addition, as the automation and integration degree of nucleic acid analysis are increasing, the automation of nucleic acid detection requires easy integration of extraction methods, the use of organic solvents such as ethanol, etc. should be avoided as much as possible, and the compatibility with cell lysis at the front end and nucleic acid amplification at the rear end should be strong.
Disclosure of Invention
The invention aims to provide polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment.
The invention firstly provides a polyacrylamide derivative modified filter paper, which is a fiber filter paper modified with a modifier;
the modifier is a polymer of one or more acrylic acid derivative monomers.
In the above polyacrylamide derivative modified filter paper, the fiber filter paper may be a glass matrix fiber filter paper or a quartz matrix fiber filter paper.
In the above filter paper modified by polyacrylamide derivatives, the acrylic acid derivative monomer is selected from acrylamide, N- (3-aminopropyl) methacrylate hydrochloride, 3-indoleacrylic acid, 2-acrylamido-2-methylpropanesulfonic acid sodium salt and hydroxymethyl acrylamide.
The invention further provides a preparation method of the polyacrylamide derivative modified filter paper, which comprises the following steps:
1) activating the fiber filter paper and then performing silanization treatment;
2) and carrying out polymerization reaction on one or more acrylic acid derivative monomers on the surface of the fiber filter paper.
In the preparation method, in the step 1), the fiber filter paper is activated by the following method a) or b) to remove impurities on the surface of the fiber filter paper:
a) adding the fiber filter paper into a mixed solution of concentrated sulfuric acid and hydrogen peroxide to react for 30-60 min;
b) and adding the fiber filter paper into 0.5-2M hydrochloric acid solution for reaction for 1-3 days.
In the above preparation method, in step 1), the silylation agent used in the silylation treatment can be 3- (methacryloyloxy) propyl trimethoxysilane or 3-glycidyl ether oxypropyl methyldiethoxysilane;
the steps of the silanization treatment are as follows:
and adding the fiber filter paper into a mixed solution of ethanol and water containing the silanization reagent to react for 1-2 h.
In the preparation method, in the step 2), the fiber filter paper is added into a reaction solution containing the acrylic acid derivative monomer to carry out the polymerization reaction for 1-3 hours;
the composition of the reaction solution was as follows:
the Tris-HCl buffer solution with pH of 8-9 has a molar concentration of 50mM, ammonium pyrophosphate in a mass concentration of 0.0001-0.001%, N, N, N ', N' -tetramethyldiethylamine in a mass concentration of 0.0001-0.0005%, and acrylic acid derivative monomer in a molar concentration of 1-20 mM, such as 18.75mM, using water and ethanol as solvents.
Based on the polyacrylamide derivative modified filter paper, the invention also provides a nucleic acid extraction device, which comprises a nucleic acid extraction column, a filter paper fixing support, filter paper, a centrifugal tube and a PCR tube;
the filter paper is the polyacrylamide derivative modified filter paper;
the filter paper can be fixed in a circular hole in the middle of the filter paper fixing bottom support, and a gasket which can be penetrated by liquid is arranged at the lower part of the circular hole;
the filter paper fixing base is matched with the nucleic acid extraction column through threads;
the filter paper fixing support is positioned at the bottom of the nucleic acid extraction column;
and cutting the filter paper into a wafer with the diameter of 2-4 mm.
Based on the nucleic acid extraction device, the invention provides a high-enrichment-rate nucleic acid extraction method, which comprises the following steps:
s1, mixing the sample solution with the lysis solution for vibration lysis;
s2, transferring the mixed solution processed in the step S1 to the nucleic acid extraction column in the nucleic acid extraction device, wherein the centrifugal tube is sleeved outside the nucleic acid extraction column, and performing centrifugal filtration to capture nucleic acid;
the filter paper is fixed in a circular hole in the middle of the filter paper fixing support, and the filter paper fixing support is matched with the nucleic acid extraction column;
s3, after the waste liquid in the centrifugal tube is poured out, nesting the nucleic acid extraction column into the centrifugal tube again, adding a cleaning solution into the nucleic acid extraction column, and centrifuging to clean;
s4, taking out the nucleic acid extraction column, detaching the filter paper fixing support, turning over, inserting the filter paper fixing support into the PCR tube, and transferring the filter paper into the PCR tube in a centrifugal or finger-flicking mode; and then adding an amplification reagent containing a nucleic acid releasing agent into the PCR tube, centrifuging and carrying out amplification detection.
