CN112980982B - Primers and detection kit for identifying multiple staphylococci based on pheS gene and application thereof - Google Patents
Primers and detection kit for identifying multiple staphylococci based on pheS gene and application thereof Download PDFInfo
- Publication number
- CN112980982B CN112980982B CN202110536972.2A CN202110536972A CN112980982B CN 112980982 B CN112980982 B CN 112980982B CN 202110536972 A CN202110536972 A CN 202110536972A CN 112980982 B CN112980982 B CN 112980982B
- Authority
- CN
- China
- Prior art keywords
- staphylococcus
- seq
- primer
- primer pair
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention provides a primer and a detection kit for identifying various staphylococci based on pheS genes and application thereof, belonging to the technical field of bacteria identification. The invention provides a primer group for identifying multiple staphylococci based on pheS gene, which comprises the following two or more primer pairs: the primer pair for specifically amplifying staphylococcus aureus, the primer pair for specifically amplifying staphylococcus wowensis, the primer pair for specifically amplifying staphylococcus epidermidis, the primer pair for specifically amplifying human staphylococcus, the primer pair for specifically amplifying staphylococcus capitis and the primer pair for specifically amplifying staphylococcus haemolyticus. The primer group has the characteristics of good amplification specificity, high detection sensitivity and capability of identifying various staphylococci simultaneously. The method for detecting the staphylococcus in the environment based on the primer group can realize the simultaneous identification of the staphylococcus, and has the characteristics of short detection time, low detection cost and accurate and reliable detection result.
Description
Technical Field
The invention belongs to the technical field of bacteria identification, and particularly relates to a primer and a detection kit for identifying various staphylococci based on pheS genes and application thereof.
Background
Staphylococcus genus (Staphylococcus) Is a group of gram-positive bacteria, is the most common pyogenic coccus, is most easily infected by staphylococcus in the elderly, pregnant women, newborns and the like with low body resistance, and causes herpes zoster, conjunctivitis, sepsis and the like. In addition, staphylococci can cause infectious diseases in poultry, such as callus, omphalitis and staphylococcal septicemia, which cause significant losses to the poultry industry.
The phenylalanyl-tRNA synthetase alpha subunit gene (pheS) has high homogeneity in strains of the same species, and the gene sequence has poor similarity in different species, so that the gene is a fast-evolving gene. Research shows that the pheS gene can be used as a reliable tool for identifying environmental strains and is an effective screening method for detecting the strains.
The method for detecting the staphylococcus aureus of the experimental animal by using the gyrB characteristic sequence is reported in the prior art, a primer combination for the staphylococcus aureus is designed, the staphylococcus aureus is detected by LAMP (loop-mediated isothermal amplification), a detection result can be obtained in a short time, but only one kind of staphylococcus can be detected by the method, and the detection for the staphylococcus aureus of the experimental animal is limited in detection capability. At present, primers and a method for identifying multiple staphylococci in the environment on a species level based on pheS characteristic sequences are not reported.
Disclosure of Invention
In view of the above, the invention aims to provide a primer, a detection kit and an application thereof for identifying multiple staphylococci based on pheS gene, which are used for identifying staphylococcus aureus, staphylococcus wovensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and staphylococcus haemolyticus in the environment at the species level.
The invention provides a primer group for identifying multiple staphylococci based on pheS gene, which comprises the following two or more primer pairs: a primer pair for specifically amplifying staphylococcus aureus, a primer pair for specifically amplifying staphylococcus wowensis, a primer pair for specifically amplifying staphylococcus epidermidis, a primer pair for specifically amplifying human staphylococcus, a primer pair for specifically amplifying staphylococcus capitis and a primer pair for specifically amplifying staphylococcus haemolyticus;
the nucleotide sequence of the primer pair for specifically amplifying staphylococcus aureus is shown as SEQ ID NO 1 and SEQ ID NO:2 is shown in the specification;
the nucleotide sequence of the primer pair of the specific amplification staphylococcus wowensis is shown as SEQ ID NO:3 and SEQ ID NO:4 is shown in the specification;
the nucleotide sequence of the primer pair for specifically amplifying staphylococcus epidermidis is shown as SEQ ID NO:5 and SEQ ID NO:6 is shown in the specification;
the nucleotide sequence of the primer pair for specifically amplifying the human staphylococcus is shown as SEQ ID NO:7 and SEQ ID NO:8 is shown in the specification;
the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus caput is shown as SEQ ID NO 9 and SEQ ID NO:10 is shown in the figure;
the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus haemolyticus is shown in SEQ ID NO:11 and SEQ ID NO: shown at 12.
The invention provides a DNA barcode for identifying multiple staphylococci based on pheS genes, which comprises the following two or more DNA barcodes: a DNA barcode of Staphylococcus aureus, a DNA barcode of Staphylococcus wovensis, a DNA barcode of Staphylococcus epidermidis, a DNA barcode of Staphylococcus hominis, a DNA barcode of Staphylococcus capitis, and a DNA barcode of Staphylococcus haemolyticus;
the nucleotide sequence of the DNA bar code of the staphylococcus aureus is shown as SEQ ID NO. 13;
the nucleotide sequence of the DNA bar code of the staphylococcus Woensis is shown as SEQ ID NO. 14;
the nucleotide sequence of the DNA bar code of the staphylococcus epidermidis is shown as SEQ ID NO. 15;
the nucleotide sequence of the DNA bar code of the human staphylococcus is shown as SEQ ID NO. 16;
the nucleotide sequence of the DNA bar code of the staphylococcus capitis is shown as SEQ ID NO. 17;
the nucleotide sequence of the DNA barcode of the staphylococcus haemolyticus is shown as SEQ ID NO 18.
The invention provides a detection kit for identifying multiple staphylococci based on pheS genes, which comprises the primer group in the technical scheme.
Preferably, 10 × Taq buffer, Taq DNA Polymerase, dNTPs and the DNA barcode are included.
The invention provides application of the primer group, the detection kit or the DNA bar code in preparation of a reagent or a kit for identifying staphylococcus.
Preferably, the staphylococcus includes staphylococcus aureus, staphylococcus wovensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and/or staphylococcus haemolyticus.
The invention provides a method for rapidly identifying a plurality of staphylococci in an environment, which comprises the following steps:
1) cracking collected environmental bacteria, performing solid-liquid separation on the obtained cracking liquid, and collecting supernatant;
2) taking the supernatant in the step 1) as a template, and carrying out PCR amplification by using the primer group to obtain a PCR product;
3) carrying out fragment analysis on the PCR product obtained in the step 2) to obtain a sample of the following amplified fragment, wherein the sample of the following amplified fragment contains staphylococcus of a corresponding species;
the length of the amplified fragment of the staphylococcus aureus is 434 bp;
the length of the amplified fragment of the staphylococcus haemolyticus is 425 bp;
the length of the amplified fragment of the human staphylococcus is 941 bp;
the length of the amplified fragment of the staphylococcus volvaceae is 676 bp;
the length of the amplified fragment of the staphylococcus capitis is 581 bp;
and/or the length of the amplified fragment of staphylococcus epidermidis is 1004 bp.
Preferably, the reaction system for PCR amplification in the step 2) is 10 xTaq buffer 2 μ l, Taq DNA Polymerase 0.3 μ l, 2.5 mM dNTPs 1.6 μ l, 10 μ M upstream primer 0.4 μ l, 10 μ M downstream primer 0.4 μ l, template 2 μ l, ddH2And O is supplemented to 20 mu l.
Preferably, the reaction procedure of the PCR amplification in the step 2) is 95 ℃ for 5 min; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 90 s, 35 cycles.
Preferably, the concentration of a single bacterial species in the environmental bacteria collected in step 1) is not less than 1 × 104 CFU/ml。
The invention provides a primer group for identifying multiple staphylococci based on pheS genes, which comprises a primer pair for specifically amplifying staphylococcus aureus, a primer pair for specifically amplifying staphylococcus epidermidis, a primer pair for specifically amplifying human staphylococcus, a primer pair for specifically amplifying staphylococcus capitis and a primer pair for specifically amplifying staphylococcus haemolyticus. The invention designs specific primers aiming at pheS genes of 6 staphylococcus to obtain a primer group capable of identifying staphylococcus aureus, staphylococcus wowensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and staphylococcus haemolyticus in the environment at the species level. The primer group has higher amplification specificity, can identify various staphylococci in an amplification environment, and does not generate cross reaction.
The invention provides a DNA bar code for identifying various staphylococci based on pheS gene, which comprises one or more of the following DNA bar codes: a DNA barcode of Staphylococcus aureus, a DNA barcode of Staphylococcus wovensis, a DNA barcode of Staphylococcus epidermidis, a DNA barcode of Staphylococcus human, a DNA barcode of Staphylococcus capitis, and a DNA barcode of Staphylococcus haemolyticus. The invention can distinguish 6 staphylococci from other species at the species level by limiting the specific DNA fragments of the staphylococci in various environments, so that the identification of the staphylococci in various environments can be realized based on the DNA barcode provided by the invention.
The invention provides a method for rapidly detecting various staphylococci in environment, which comprises the steps of cracking collected environmental bacteria, taking collected supernatant as a template, carrying out PCR amplification by using a primer group, and carrying out fragment analysis on an obtained PCR product. Because the primers in the primer group can only specifically amplify the target bacteria, the method can simultaneously identify the existence of 6 staphylococci (staphylococcus aureus, staphylococcus wovensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and staphylococcus haemolyticus) in the environment, and the detection result is very accurate and reliable.
Meanwhile, the method provided by the invention does not need to carry out multi-step complex operations such as culture, DNA extraction and the like on the detected bacterial sample, and the operation method is simple; the rapid detection of the sample can be realized only by 1-2 h in the whole identification process, and the purpose of rapid identification is realized. In addition, the experiment shows that the detection sensitivity of the method provided by the invention is only 2.7 multiplied by 102CFU/ml, and has the characteristic of high detection sensitivity.
Drawings
FIG. 1 is a technical flow chart of an authentication method provided by the present invention;
FIG. 2 is the result of the specificity detection of 6 pairs of primers provided by the present invention;
FIG. 3 shows the results of the sensitivity tests of 5 staphylococci in the example of the present invention;
FIG. 4 shows the electrophoresis results of PCR amplification detection of bacterial solutions prepared by mixing 6 pairs of primers with different staphylococci.
Detailed Description
The invention provides a primer group for identifying multiple staphylococci based on pheS gene, which comprises the following two or more primer pairs: the primer pair for specifically amplifying staphylococcus aureus, the primer pair for specifically amplifying staphylococcus wowensis, the primer pair for specifically amplifying staphylococcus epidermidis, the primer pair for specifically amplifying human staphylococcus, the primer pair for specifically amplifying staphylococcus capitis and the primer pair for specifically amplifying staphylococcus haemolyticus. The nucleotide sequence of the primer pair for specifically amplifying staphylococcus aureus is shown in SEQ ID NO:1 (ctgaacaacaaacaatgtcagag) and SEQ ID NO:2 (cagcatttcgaagttataatgatc); the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus wowensis is shown as SEQ ID NO:3 (ccattgttaatacgttaggatgc) and SEQ ID NO:4 (gatgaaagacaaacgattttagc); the nucleotide sequence of the primer pair for specifically amplifying staphylococcus epidermidis is shown as SEQ ID NO:5 (tgatctaatgtctgagttgaagc) and SEQ ID NO:6 (aacggacatcattggtataaaag); the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus hominis is shown as SEQ ID NO:7 (cgaatgtcttcgattccg) and SEQ ID NO:8 (gacattaacgaagcgcaag); the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus capilalis is shown as SEQ ID NO:9 (gccatttcaagaacgtttg) and SEQ ID NO:10 (ggttcaaagcatcctcttactc); the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus haemolyticus is shown in SEQ ID NO:11 (gtccttcaatttgtgtgaactg) and SEQ ID NO:12 (gaagcaagaattgttaaaaaacg). When the primer group comprises two primers, a primer pair for specifically amplifying staphylococcus aureus and a primer pair for specifically amplifying staphylococcus aureus are preferably included, when the primer group comprises three primers, a primer pair for specifically amplifying staphylococcus aureus and a primer pair for specifically amplifying staphylococcus epidermidis are preferably included, and when the primers comprise four primer pairs, a primer pair for specifically amplifying staphylococcus aureus, a primer pair for specifically amplifying staphylococcus epidermidis, a primer pair for specifically amplifying staphylococcus hominis are preferably included. When the primers comprise 5 pairs of primer pairs, the primer pairs for specifically amplifying staphylococcus aureus, the primer pair for specifically amplifying staphylococcus wowensis, the primer pair for specifically amplifying staphylococcus epidermidis, the primer pair for specifically amplifying staphylococcus hominis and the primer pair for specifically amplifying staphylococcus haemolyticus are preferably included.