In the method for extracting nucleic acid, in step S1, the volume ratio of the sample solution to the lysis solution is 1: 0.5 to 2;
the conditions of the concussion cracking are as follows: cracking at 800-2000 rpm for 2-10 min at room temperature (for RNA extraction) or 50-80 deg.C (for DNA extraction);
the lysate can be used for the lysis of viruses, cells, bacteria and fungi, the lysate not only plays a role in lysis, but also can provide a proper solution environment for the subsequent extraction of nucleic acid, and the lysate comprises a lysate for DNA capture and a lysate for RNA capture;
the lysis solution for DNA capture is an acidic morpholine ethanesulfonic acid buffer solution with the pH value of 4-7, and comprises the following components:
1-4M guanidine hydrochloride or guanidine isothiocyanate, 10-40 mM dithiothreitol and 10-40 mM ethylenediaminetetraacetic acid disodium salt;
the lysis solution for RNA capture is an acidic morpholine ethanesulfonic acid buffer solution with the pH value of 4-7, and comprises the following components:
2-10M of urea, 10-40 mM of dithiothreitol, 10-40 mM of ethylenediaminetetraacetic acid disodium salt, 5-30 mM of lithium acetate and 0.1-10 mu g/mL of carrier RNA.
In the above-mentioned nucleic acid extraction method, in step S2, the capturing conditions are: centrifuging for 2-10 min under the condition of 200-2000 g;
in step S3, the cleaning conditions are: centrifuging for 2-3 min under the condition of 2000-5000 g;
the cleaning solution is a low-salt solution (for RNA) or TE buffer solution (for DNA) containing diethyl pyrocarbonate;
in step S4, the releasing agent includes anionic polysaccharide and surfactant, which can improve the compatibility of the filter paper and the amplification reagent;
the anionic polysaccharide is sodium alginate and chondroitin sulfate;
the surfactant is Tween-20, Triton X-100 and NP 40.
The nucleic acid extraction method provided by the invention can be used for efficiently separating and enriching nucleic acid in a large-volume biological sample, and can greatly improve the sensitivity of nucleic acid detection by combining with a subsequent nucleic acid amplification detection method. The method is used for four basic steps of cracking, nucleic acid capturing, cleaning and filter paper transferring in the extraction of nucleic acid in a biological sample, and has the advantages of simple operation, no organic solvents such as ethanol and the like, easy integration on a microfluidic chip and high enrichment rate, and can be used for separating nucleic acid in a large-volume biological sample.
Drawings
FIG. 1 shows an XPS spectrum of a filter paper modified with a polyacrylamide derivative according to the present invention.
FIG. 2 is a schematic diagram of a nucleic acid extraction column and a centrifuge tube in a nucleic acid extraction device based on polyacrylamide derivative modified filter paper.
FIG. 3 is a schematic diagram showing the transfer of a filter paper to a PCR tube in the nucleic acid isolation apparatus based on a polyacrylamide derivative-modified filter paper according to the present invention.
FIG. 4 shows the result of RNA extraction and RT-PCR detection of the novel coronavirus in example 1 of the present invention.
FIG. 5 shows the result of the Chlamydia trachomatis DNA extraction and LAMP detection in the embodiment 2 of the present invention, wherein the following steps are performed from left to right: red: 10000 copies; orange color: 1000 copies; blue color: 100 copies; black (horizontal): and (5) negative control.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The invention provides a high-enrichment-rate nucleic acid extraction method based on polyacrylamide derivative modified filter paper, which comprises the following steps:
s1, mixing the sample solution with the lysis solution for vibration lysis;
s2, transferring the mixed solution processed in the step S1 to the nucleic acid extraction column in the nucleic acid extraction device, wherein the centrifugal tube is sleeved outside the nucleic acid extraction column, and performing centrifugal filtration to capture nucleic acid;
the filter paper is fixed in a circular hole in the middle of the filter paper fixing support, and the filter paper fixing support is matched with the nucleic acid extraction column;
s3, after the waste liquid in the centrifugal tube is poured out, nesting the nucleic acid extraction column into the centrifugal tube again, adding a cleaning solution into the nucleic acid extraction column, and centrifuging to clean;
s4, taking out the nucleic acid extraction column, detaching the filter paper fixing support, turning over, inserting the filter paper fixing support into the PCR tube, and transferring the filter paper into the PCR tube in a centrifugal or finger-flicking mode; and then adding an amplification reagent containing a nucleic acid releasing agent into the PCR tube, centrifuging and carrying out amplification detection.