The source of each sequence of the primer set is not particularly limited in the present invention, and a primer synthesis method well known in the art may be used. In the examples of the present invention, each primer in the primer set was synthesized by committee of bio-engineering (shanghai) incorporated.
The invention provides a DNA bar code for identifying various staphylococci based on pheS gene, which comprises one or more of the following DNA bar codes: a DNA barcode of Staphylococcus aureus, a DNA barcode of Staphylococcus wovensis, a DNA barcode of Staphylococcus epidermidis, a DNA barcode of Staphylococcus human, a DNA barcode of Staphylococcus capitis, and a DNA barcode of Staphylococcus haemolyticus. The nucleotide sequence of the DNA barcode of the staphylococcus aureus is shown as SEQ ID NO. 13 (ctgaacaacaaacaatgtcagagttaaaacaacaagcgcttgtagatattaatgaagcaaatgatgaacgtgcactgcaagaagttaaagtgaaatacttaggtaaaaaagggtcagttagcggactaatgaaattgatgaagggtttgccgaatgaagataaacctgcgtttggtcaaaaagtgaatgaattgcgtcaaacaattcaaaatgaattagatgaaagacaacagatgttagttaaagaaaaattaaataagcaattggctgaagaaacaattgatgtatcattaccaggtcgtcatattgaaatcggttcaaagcatccattaacacgtacaatagaagaaattgaagacttattcttaggtttaggttatgaaattgtgaatggatatgaagttgaacaagatcattataacttcgaaatgctg), and the DNA barcode is obtained by amplifying primers shown as SEQ ID NO. 1 and SEQ ID NO. 2, and the fragment length is 434 bp.
The nucleotide sequence of the DNA barcode of the staphylococcus wowensis is shown as SEQ ID NO. 14 (ccattgttaatacgttaggatgcaccattcctgcacctaaaatctcaatccaaccggtatgtttacacacattacaaccttggcctttacatttaaagcatgaaacatccacttctacagatggttcagtgaatgggaaataacttggacgtagacgaatttctctatctgcaccgaacaattctttagctaataattctaatgtaccttttaaatcactcatcttaatatttttatctacaactaaaccttcaatttgtgtaaattgatgactatgcgtcgcatcatctgaatcacgacgatatactttacctggacaaataattttcactggaccttgtccattacgttgttccaacgtacgtgcttgtactggagacgtatgtgttctcattaaagtctcttcagtaatataaaaactatcttgcatatcacgtgcaggatgtgatttaggtaagtttaatgcctcaaaattataatgatcctgttctacttcataaccatcaacaatttcataacctaagcccaagaataaatcttctatctcttcaattgtacgtgtcaatggatgttttgagcctatttctatttggcgactaggtaatgtcacatcaattgtttcttctgcaagttgttgatttaacttttcattggctaaaatcgtttgtctttcatc), the nucleotide sequence is obtained by amplifying primers shown as SEQ ID NO. 3 and SEQ ID NO. 4, and the fragment length is 676 bp.
The nucleotide sequence of the DNA bar code of the staphylococcus epidermidis is shown as SEQ ID NO. 15 (tgatctaatgtctgagttgaagcaacaagctttagtggatataaacgaagcaaaagatgcgcaagcgttacaagaagtaaaagtgaaatatttaggtaaaaaaggttctgttagcggcttaatgaaaaatatgaaagatttgcctaatgaagacaaacctgcgtatggtcaaaaggtaaatgaattaagacaaactattcaaagtgaattagatgaaagacaaaagctaatcaaagaagagaaattaaatcaacagctttctgaagaaacaattgatgtcacattgccaagtcgtcatattgaaattggatcaaaacatcctttaacacgtacagttgaagagattgaagacttgttcttagggttaggttatgaaattgttgatggttatgaagttgaacaagattactataattttgaagctttaaacttacctaaatcgcatccagcacgtgatatgcaagatagcttttatatcacagaagaaattttaatgcgtacacatacttcaccagtacaagcacgtactatggaaaaacgtaaaggacaaggaccagtcaaaattatttgtcccggtaaagtttatcgacgtgactcagatgatgcaacacatagccaccaatttacacaaattgaaggtttagtagttgataaagatattaaaatgagcgatttaaaagggactttagagttagttgcaaaaaaattattcggtgcagatcgtgagattcgtttacgcccaagttatttcccgtttactgaaccatcagttgaagtagatgtatcatgtttcaaatgtaaaggacagggttgtaatgtttgtaaacatacaggttggattgaaattttaggagcgggcatggttcacccgaatgtattagaaatggccggattcgattctaaggaatattctggcttcgcatttggtatgggaccagatcgaattgcaatgttaaagtatggtattgaagatattcgtcacttttataccaatgatgtccgtt), the DNA bar code is obtained by amplifying primers shown as SEQ ID NO. 5 and SEQ ID NO. 6, and the length of the fragment is 1004 bp.
The nucleotide sequence of the DNA barcode of the human staphylococcus is shown as SEQ ID NO. 16 (cgaatgtcttcgattccgtattttaacattgctatacgatctggccccataccaaatgcaaagccagaatattcatttgaatcaaaaccggccatttctagaacattaggatgtaccatacctgcacctaagatttcaatccatccagtatgtttacatacattacatcctttacctttacatttgaaacaagagacatctacttccactgatggctctgtgaatgggaaataacttggtcgtaatcgaatctcacgatcagccccaaataattttttagctactaactctaacgttcctttcaaatcactcattttaatatgtttatctactactaaaccttcaatttgtgtaaattgatgactatgtgtagcatcatctgaatctcgtcgatacactttcccaggacaaataatttttactggtccttgaccgtgacgtttttccattgtacgtgcttgcactggagacgtgtgcgtacgcatcaaaatctcatctgtaatataaaaactatcttgcatatctcgggctggatgtgatttaggaagatttaaagcttcaaaattataataatcttgttctacttcgtatccgtcaacaatttcatatcctaatcctaggaataaatcttcaatttcttcaactgttctagttaatggatgttttgagccaatattaatttgacgactaggtaatgtaacatcaattgtttcctcagcaagttgttggtttaacttttcattttttaataattcttgtttttcttcaagttcattttgaattgcttgtcttaattcatttactttttgtccataagctggcttttcttcatttggtaaatctttcatatttttcattaaaccacttacagagcctttttttcctagatactttactttgacatcttgtaaagcacgttcatcttgcgcttcgttaatgtc), and the DNA barcode is obtained by amplifying primers shown as SEQ ID NO. 7 and SEQ ID NO. 8, and the fragment length is 941 bp.