Example 1 extraction of New coronavirus RNA in combination with qPCR detection
Preparation of acrylamide derivative modified filter paper
(1) Cleaning and activating the surface of filter paper
The quartz matrix fiber filter paper was put into a 1M hydrochloric acid solution for 3 days to react to remove impurities on the surface of the filter paper fiber. After completion of the washing and activation, washing was performed with a large amount of deionized water, so that the pH of the filter paper was returned to neutral, unknown.
(2) Silanization modification of filter paper
The activated filter paper was placed in a 1: 1, reacting for 1 hour at room temperature, washing for three times by using deionized water, and drying on a hot plate at 80 ℃ after washing.
(3) Polymerization of acrylamide derivative monomer
A reaction premix containing 50mM Tris-HCl buffer solution with pH 9.0, 18.75mM N- (3-aminopropyl) methacrylate hydrochloride, 35.5mL deionized water and 2mL absolute ethanol was prepared before polymerization. After the reaction premix was mixed well, filter paper was added, and 9. mu.L of 10% ammonium pyrophosphate (mass concentration in the system: 0.000225%) and 5. mu.L of N, N, N ', N' -tetramethyldiethylamine (mass concentration in the system: 0.000125%) were sequentially added, followed by shaking reaction at room temperature for 2 hours. After the reaction was completed, the reaction mixture was repeatedly washed with deionized water five times, and then placed in an oven to be dried overnight at 80 ℃.
The XPS (photoelectron spectroscopy) of the prepared filter paper is shown in FIG. 1, and it can be seen that the filter paper is modified to have nitrogen elements, which indicates that the monomers are modified on the surface of the filter paper.
II, nucleic acid extraction device
As shown in FIGS. 2 and 3, the nucleic acid extraction apparatus provided by the present invention comprises a nucleic acid extraction column 1, a filter paper fixing holder 3, filter paper 2, a centrifuge tube 4, and a PCR tube 5. Wherein, the filter paper 3 is the acrylamide derivative modified filter paper prepared in the first step, and can be fixed in a round hole in the middle of the filter paper fixing support 3, a liquid permeable gasket (not shown) is arranged at the lower part of the round hole, the filter paper fixing support 3 is matched with the nucleic acid extraction column 1 through threads, and the filter paper fixing support 3 is positioned at the bottom of the nucleic acid extraction column 1.
The assembly process of the nucleic acid extraction device of the invention is as follows:
the modified filter paper 2 is beaten into a small round piece with the diameter of 2.5mm by using a puncher, a layer of plastic gasket is filled at the bottom of the filter paper fixing support 3, then the filter paper 2 is placed on the gasket, the filter paper is slightly compressed, the filter paper fixing support 3 is screwed onto a stud at the bottom end of the nucleic acid extraction column 1, the filter paper fixing support 3 and the nucleic acid extraction column 1 are assembled into a 15ml centrifugal tube 4, and therefore the assembly of the extraction device is completed, as shown in figure 2.
After capturing nucleic acid, the nucleic acid extraction cartridge 1 is removed, then the filter paper fixing mount 3 is detached, turned upside down, and inserted into the PCR tube 5, and the filter paper 2 is transferred into the PCR tube 5 by centrifugation or finger flicking, thereby transferring the filter paper 2 into the PCR tube 5, as shown in FIG. 3.
Thirdly, extracting and detecting the pseudovirus in the virus collection liquid
(1) Splitting of viruses
Adding 10, 20 and 50 pseudoviruses into 1mL of virus collection liquid according to the volume ratio of 1: 1, mixing the virus collection liquid and the lysate uniformly, then shaking and cracking at 1200rpm for 10min, and carrying out the process at room temperature. The virus collection liquid is a virus collection liquid of Youkangyan swab, and the lysis liquid contains 8M urea, 30mM dithiothreitol and 30mM EDTA2Na, 50mM MES buffer, 30mM LiAc and 100ng yeast tRNA.
(2) Capture of viral RNA
After completion of the shake lysis, the liquid was transferred directly to the assembled nucleic acid extraction device and 500g was centrifuged to capture viral RNA.