The nucleotide sequence of the DNA barcode of the staphylococcus capitis is shown as SEQ ID NO:17 (gccatttcaagaacgtttggatgtaccataccagcacctaaaatttcaatccaacctgtgtgtttgcagacattacaaccctctcctttacatttgaaacaagacacatctacttcaactgatggttctgtgaaagggaaataacttggacgcagacgtatttcacgatccgccccgaataactttttggctaataattctaaagtacctttcaaatcactcattttaatatttttatcaacaactaaaccttcaatttgtgtaaattgatgactatgtgtcgcatcatctgagtctcgacggtacactttacctggacatattattttaacggggccctgtccaccacgtttctccattgttcgagcctgaactggtgacgtatgtgtacgcattagtatttcttcagtaatatagaaactatcttgcatatctcgggcaggatgtgacttaggtaaatttaaagcttcaaaattataataatcctgttcaacctcataaccatctacaatttcataacctaatccaaggaataaatcctcaatttcttcaactgtacgagtaagaggatgctttgaacc), and the DNA barcode is obtained by amplifying primers shown as SEQ ID NO:9 and SEQ ID NO:10, and the fragment length is 581 bp.
The nucleotide sequence of the DNA barcode of the staphylococcus haemolyticus is shown as SEQ ID NO 18 (gtccttcaatttgtgtgaactggtgactatgtgtcgcatcatctgaatcacggcgataaactttaccaggacaaataattttaactggtccttgtccattgcgtttttccattgtgcgtgcttgtactggagatgtgtgtgtacgcattaagatttcatcagtaatataaaaactatcttgcatatcacgtgcaggatgggatttaggtaaatttaaagcttcaaagttataataatcttgttctacttcatagccatcaacaatttcgtaacctagacctaagaataaatcttcaatttcttcaactgttcgtgttaaaggatgtttagaacctatactaatttgtcgacttggcaatgttacatcgattgtttcttctgctaattgttgatttaatttttcgttttttaacaattcttgcttc), and the DNA barcode is obtained by amplifying primers shown as SEQ ID NO 11 and SEQ ID NO 12, and the fragment length is 425 bp.
The invention provides a detection kit for identifying multiple staphylococci based on pheS genes, which comprises a primer group. The detection kit preferably further comprises 10 XTaq buffer, Taq DNA Polymerase, dNTPs and the DNA barcode. The preparation method of the kit is not particularly limited, and the preparation method of the detection kit known in the art can be adopted.
The invention provides application of the primer group, the detection kit or the DNA bar code in preparation of a reagent or a kit for identifying staphylococcus. The staphylococcus preferably comprises staphylococcus aureus, staphylococcus wadskii, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and/or staphylococcus haemolyticus.
In the present invention, the primer set is used for amplifying staphylococcus species. The 6 DNA barcodes can be used as positive reference substances for identifying 6 specific strains of staphylococcus. Other reagents in the detection kit are used for PCR amplification of staphylococcus.
The invention provides a method for rapidly identifying a plurality of staphylococci in an environment, which comprises the following steps:
1) cracking collected environmental bacteria, performing solid-liquid separation on the obtained cracking liquid, and collecting supernatant;
2) taking the supernatant in the step 1) as a template, and carrying out PCR amplification by using the primer group to obtain a PCR product;
3) and (3) carrying out fragment analysis on the PCR product of the step 2).
The invention carries out cracking on the collected environmental bacteria, carries out solid-liquid separation on the obtained cracking liquid, and collects the supernatant.
In the present invention, the method for collecting environmental bacteria preferably uses a swab to sample bacteria at different locations in the environment; the sampling area is preferably 20-30 cm2More preferably 25 cm2. The environment includes indoor desktops, glass, refrigerators, air conditioners, televisions, and printers. The solution of the collected environmental bacteria is preferably a bacterial lysate. The lysis method preferably comprises collecting the collected environmental bacteria with lysis solution, shaking, mixing, standing for 5min to lyse cells, and centrifuging. The method of solid-liquid separation is preferably centrifugation. The rotation speed of the centrifugation is preferably 3000-5000 rpm, and more preferably 4000 rpm. The time for centrifugation is preferably 2-5 min, and more preferably 3 min. The concentration of one single bacterium in the collected environmental bacteria is preferably not less than 1 × 104 CFU/ml。
After the supernatant is obtained, the invention takes the supernatant as a template and uses the primer group to carry out PCR amplification to obtain a PCR product.
In the invention, the reaction system for PCR amplification is preferably 10 xTaq buffer 2 μ l, Taq DNA Polymerase 0.3 μ l, 2.5 mM dNTPs 1.6 μ l, 10 μ M upstream primer 0.4 μ l, 10 μ M downstream primer 0.4 μ l, template 2 μ l, ddH2And O is supplemented to 20 mu l. The reaction procedure of the PCR amplification is preferably 95 ℃ for 5 min; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 90 s, 35 cycles. The PCR amplification apparatus of the present invention is not particularly limited, and any PCR amplification apparatus known in the art may be used.
After PCR amplification is obtained, the PCR product is subjected to fragment analysis.
In the present invention, the method of fragment analysis preferably comprises agarose gel electrophoresis or sequencing. When the agarose gel electrophoresis is adopted for fragment analysis, obtaining an electrophoresis picture, and judging the type of staphylococcus contained in the collected sample according to the position of each amplification band in the electrophoresis picture: the length of the amplified fragment of the staphylococcus aureus is 434 bp; the length of the amplified fragment of the staphylococcus haemolyticus is 425 bp; the length of the amplified fragment of the human staphylococcus is 941 bp; the length of the amplified fragment of the staphylococcus volvaceae is 676 bp; the length of the amplified fragment of the staphylococcus capitis is 581bp and/or the length of the amplified fragment of the staphylococcus epidermidis is 1004 bp. When a fragment having a corresponding length is obtained by amplification with reference to the length of the amplified band, the presence of a corresponding type of staphylococcus in the environment can be determined. When the sequencing is adopted for fragment analysis, the sequencing result is compared with the DNA bar codes of all the staphylococci, and the sample with the consistent comparison result is judged to be the staphylococci corresponding to the DNA bar codes in the environment.