(3) Cleaning of filter paper
Pouring the waste liquid in the centrifuge tube, nesting the nucleic acid extraction column 1 into the centrifuge tube 4 again, adding a cleaning solution (DEPC water) into the nucleic acid extraction column 1, centrifuging and cleaning the filter paper twice, wherein the preferred cleaning condition is 2000g centrifugation for 2-5 min.
(4) Transfer of filter paper
The nucleic acid extraction column 1 is taken out, the filter paper fixing support 3 at the bottom of the nucleic acid extraction column 1 is unscrewed, the nucleic acid extraction column is placed into the PCR tube 5 after being turned over, the filter paper is transferred to the bottom of the PCR tube 5 through centrifugation at 2000g for 1min, the cover is opened, the filter paper fixing support 3 is discarded, and therefore the filter paper 2 is transferred into the PCR tube 5.
(5) Amplification assay
And after the filter paper 2 is transferred into the PCR tube 5, adding the prepared RT-qPCR system containing the release agent into the PCR tube 5, and after simple centrifugation, transferring the PCR tube 5 into a PCR instrument for real-time fluorescent quantitative PCR detection of virus nucleic acid.
RT-qPCR primer sequences and modifications were as follows:
nCoV_N1-F：GAC CCC AAA ATC AGC GAA AT；
nCoV_N1-R：TCT GGT TAC TGC CAG TTG AAT CTG；
nCoV_N1-P：FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1；
the sequence is sequence 1-sequence 3.
19 μ L of RT-qPCR reagent was added to each piece of modified filter paper, and the 19 μ L of RT-qPCR system contained: 10 μ L of 2 Xone Step PrimeScriptTMIII RT-qPCR Mix, 1.0. mu.L nCoV _ N1-F and nCoV _ N1-R, 0.4. mu.L nCoV _ N1-P, 5. mu.L 4X nucleic acid releasing agent (0.25% sodium alginate, 0.25% Tween-20), 1.6. mu.L DEPC water.
The temperature cycling conditions of RT-qPCR were: the retrovirus RNA is preserved at 52 ℃ for 5min, and then is subjected to 45 temperature-changing cycles (denaturation at 95 ℃ for 5s, annealing at 60 ℃ and extension for 30s), fluorescent signals are collected at the extension stage of each cycle, an amplification curve is obtained by the collection and processing of a PCR instrument, and the Ct value is calculated, and the result is shown in figure 4.
As can be seen from FIG. 4, the detection sensitivity of the viral nucleic acid can be greatly improved by the method of extracting the viral RNA in combination with RT-PCR detection, and the detection limit can even reach 10 copies/mL.
Example 2 extraction of Chlamydia trachomatis DNA in combination with LAMP amplification assay.
Preparation of acrylamide derivative modified filter paper
(1) Cleaning and activating the surface of filter paper
The glass matrix fiber filter paper was put into a 1M hydrochloric acid solution for 2 days to react to remove impurities on the surface of the filter paper fiber. After completion of the washing and activation, washing was performed with a large amount of deionized water, so that the pH of the filter paper was returned to neutral, unknown.
(2) Silanization modification of filter paper
The activated filter paper was placed in a 1: 1, reacting for 1h at room temperature, washing for three times by using deionized water, and drying on a hot plate at 80 ℃ after washing.
(3) Polymerization of acrylamide derivative monomer
A reaction premix containing 50mM Tris-HCl buffer solution with pH 9.0, 15mM N- (3-aminopropyl) methacrylate hydrochloride, 3.75mM acrylamide monomer, 35.5mL deionized water and 2mL absolute ethyl alcohol was prepared before polymerization. After the reaction premix is mixed uniformly, filter paper is added, 9.5. mu.L of 10% ammonium pyrophosphate (0.000225% in mass concentration of the system) and 6. mu.L of N, N, N ', N' -tetramethyldiethylamine (0.000125% in mass concentration of the system) are sequentially added, and the mixture is shaken to react for 2 hours at room temperature. After the reaction was completed, the reaction mixture was repeatedly washed with deionized water five times, and then placed in an oven to be dried overnight at 80 ℃.
II, nucleic acid extraction device
As in example 1.
Thirdly, extracting and detecting the pseudovirus in the virus collection liquid
(1) Lysis of chlamydia trachomatis:
adding 10, 20 and 50 chlamydia trachomatis particles into 1mL of virus collection liquid according to the volume ratio of 1: 1 mixing the virus collection liquid and the lysis solution evenly, and oscillating at 1200rpmThe cleavage is carried out for 10min at 60 ℃. The lysate contained 2M guanidine hydrochloride, 30mM dithiothreitol, 40mM EDTA2Na, 50mM MES buffer solution.
2) Capture of Chlamydia trachomatis DNA
After completion of the shake lysis, the liquid was directly transferred to an assembled nucleic acid extraction device and centrifuged at 500g for 5min to capture the Chlamydia trachomatis DNA.
3) And (3) cleaning the filter paper:
and after the waste liquid in the centrifugal tube is poured out, sleeving the centrifugal column tube into the centrifugal tube again, adding a cleaning solution (TE buffer solution) into the centrifugal column tube, centrifuging and cleaning the filter paper twice, wherein the cleaning condition is preferably 2000g for 2 minutes.
4) Transfer of filter paper
Taking out the nucleic acid extraction column 1, unscrewing a filter paper fixing support 3 at the bottom of the nucleic acid extraction column 1, turning over, putting the filter paper fixing support into a PCR tube 5, covering a cover of the PCR tube 5 into a back side hole of the filter paper fixing support 3, transferring the filter paper 2 into the PCR tube 5 at the bottom in a finger-flicking mode, transferring the filter paper into the PCR tube, adding an amplification reagent and detecting target nucleic acid by in-situ amplification.
5) Amplification assay
And (3) transferring the filter paper 2 into the PCR tube 5, adding the prepared LAMP amplification system into the PCR tube 5, transferring the PCR tube 5 into a PCR instrument after simple centrifugation, and performing LAMP amplification detection on the DNA of the chlamydia trachomatis.
The LAMP amplification primer is synthesized by biological engineering (Shanghai) limited and has the following sequence:
CT7-FIP：AGGCGATTTAAAAACCAAGGTCG-CTTATCGCCGATGAGTTCG；
CT7-BIP：AGCGGCCAAAATATATGCGG-TTTATAAACCTCCCCAACCA；
CT7-LF1：GTGATAGGGAAAGTATGTGGAATGT；
CT7-LB2：GGGGATCGATTGAAACTCTTTTTGT；
CT7-F3：GGAAGAAATTGATCCAACACC；
CT7-B3：TGCTTACAATGCTCTTGCA。
the sequence is sequence 4-sequence 9.
20 μ L LAMP amplification System: 2 μ L10 XHG 2.0Buffer (containing Mg)2+) 1.12. mu.L dNTP (25mM), 1.6. mu.L Syto9 (50. mu.M), 0.4. mu.L CT7-F3/CT7-B3(10um), 1.6. mu.L CT7-FIP3/CT7-BIP3(20um), 0.4. mu.L CT7-LF1/CT7-LB2(20um), 0.5. mu.L HG 2.0Bst (8U/ul), 7.98. mu.L ultrapure water.
LAMP amplification is completed in a PCR instrument, a fluorescence value is collected every 50s in the process of keeping the temperature constant at 65 ℃, the instrument completes the collection and processing of fluorescence signals to obtain an amplification curve, and the existence of a target sequence is judged according to the amplification curve, as shown in figure 5, as can be seen from figure 5, DNA can be extracted from a large number of biological samples by the method, and the target sequence is detected in situ through LAMP amplification on filter paper.
SEQUENCE LISTING
<110> Qinghua university
<120> polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence
<400> 2
tctggttact gccagttgaa tctg 24
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence
<400> 3
accccgcatt acgtttggtg gacc 24
<210> 4
<211> 42
<212> DNA
<213> Artificial sequence
<400> 4
aggcgattta aaaaccaagg tcgcttatcg ccgatgagtt cg 42
<210> 5
<211> 40
<212> DNA
<213> Artificial sequence
<400> 5
agcggccaaa atatatgcgg tttataaacc tccccaacca 40
<210> 6
<211> 25
<212> DNA
<213> Artificial sequence
<400> 6
gtgataggga aagtatgtgg aatgt 25
<210> 7
<211> 25
<212> DNA
<213> Artificial sequence
<400> 7
ggggatcgat tgaaactctt tttgt 25
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence
<400> 8
ggaagaaatt gatccaacac c 21
<210> 9
<211> 19
<212> DNA
<213> Artificial sequence
<400> 9
tgcttacaat gctcttgca 19
Claims (9)
1. A polyacrylamide derivative modified filter paper is a fiber filter paper modified with a modifier;
the modifier is a polymer of one or more acrylic acid derivative monomers;
the acrylic acid derivative monomer is selected from acrylamide, N- (3-aminopropyl) methacrylate hydrochloride, 3-indoleacrylic acid, 2-acrylamido-2-methylpropanesulfonic acid sodium salt and hydroxymethyl acrylamide;
the polyacrylamide derivative modified filter paper is prepared by the method comprising the following steps:
1) activating the fiber filter paper and then performing silanization treatment;
2) and carrying out polymerization reaction on one or more acrylic acid derivative monomers on the surface of the fiber filter paper.