The primers, the detection kit and the application thereof for identifying various staphylococci based on pheS gene provided by the present invention will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.
Example 1
The design method of 6 staphylococcus specific primers comprises the following specific steps:
A. downloading pheS gene sequences of staphylococcus aureus, staphylococcus wowensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and staphylococcus haemolyticus from a genebank;
B. comparing the gene sequences, searching for different sequences, and designing specific primers respectively aiming at 6 staphylococci, wherein the primer sequences are shown in Table 1.
Example 2
Staphylococcus primer specificity detection
A. The method comprises the steps of utilizing designed 6 staphylococcus primers, taking staphylococcus species corresponding to the primers as positive control, taking negative control as lysate, cracking bacteria cultured overnight by staphylococcus aureus, staphylococcus wowensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis, staphylococcus haemolyticus, bacillus, pantoea, micrococcus and pseudomonas by the lysate, taking supernate, and respectively taking supernate of different bacteria as templates for PCR amplification.
Table 2 shows the number of the strain samples used in agarose gel electrophoresis
| Numbering | Sample (I) |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | |
| 6 | |
| 7 | |
| 8 | |
| 9 | |
| 10 | |
| 11 | Pseudomonas sp |
B. Detecting the PCR product by agarose gel electrophoresis; the PCR amplification method is as follows:
reaction system of PCR amplification:
10× Taq buffer 2 µl
Taq DNA Polymerase 0.3 µl
2.5mM dNTPs 1.6 µl
primer pair (one pair) of 0.4 mul/0.4 mul
ddH2And O is supplemented to 20 mu l.
Reaction procedure for PCR amplification: 5min at 95 ℃; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 90 s, 35 cycles.
C. The results of agarose gel electrophoresis are shown in FIG. 2.
As can be seen from FIG. 2, different staphylococcal primers can only amplify corresponding staphylococci, indicating that the designed primers have good specificity.
Example 3
The staphylococcus sensitivity detection method comprises the following specific steps:
A. culturing Staphylococcus aureus, Staphylococcus wovensis, Staphylococcus epidermidis, Staphylococcus hominis and Staphylococcus hemolyticus overnight, and counting by plate to obtain Staphylococcus aureus (4.95 × 10)9 CFU/ml), Staphylococcus wovensis (3X 10)9 CFU/ml), Staphylococcus epidermidis (4.5X 10)9 CFU/ml), human staphylococci (1X 10)9 CFU/ml), Staphylococcus haemolyticus (2.7X 10)9 CFU/ml). It is diluted by 10 times of gradient, the dilution degree is 10 respectively0、10-1、10-2、10-3、10-4、10-5、10-6。
B. The bacterial liquids with different concentrations were used as templates, and primers designed in example 2 for specific amplification of staphylococcus aureus, staphylococcus wowensis, staphylococcus epidermidis, staphylococcus hominis and staphylococcus haemolyticus were used to perform PCR amplification on the corresponding strains, respectively, with the negative control being lysate (N).
C. And carrying out agarose gel electrophoresis detection on the PCR product.
The results of agarose gel electrophoresis are shown in FIG. 3. As can be seen from FIG. 3, the detection sensitivity of the detection system for detecting Staphylococcus wowensonii reaches 3X 103 CFU/ml, the detection sensitivity for detecting staphylococcus epidermidis reaches 4.5 multiplied by 102 CFU/ml, the detection sensitivity for detecting the human staphylococcus reaches 1 multiplied by 104 CFU/ml, the detection sensitivity for detecting staphylococcus aureus reaches 4.95 multiplied by 102 CFU/ml, detection of Staphylococcus haemolyticus 2.7X 102 CFU/ml。
Example 4
The method comprises the following specific steps of simulating environment sampling and identifying the species of staphylococcus:
A. culturing staphylococcus aureus, staphylococcus wowensis, staphylococcus epidermidis, staphylococcus hominis, staphylococcus capitis and staphylococcus haemolyticus overnight in a shaking way, randomly selecting bacterial liquids of different bacteria, uniformly mixing, preparing 6 groups of mixed bacteria, respectively numbering 1-6, wherein No. 1 is the mixed bacteria of the staphylococcus aureus, staphylococcus wowensis, the capitis staphylococcus and the staphylococcus haemolyticus (the number ratio of all the bacteria is 1:1:1:1, and the total bacterial concentration is 2 multiplied by 10)9CFU/ml); staphylococcus aureus and Staphylococcus hemolyticus 2 (the number ratio of the bacteria is 1:1, and the total bacteria concentration is 2 × 10)9CFU/ml); no. 3 is mixed bacteria of Staphylococcus aureus, Staphylococcus wovensis, Staphylococcus epidermidis and Staphylococcus hominis (the number ratio of each bacteria is 1:1:1:1, the total bacteria concentration is 2 × 109CFU/ml); no. 4 is a mixed strain of Staphylococcus aureus, Staphylococcus capitis, and Staphylococcus haemolyticus (the number ratio of each strain is 1:1:1, and the total strain concentration is 2 × 109CFU/ml); no. 5 is staphylococcus Woensis, staphylococcus epidermidis and staphylococcus hominisAnd mixed bacteria of Staphylococcus capitis (number ratio of each bacteria is 1:1:1:1, total bacteria concentration is 2 × 109CFU/ml); no. 6 is mixed bacteria of Staphylococcus epidermidis, Staphylococcus hominis and Staphylococcus capitis (the number ratio of each bacteria is 1:1:1, the total bacteria concentration is 2 × 109CFU/ml）。
B. Respectively taking 100 mul from 6 groups of mixed bacteria liquid, and respectively and uniformly smearing the 100 mul to 5 multiplied by 5cm2The table top, the glass, the refrigerator, the air conditioner, the television and the printer are dried and then sampled by a swab (the sampling solution is lysate).
C. The collected samples were used as templates, and 6 specific primers designed in example 2 were used for PCR amplification, the PCR amplification method being as described in example 2, wherein the positive control was a fragment obtained by amplifying staphylococci corresponding to 6 specific amplification primer pairs (labeled as P1, P2, P3, P4, P5 and P6), and the negative control was lysate (N).
D. And carrying out agarose gel electrophoresis detection on each PCR product.
The results of agarose gel electrophoresis are shown in FIG. 4. As can be seen in FIG. 4, the method provided by the present invention can be used to detect bacteria sampled at different locations in an environment, thereby identifying the presence or absence of one or more of Staphylococcus aureus, Staphylococcus wovensis, Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus capitis, and Staphylococcus haemolyticus in the environment.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Zhi Shi Intelligent technology (Beijing) Co Ltd
To Microbiology Intelligent Technology (Xiamen) Co., Ltd.
<120> primer and detection kit for identifying multiple staphylococci based on pheS gene and application thereof
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctgaacaaca aacaatgtca gag 23
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cagcatttcg aagttataat gatc 24
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccattgttaa tacgttagga tgc 23
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gatgaaagac aaacgatttt agc 23
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgatctaatg tctgagttga agc 23
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aacggacatc attggtataa aag 23
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cgaatgtctt cgattccg 18
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gacattaacg aagcgcaag 19
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gccatttcaa gaacgtttg 19
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggttcaaagc atcctcttac tc 22
<210> 11
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gtccttcaat ttgtgtgaac tg 22
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gaagcaagaa ttgttaaaaa acg 23
<210> 13
<211> 434
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ctgaacaaca aacaatgtca gagttaaaac aacaagcgct tgtagatatt aatgaagcaa 60
atgatgaacg tgcactgcaa gaagttaaag tgaaatactt aggtaaaaaa gggtcagtta 120
gcggactaat gaaattgatg aagggtttgc cgaatgaaga taaacctgcg tttggtcaaa 180
aagtgaatga attgcgtcaa acaattcaaa atgaattaga tgaaagacaa cagatgttag 240
ttaaagaaaa attaaataag caattggctg aagaaacaat tgatgtatca ttaccaggtc 300
gtcatattga aatcggttca aagcatccat taacacgtac aatagaagaa attgaagact 360
tattcttagg tttaggttat gaaattgtga atggatatga agttgaacaa gatcattata 420
acttcgaaat gctg 434
<210> 14
<211> 676
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ccattgttaa tacgttagga tgcaccattc ctgcacctaa aatctcaatc caaccggtat 60
gtttacacac attacaacct tggcctttac atttaaagca tgaaacatcc acttctacag 120
atggttcagt gaatgggaaa taacttggac gtagacgaat ttctctatct gcaccgaaca 180
attctttagc taataattct aatgtacctt ttaaatcact catcttaata tttttatcta 240
caactaaacc ttcaatttgt gtaaattgat gactatgcgt cgcatcatct gaatcacgac 300
gatatacttt acctggacaa ataattttca ctggaccttg tccattacgt tgttccaacg 360
tacgtgcttg tactggagac gtatgtgttc tcattaaagt ctcttcagta atataaaaac 420
tatcttgcat atcacgtgca ggatgtgatt taggtaagtt taatgcctca aaattataat 480
gatcctgttc tacttcataa ccatcaacaa tttcataacc taagcccaag aataaatctt 540
ctatctcttc aattgtacgt gtcaatggat gttttgagcc tatttctatt tggcgactag 600
gtaatgtcac atcaattgtt tcttctgcaa gttgttgatt taacttttca ttggctaaaa 660
tcgtttgtct ttcatc 676
<210> 15
<211> 1004
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tgatctaatg tctgagttga agcaacaagc tttagtggat ataaacgaag caaaagatgc 60
gcaagcgtta caagaagtaa aagtgaaata tttaggtaaa aaaggttctg ttagcggctt 120
aatgaaaaat atgaaagatt tgcctaatga agacaaacct gcgtatggtc aaaaggtaaa 180
tgaattaaga caaactattc aaagtgaatt agatgaaaga caaaagctaa tcaaagaaga 240
gaaattaaat caacagcttt ctgaagaaac aattgatgtc acattgccaa gtcgtcatat 300
tgaaattgga tcaaaacatc ctttaacacg tacagttgaa gagattgaag acttgttctt 360
agggttaggt tatgaaattg ttgatggtta tgaagttgaa caagattact ataattttga 420
agctttaaac ttacctaaat cgcatccagc acgtgatatg caagatagct tttatatcac 480
agaagaaatt ttaatgcgta cacatacttc accagtacaa gcacgtacta tggaaaaacg 540
taaaggacaa ggaccagtca aaattatttg tcccggtaaa gtttatcgac gtgactcaga 600
tgatgcaaca catagccacc aatttacaca aattgaaggt ttagtagttg ataaagatat 660
taaaatgagc gatttaaaag ggactttaga gttagttgca aaaaaattat tcggtgcaga 720
tcgtgagatt cgtttacgcc caagttattt cccgtttact gaaccatcag ttgaagtaga 780
tgtatcatgt ttcaaatgta aaggacaggg ttgtaatgtt tgtaaacata caggttggat 840
tgaaatttta ggagcgggca tggttcaccc gaatgtatta gaaatggccg gattcgattc 900
taaggaatat tctggcttcg catttggtat gggaccagat cgaattgcaa tgttaaagta 960
tggtattgaa gatattcgtc acttttatac caatgatgtc cgtt 1004
<210> 16
<211> 941
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgaatgtctt cgattccgta ttttaacatt gctatacgat ctggccccat accaaatgca 60
aagccagaat attcatttga atcaaaaccg gccatttcta gaacattagg atgtaccata 120
cctgcaccta agatttcaat ccatccagta tgtttacata cattacatcc tttaccttta 180
catttgaaac aagagacatc tacttccact gatggctctg tgaatgggaa ataacttggt 240
cgtaatcgaa tctcacgatc agccccaaat aattttttag ctactaactc taacgttcct 300
ttcaaatcac tcattttaat atgtttatct actactaaac cttcaatttg tgtaaattga 360
tgactatgtg tagcatcatc tgaatctcgt cgatacactt tcccaggaca aataattttt 420
actggtcctt gaccgtgacg tttttccatt gtacgtgctt gcactggaga cgtgtgcgta 480
cgcatcaaaa tctcatctgt aatataaaaa ctatcttgca tatctcgggc tggatgtgat 540
ttaggaagat ttaaagcttc aaaattataa taatcttgtt ctacttcgta tccgtcaaca 600
atttcatatc ctaatcctag gaataaatct tcaatttctt caactgttct agttaatgga 660
tgttttgagc caatattaat ttgacgacta ggtaatgtaa catcaattgt ttcctcagca 720
agttgttggt ttaacttttc attttttaat aattcttgtt tttcttcaag ttcattttga 780
attgcttgtc ttaattcatt tactttttgt ccataagctg gcttttcttc atttggtaaa 840
tctttcatat ttttcattaa accacttaca gagccttttt ttcctagata ctttactttg 900
acatcttgta aagcacgttc atcttgcgct tcgttaatgt c 941
<210> 17
<211> 581
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gccatttcaa gaacgtttgg atgtaccata ccagcaccta aaatttcaat ccaacctgtg 60
tgtttgcaga cattacaacc ctctccttta catttgaaac aagacacatc tacttcaact 120
gatggttctg tgaaagggaa ataacttgga cgcagacgta tttcacgatc cgccccgaat 180
aactttttgg ctaataattc taaagtacct ttcaaatcac tcattttaat atttttatca 240
acaactaaac cttcaatttg tgtaaattga tgactatgtg tcgcatcatc tgagtctcga 300
cggtacactt tacctggaca tattatttta acggggccct gtccaccacg tttctccatt 360
gttcgagcct gaactggtga cgtatgtgta cgcattagta tttcttcagt aatatagaaa 420
ctatcttgca tatctcgggc aggatgtgac ttaggtaaat ttaaagcttc aaaattataa 480
taatcctgtt caacctcata accatctaca atttcataac ctaatccaag gaataaatcc 540
tcaatttctt caactgtacg agtaagagga tgctttgaac c 581
<210> 18
<211> 425
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gtccttcaat ttgtgtgaac tggtgactat gtgtcgcatc atctgaatca cggcgataaa 60
ctttaccagg acaaataatt ttaactggtc cttgtccatt gcgtttttcc attgtgcgtg 120
cttgtactgg agatgtgtgt gtacgcatta agatttcatc agtaatataa aaactatctt 180
gcatatcacg tgcaggatgg gatttaggta aatttaaagc ttcaaagtta taataatctt 240
gttctacttc atagccatca acaatttcgt aacctagacc taagaataaa tcttcaattt 300
cttcaactgt tcgtgttaaa ggatgtttag aacctatact aatttgtcga cttggcaatg 360
ttacatcgat tgtttcttct gctaattgtt gatttaattt ttcgtttttt aacaattctt 420
gcttc 425
Claims (10)
1. A primer group for identifying multiple staphylococci based on pheS gene is characterized by comprising the following 6 pairs of primer pairs: a primer pair for specifically amplifying staphylococcus aureus, a primer pair for specifically amplifying staphylococcus wowensis, a primer pair for specifically amplifying staphylococcus epidermidis, a primer pair for specifically amplifying human staphylococcus, a primer pair for specifically amplifying staphylococcus capitis and a primer pair for specifically amplifying staphylococcus haemolyticus;
the nucleotide sequence of the primer pair for specifically amplifying staphylococcus aureus is shown as SEQ ID NO 1 and SEQ ID NO:2 is shown in the specification;
the nucleotide sequence of the primer pair of the specific amplification staphylococcus wowensis is shown as SEQ ID NO:3 and SEQ ID NO:4 is shown in the specification;
the nucleotide sequence of the primer pair for specifically amplifying staphylococcus epidermidis is shown as SEQ ID NO:5 and SEQ ID NO:6 is shown in the specification;
the nucleotide sequence of the primer pair for specifically amplifying the human staphylococcus is shown as SEQ ID NO:7 and SEQ ID NO:8 is shown in the specification;
the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus caput is shown as SEQ ID NO 9 and SEQ ID NO:10 is shown in the figure;
the nucleotide sequence of the primer pair for specifically amplifying the staphylococcus haemolyticus is shown in SEQ ID NO:11 and SEQ ID NO: shown at 12.
2. A group of DNA barcodes for identifying multiple staphylococci based on pheS genes is characterized by consisting of the following six DNA barcodes: a DNA barcode of Staphylococcus aureus, a DNA barcode of Staphylococcus wovensis, a DNA barcode of Staphylococcus epidermidis, a DNA barcode of Staphylococcus hominis, a DNA barcode of Staphylococcus capitis, and a DNA barcode of Staphylococcus haemolyticus;
the nucleotide sequence of the DNA bar code of the staphylococcus aureus is shown as SEQ ID NO. 13;
the nucleotide sequence of the DNA bar code of the staphylococcus Woensis is shown as SEQ ID NO. 14;
the nucleotide sequence of the DNA bar code of the staphylococcus epidermidis is shown as SEQ ID NO. 15;
the nucleotide sequence of the DNA bar code of the human staphylococcus is shown as SEQ ID NO. 16;
the nucleotide sequence of the DNA bar code of the staphylococcus capitis is shown as SEQ ID NO. 17;
the nucleotide sequence of the DNA barcode of the staphylococcus haemolyticus is shown as SEQ ID NO 18.
3. A detection kit for identifying multiple staphylococci based on pheS gene, comprising the primer set according to claim 1.
4. The assay kit of claim 3, further comprising 10 XTaq buffer, Taq DNA Polymerase, dNTPs and the DNA barcode of claim 2.
5. Use of the primer set of claim 1, the DNA barcode of claim 2, or the detection kit of claim 3 or 4 for the preparation of a reagent or kit for identifying staphylococci.
6. The use of claim 5, wherein said staphylococci comprise Staphylococcus aureus, Staphylococcus wovensis, Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus capitis, and Staphylococcus haemolyticus.
7. A method for rapidly identifying a plurality of staphylococci in an environment, comprising the steps of:
1) cracking collected environmental bacteria, performing solid-liquid separation on the obtained cracking liquid, and collecting supernatant;
2) performing PCR amplification by using the supernatant obtained in the step 1) as a template and using the primer group in claim 1 to obtain a PCR product;
3) carrying out fragment analysis on the PCR product obtained in the step 2) to obtain a sample of the following amplified fragment, wherein the sample of the following amplified fragment contains staphylococcus of a corresponding species;
the length of the amplified fragment of the staphylococcus aureus is 434 bp;
the length of the amplified fragment of the staphylococcus haemolyticus is 425 bp;
the length of the amplified fragment of the human staphylococcus is 941 bp;
the length of the amplified fragment of the staphylococcus volvaceae is 676 bp;
the length of the amplified fragment of the staphylococcus capitis is 581 bp;
and the length of the amplified fragment of staphylococcus epidermidis is 1004 bp.
8. The method for rapidly identifying multiple staphylococci in the environment according to claim 7, wherein the reaction system for PCR amplification in the step 2) is 10 xTaq buffer 2 μ l, Taq DNA Polymerase 0.3 μ l, 2.5 mM dNTPs 1.6 μ l, 10 μ M upstream primer 0.4 μ l, 10 μ M downstream primer 0.4 μ l, template 2 μ l, ddH2And O is supplemented to 20 mu l.
9. The method for rapidly identifying multiple staphylococci in the environment according to claim 7, wherein the reaction procedure of the PCR amplification in the step 2) is 95 ℃ for 5 min; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 90 s, 35 cycles.
10. The method for rapidly identifying multiple staphylococci in the environment according to any one of claims 7-9, wherein the concentration of a single bacterial species in the environmental bacteria collected in step 1) is not less than 1 x 104 CFU/ml。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110536972.2A CN112980982B (en) | 2021-05-18 | 2021-05-18 | Primers and detection kit for identifying multiple staphylococci based on pheS gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110536972.2A CN112980982B (en) | 2021-05-18 | 2021-05-18 | Primers and detection kit for identifying multiple staphylococci based on pheS gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112980982A CN112980982A (en) | 2021-06-18 |
| CN112980982B true CN112980982B (en) | 2021-08-10 |
Family
ID=76336655
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110536972.2A Active CN112980982B (en) | 2021-05-18 | 2021-05-18 | Primers and detection kit for identifying multiple staphylococci based on pheS gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112980982B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113444824B (en) * | 2021-08-30 | 2021-11-19 | 至善时代智能科技(北京)有限公司 | Primer for identifying 4 staphylococci in environment based on isothermal amplification technology, detection kit and application |
| CN115161333B (en) * | 2022-06-23 | 2023-08-25 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Reverse screening marker of streptococcus suis, streptococcus suis containing reverse screening marker and application of streptococcus suis |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020055101A1 (en) * | 1995-09-11 | 2002-05-09 | Michel G. Bergeron | Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories |
| CN110157821B (en) * | 2019-05-06 | 2020-08-28 | 浙江大学 | Kit for detecting human staphylococcus |
| CN110079586B (en) * | 2019-05-06 | 2020-10-30 | 浙江大学 | Kit for detecting staphylococcus aureus |
-
2021
- 2021-05-18 CN CN202110536972.2A patent/CN112980982B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112980982A (en) | 2021-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112980982B (en) | Primers and detection kit for identifying multiple staphylococci based on pheS gene and application thereof | |
| US7718402B2 (en) | Biological reagents and methods to verify the efficiency of sample preparation and nucleic acid amplification and/or detection | |
| JPH11503921A (en) | Universal target for species identification | |
| Genc et al. | Evaluation of MALDI-TOF MS for identification of nontuberculous mycobacteria isolated from clinical specimens in mycobacteria growth indicator tube medium | |
| Fujita et al. | Rapid identification of staphylococcal strains from positive-testing blood culture bottles by internal transcribed spacer PCR followed by microchip gel electrophoresis | |
| CN107541509B (en) | LAMP primer combination for detecting 6 infectious pathogens of cow mastitis and application thereof | |
| CN112961930B (en) | Primer group, kit and method for identifying environmental bacteria at genus level | |
| CN112961929B (en) | Primer group, kit and method for staphylococcus in species level identification environment | |
| CN107083443B (en) | Primer combination for PCR detection of Elizabeth meningitis and septica | |
| Eigner et al. | Evaluation of a rapid direct assay for identification of bacteria and the mecA and van genes from positive-testing blood cultures | |
| Sandin | Polymerase chain reaction and other amplification techniques in mycobacteriology | |
| CN113444825A (en) | Primer group, kit and constant-temperature amplification method for species level identification of environmental bacteria | |
| CN112592992A (en) | Primer probe set and kit for combined detection of mycoplasma pneumoniae and chlamydia pneumoniae based on fluorescent RMA method | |
| CN103614486A (en) | Detection kit for vibrio alginnolyficus | |
| CN111057775A (en) | Specific novel molecular target for identifying salmonella and rapid detection method thereof | |
| KR100436741B1 (en) | Genes for detecting bacteria and detection method by using the same | |
| CN1904064B (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
| CN113444824B (en) | Primer for identifying 4 staphylococci in environment based on isothermal amplification technology, detection kit and application | |
| CN108330185A (en) | Double PCR technology detects the primer pair and method of bacillus cereus | |
| Günther et al. | Design and evaluation of an oligonucleotide-microarray for the detection of different species of the genus Kitasatospora | |
| CN113444826B (en) | Primer, probe and kit for identifying micrococcus based on isothermal amplification technology and application of primer, probe and kit | |
| WO1997020071A1 (en) | Detection of bacterium belonging to the genus pectinatus | |
| Korshunov et al. | Comparison of biochemical and molecular genetic approaches for identification of environmental strains | |
| CN111286549A (en) | Specific primer for amplifying bacillus amyloliquefaciens and application thereof | |
| Ming et al. | Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220606 Address after: 361005 room 607, zone B, building 1, torch Huizhi space, No. 178, Xinfeng Road, torch hi tech Zone, Xiamen, Fujian Patentee after: To microbial Intelligent Technology (Xiamen) Co.,Ltd. Address before: 102629 room 409-14, 4th floor, building 1, 38 Yongda Road, Daxing biomedical industrial base, Zhongguancun Science and Technology Park, Daxing District, Beijing Patentee before: Zhishan times Intelligent Technology (Beijing) Co.,Ltd. Patentee before: To microbial Intelligent Technology (Xiamen) Co.,Ltd. |
|
| TR01 | Transfer of patent right |