2. The polyacrylamide derivative-modified filter paper as claimed in claim 1, wherein: the fiber filter paper is glass matrix fiber filter paper or quartz matrix fiber filter paper.
3. The method for preparing the polyacrylamide derivative-modified filter paper according to claim 1 or 2, comprising the steps of:
1) activating the fiber filter paper and then performing silanization treatment;
2) and carrying out polymerization reaction on one or more acrylic acid derivative monomers on the surface of the fiber filter paper.
4. The production method according to claim 3, characterized in that: in the step 1), the fiber filter paper is activated by the following method a) or b):
a) adding the fiber filter paper into a mixed solution of concentrated sulfuric acid and hydrogen peroxide to react for 30-60 min;
b) and adding the fiber filter paper into 0.5-2M hydrochloric acid solution for reaction for 1-3 days.
5. The production method according to claim 3 or 4, characterized in that: in the step 1), the silanization reagent adopted in the silanization treatment is 3- (methacryloyloxy) propyl trimethoxy silane or 3-glycidyl ether oxy propyl methyl diethoxy silane;
the steps of the silanization treatment are as follows:
adding the fiber filter paper into a mixed solution of ethanol and water containing the silanization reagent to react for 1-2 h;
in the step 2), adding the fiber filter paper into a reaction solution containing the acrylic acid derivative monomer to perform the polymerization reaction for 1-3 hours;
the composition of the reaction solution was as follows:
the Tris-HCl buffer solution with the pH value of 8-9 takes water and ethanol as solvents, the molar concentration of the Tris-HCl buffer solution is 50mM, the mass concentration of ammonium pyrophosphate is 0.0001-0.001%, the mass concentration of N, N, N ', N' -tetramethyl diethylamine is 0.0001-0.0005%, and the molar concentration of an acrylic acid derivative monomer is 1-20 mM.
6. A nucleic acid extraction device comprises a nucleic acid extraction column, a filter paper fixing support, filter paper, a centrifuge tube and a PCR tube;
the filter paper is the polyacrylamide derivative modified filter paper according to claim 1 or 2;
the filter paper can be fixed in a circular hole in the middle of the filter paper fixing bottom support, and a gasket which can be penetrated by liquid is arranged at the lower part of the circular hole;
the filter paper fixing base is matched with the nucleic acid extraction column through threads;
the filter paper fixing support is positioned at the bottom of the nucleic acid extraction column;
and cutting the filter paper into a wafer with the diameter of 2-4 mm.
7. A method for extracting nucleic acid with high enrichment rate comprises the following steps:
s1, mixing the sample solution with the lysis solution for vibration lysis;
s2, transferring the mixed solution processed in the step S1 to the nucleic acid extraction column in the nucleic acid extraction device of claim 6, wherein the centrifugal tube is sleeved outside the nucleic acid extraction column, and performing centrifugal filtration to capture nucleic acid;
the filter paper is fixed in a circular hole in the middle of the filter paper fixing support, and the filter paper fixing support is matched with the nucleic acid extraction column;
s3, after the waste liquid in the centrifugal tube is poured out, nesting the nucleic acid extraction column into the centrifugal tube again, adding a cleaning solution into the nucleic acid extraction column, and centrifuging to clean;
s4, taking out the nucleic acid extraction column, detaching the filter paper fixing support, turning over, inserting the filter paper fixing support into the PCR tube, and transferring the filter paper into the PCR tube in a centrifugal or finger-flicking mode; and then adding an amplification reagent containing a nucleic acid releasing agent into the PCR tube, centrifuging and carrying out amplification detection.
8. The method for extracting nucleic acid according to claim 7, wherein: in step S1, the volume ratio of the sample solution to the lysis solution is 1: 0.5 to 2;
the conditions of the concussion cracking are as follows: cracking at 800-2000 rpm for 2-10 min at room temperature or 50-80 deg.C;
the lysis solution comprises lysis solution for DNA capture and lysis solution for RNA capture;
the lysis solution for DNA capture is an acidic morpholine ethanesulfonic acid buffer solution with the pH value of 4-7, and comprises the following components:
1-4M guanidine hydrochloride or guanidine isothiocyanate, 10-40 mM dithiothreitol and 10-40 mM ethylenediaminetetraacetic acid disodium salt;
the lysis solution for RNA capture is an acidic morpholine ethanesulfonic acid buffer solution with the pH value of 4-7, and comprises the following components:
2-10M of urea, 10-40 mM of dithiothreitol, 10-40 mM of ethylenediaminetetraacetic acid disodium salt, 5-30 mM of lithium acetate and 0.1-10 mu g/mL of carrier RNA.
9. The method for extracting nucleic acid according to claim 7 or 8, wherein: in step S2, the capturing conditions are: centrifuging for 2-10 min under the condition of 200-2000 g;
in step S3, the cleaning conditions are: centrifuging for 2-3 min under the condition of 2000-5000 g;
the cleaning solution is a low-salt solution or TE buffer solution containing diethyl pyrocarbonate;
in step S4, the release agent includes an anionic polysaccharide and a surfactant;
the anionic polysaccharide is sodium alginate and chondroitin sulfate;
the surfactant is Tween-20, Triton X-100 and NP 40.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110187013.4A CN112982012B (en) | 2021-02-09 | 2021-02-09 | Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment |
| PCT/CN2021/077766 WO2022170644A1 (en) | 2021-02-09 | 2021-02-25 | Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110187013.4A CN112982012B (en) | 2021-02-09 | 2021-02-09 | Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112982012A CN112982012A (en) | 2021-06-18 |
| CN112982012B true CN112982012B (en) | 2022-05-10 |
Family
ID=76394000
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110187013.4A Active CN112982012B (en) | 2021-02-09 | 2021-02-09 | Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112982012B (en) |
| WO (1) | WO2022170644A1 (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6043032A (en) * | 1993-09-22 | 2000-03-28 | Tosoh Corporation | Method of extracting nucleic acids and method of detecting specified nucleic acid sequences |
| CN104258833A (en) * | 2014-09-24 | 2015-01-07 | 华南师范大学 | Preparation method of novel solid phase microextraction fiber based on nucleic acid aptamer/ nanogold/ porous polymer coating |
| CN104597230A (en) * | 2015-01-29 | 2015-05-06 | 国家纳米科学中心 | Functional polymer thin film, preparation method and application thereof |
| CN104651524A (en) * | 2015-03-13 | 2015-05-27 | 苏州新海生物科技有限公司 | Method for storing biological samples and kit |
| CN105424923A (en) * | 2015-09-10 | 2016-03-23 | 南京微测生物科技有限公司 | Color-fluorescence dual-function immunochromatography test strip and preparation method thereof |
| CN108085314A (en) * | 2016-11-21 | 2018-05-29 | 清华大学 | A kind of amination filter paper/film purified for nucleic acid extraction and preparation method and application |
| CN111205403A (en) * | 2020-01-13 | 2020-05-29 | 东南大学 | Polyacrylamide microsphere for rapid extraction of nucleic acid and preparation method and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4191051B2 (en) * | 2002-02-27 | 2008-12-03 | 三光純薬株式会社 | Plasma or serum separator |
| CN101912768B (en) * | 2010-07-07 | 2012-05-23 | 葛志强 | Medium for adsorbing stored DNA and preparation method |
| WO2012171560A1 (en) * | 2011-06-15 | 2012-12-20 | Pfaff Tim | Plasma or serum separator |
| CN205443288U (en) * | 2016-03-24 | 2016-08-10 | 深圳逗点生物技术有限公司 | Nucleic acid extraction device |
| CN111206030B (en) * | 2020-02-18 | 2022-08-16 | 南京农业大学 | Virus nucleic acid extraction method based on glass fiber filter paper |
-
2021
- 2021-02-09 CN CN202110187013.4A patent/CN112982012B/en active Active
- 2021-02-25 WO PCT/CN2021/077766 patent/WO2022170644A1/en unknown
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6043032A (en) * | 1993-09-22 | 2000-03-28 | Tosoh Corporation | Method of extracting nucleic acids and method of detecting specified nucleic acid sequences |
| CN104258833A (en) * | 2014-09-24 | 2015-01-07 | 华南师范大学 | Preparation method of novel solid phase microextraction fiber based on nucleic acid aptamer/ nanogold/ porous polymer coating |
| CN104597230A (en) * | 2015-01-29 | 2015-05-06 | 国家纳米科学中心 | Functional polymer thin film, preparation method and application thereof |
| CN104651524A (en) * | 2015-03-13 | 2015-05-27 | 苏州新海生物科技有限公司 | Method for storing biological samples and kit |
| CN105424923A (en) * | 2015-09-10 | 2016-03-23 | 南京微测生物科技有限公司 | Color-fluorescence dual-function immunochromatography test strip and preparation method thereof |
| CN108085314A (en) * | 2016-11-21 | 2018-05-29 | 清华大学 | A kind of amination filter paper/film purified for nucleic acid extraction and preparation method and application |
| CN111205403A (en) * | 2020-01-13 | 2020-05-29 | 东南大学 | Polyacrylamide microsphere for rapid extraction of nucleic acid and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022170644A1 (en) | 2022-08-18 |
| CN112982012A (en) | 2021-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110331089B (en) | Full-automatic nucleic acid extraction amplification detection micro-fluidic chip box and application thereof | |
| JP4264134B2 (en) | Biopolymer, microorganism or substance treatment method using multiple types of magnetic particles | |
| EP0442026B1 (en) | Method to extract and purify human genomic DNA | |
| CN106754343B (en) | DNA sequencing apparatus and system based on pyrosequencing | |
| WO2011150833A1 (en) | Test tube, device comprising test tube and liquid treatment method by using same | |
| JP2011505118A (en) | Apparatus, system and method for purifying nucleic acids | |
| EP1453484A2 (en) | Methods and materials for detecting genetic material | |
| JP2009131264A (en) | Isolation and purification of nucleic acid | |
| DK2283026T3 (en) | PROCEDURE FOR CONCENTRATION AND INSULATION OF BIOMOLECULES OR VIRUSES | |
| CN103952397A (en) | Method for separating free nucleic acid from blood serum or blood plasma sample by using magnetic bead | |
| CN104334725A (en) | Biomolecule isolation | |
| CN105524917A (en) | Kit for extracting blood genome DNA based on magnetic bead method and use method for kit | |
| CN105695450A (en) | Magnetic-bead-process-based kit for extracting free DNAs (deoxyribonucleic acids) and application method thereof | |
| EP2997166A1 (en) | Analyte enrichment methods and compositions | |
| CN111424115A (en) | Method for detecting novel coronavirus by using glucometer | |
| CN103184214B (en) | A kind of hbv nucleic acid rapid extraction reagent | |
| CN1304589C (en) | Process for separating nucleic acid from biological particles by solid-phase carrier | |
| JP2018516533A5 (en) | ||
| US20160168562A1 (en) | Device having a filter layer and method for extracting nucleic acids from formalin-fixed and paraffin-embedded samples | |
| CN112982012B (en) | Polyacrylamide derivative modified filter paper and application thereof in nucleic acid separation and enrichment | |
| KR20150127917A (en) | Method of extracting and amplifying nucleic acids by using magnetic bead | |
| CN100338223C (en) | Single chain DNA fast preparation technology and reagent box | |
| CN113026110A (en) | High-throughput single-cell transcriptome sequencing method and kit | |
| CN113186249A (en) | Rapid extraction kit for viral nucleic acid and use method thereof | |
| CN101033484B (en) | Method of extracting, amplifying and detecting nucleic acid in single tube based on nano microsphere |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210910 Address after: 310018 2a20, building 2, No. 339, Baiyang street, Qiantang new area, Hangzhou, Zhejiang Applicant after: Hangzhou Zijing biological Co.,Ltd. Address before: 100084, Haidian District, 100084 mailbox, 82 boxes, Tsinghua University patent office, Beijing Applicant before: TSINGHUA University |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |