CN112979804A

CN112979804A - An isolated binding protein comprising a procalcitonin antigen binding domain

Info

Publication number: CN112979804A
Application number: CN201911307723.5A
Authority: CN
Inventors: 崔鹏; 何志强; 孟媛; 钟冬梅; 马秋燕; 游辉; 覃婷
Original assignee: Dongguan Pengzhi Biotechnology Co Ltd
Current assignee: Dongguan Pengzhi Biotechnology Co Ltd
Priority date: 2019-12-18
Filing date: 2019-12-18
Publication date: 2021-06-18
Anticipated expiration: 2039-12-18
Also published as: CN112979804B

Abstract

The present invention relates to an isolated binding protein comprising a Procalcitonin (PCT) antigen binding domain, and studies on the preparation, use, etc. of the binding protein. The binding protein has strong activity and high affinity with human procalcitonin, and can be widely applied to the detection of procalcitonin.

Description

An isolated binding protein comprising a procalcitonin antigen binding domain

Technical Field

The present invention relates to the field of immunological techniques, and in particular, to an isolated binding protein comprising a procalcitonin antigen binding domain.

Background

The Procalcitonin (PCT) coding gene is positioned on the No. 11 human chromosome, consists of 6 exons and 5 introns, has the total length of 7600bp, has the length of 2800bp, is translated into procalcitonin precursors in the rough endoplasmic reticulum of cells beside thyroid follicles after being transcribed, and is further modified and processed under the action of endogenous polypeptide enzyme to generate a final product PCT of 116 amino acids.

PCT is mainly produced under the stimulation of bacterial toxin and inflammatory cell factors, serum PCT is not generally increased under a non-infectious inflammation state, the generation of PCT is very fast in the infectious inflammation process, the PCT is increased within 2-6 hours of an endotoxin stimulation reaction, and the blood PCT of a serious systemic infected person can be up to 1000 times within 24 hours. PCT is widely accepted as a new infectious inflammation marker at present, and not only can early identify whether bacterial infection exists, but also is an early warning and diagnostic index of sepsis. In addition, many studies have found that PCT can be ectopically produced and abnormally elevated levels in addition to severe bacterial infections, fungal and parasitic infections, and in the development of Multiple Organ Dysfunction Syndrome (MODS). PCT concentrations are usually positively correlated with the extent of infection and the correlation is high, and its rise or fall directly reflects the tendency of the disease to worsen or improve, providing a good prognostic indicator. Therefore, the detection of PCT has important reference values in the differential diagnosis, prognosis judgment, curative effect observation, reasonable guidance and application of antibacterial drugs and the like of infectious diseases, sepsis, MODS and the like.

In the early days, the detection of PCT mainly uses a gel chromatography method and a high performance liquid chromatography method, and the two methods are time-consuming, have high operation requirements, are difficult to automate and are expensive. In recent years, PCT is often detected by an immunological method having advantages of high specificity, high sensitivity, and easy handling, and the method includes a double antibody sandwich immunochemical method, a colloidal gold method, a radioimmunoassay, and the like. All immunological methods need to use specific monoclonal antibodies of PCT, the content of PCT in plasma of healthy people is extremely low and is below 0.2ng/mL, so that the requirements on parameters such as the affinity of the prepared antibodies are high, the PCT specific antibodies with good affinity are prepared, key raw materials are provided for immunodetection of PCT, and the method has important significance for expanding the clinical application of PCT and reducing the medical cost.

Disclosure of Invention

In view of the above, the present invention aims to provide an isolated binding protein comprising a Procalcitonin (PCT) antigen binding domain, which has good activity and high affinity, and a preparation method and use thereof.

The present invention provides an isolated binding protein comprising a procalcitonin antigen-binding domain, said antigen-binding domain comprising at least one complementarity determining region of an amino acid sequence; or conservative variants obtained by conservative mutation of one or more amino acid additions, deletions, substitutions or modifications to the following amino acid sequences, said conservative variants having at least 80% sequence identity with the following amino acid sequences:

CDR-VH1 is G-X1-S-X2-T-S-D-Y-X3-W-H, wherein,

x1 is F, V or L, X2 is L, V or I, X3 is S or T;

the CDR-VH2 is Y-X1-D-F-R-G-S-T-X2-Y-N-P-S-X3-X4-S,

x1 is L, V or I, X2 is D, K or N, X3 is I or L, X4 is K or R;

CDR-VH3 is A-X1-R-G-S-X2-D, wherein,

x1 is K or R, X2 is Y, V or F;

the CDR-VL1 is R-S-S-X1-S-X2-H-S-N-G-X3-T-Y-X4-F, wherein,

x1 is R or K, X2 is IL, II, LL or LI, X3 is L, V or I, X4 is I or L;

the complementarity determining region CDR-VL2 is X1-M-X2-N-X3-A-S, wherein,

x1 is N, Q or H, X2 is T or S, X3 is I, V or L;

the CDR-VL3 is A-X1-N-X2-E-X3-P-W-T, wherein,

x1 is Q or N, X2 is I or L, and X3 is L or I.

Further, the present invention provides an isolated binding protein comprising a procalcitonin antigen-binding domain, wherein:

in the complementarity determining region CDR-VH1, X3 is S;

in the complementarity determining region CDR-VH2, X4 is R;

in the complementarity determining region CDR-VH3, X1 is R;

in the complementarity determining region CDR-VL1, X1 is K;

in the complementarity determining region CDR-VL2, X2 is S;

in the complementarity determining region CDR-VL3, X1 is Q;

in some embodiments, in the complementarity determining regions CDR-VH1, X1 is independently selected from F;

in some embodiments, in the complementarity determining regions CDR-VH1, X1 is independently selected from V;

in some embodiments, in the complementarity determining region CDR-VH1, X1 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VH1, X2 is independently selected from L;

in some embodiments, in the complementarity determining regions CDR-VH1, X2 is independently selected from V;

in some embodiments, in the complementarity determining regions CDR-VH1, X2 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VH2, X1 is independently selected from L;

in some embodiments, in the complementarity determining regions CDR-VH2, X1 is independently selected from V;

in some embodiments, in the complementarity determining regions CDR-VH2, X1 is independently selected from I;

in some embodiments, in the complementarity determining regions CDR-VH2, X2 is independently selected from D;

in some embodiments, in the complementarity determining region CDR-VH2, X2 is independently selected from K;

in some embodiments, in the complementarity determining regions CDR-VH2, X2 is independently selected from N;

in some embodiments, in the complementarity determining regions CDR-VH2, X3 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VH2, X3 is independently selected from L;

in some embodiments, in the complementarity determining regions CDR-VH3, X2 is independently selected from Y;

in some embodiments, in the complementarity determining regions CDR-VH3, X2 is independently selected from V;

in some embodiments, in the complementarity determining regions CDR-VH3, X2 is independently selected from F;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is independently selected from IL;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is independently selected from II;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is independently selected from LL;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is independently selected from LI;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is independently selected from V;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VL1, X4 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VL1, X4 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from N;

in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from Q;

in some embodiments, in the complementarity determining region CDR-VL2, X1 is independently selected from H;

in some embodiments, in the complementarity determining region CDR-VL2, X3 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VL2, X3 is independently selected from V;

in some embodiments, in the complementarity determining region CDR-VL2, X3 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from I;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VL3, X3 is independently selected from L;

in some embodiments, in the complementarity determining region CDR-VL3, X3 is independently selected from I.

In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following sequences:

alternatively to this, the first and second parts may,

in the complementarity determining region CDR-VH1, X3 is T;

in the complementarity determining region CDR-VH2, X4 is K;

in the complementarity determining region CDR-VH3, X1 is K;

in the complementarity determining region CDR-VL1, X1 is R;

in the complementarity determining region CDR-VL2, X2 is T;

in the complementarity determining region CDR-VL3, X1 is N;

and the mutation site of each complementarity determining region is selected from any one of the following sequences:

in some embodiments, the binding protein has a K with PCT_D≤8.72×10^-10Affinity of mol/L.

In some embodiments, the binding protein comprises at least 3 CDRs, optionally 3 CDRs from a heavy chain, or 3 CDRs from a light chain.

In some embodiments, the binding protein comprises at least 6 CDRs.

In some embodiments, the binding protein is a monoclonal antibody, a nanobody, a F (ab')₂Fab', Fab, Fv, scFv (sc ═ single chain), diabodies (diabodies), or minimal recognition units of antibodies.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of constant region sequences of one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is derived from a mouse.

In some embodiments, the light chain constant region sequence is set forth in SEQ ID NO 9 and the heavy chain constant region sequence is set forth in SEQ ID NO 10.

In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

In another aspect, the invention also relates to an isolated nucleic acid molecule, which is DNA or RNA, encoding a binding protein as described above.

In another aspect, the invention also relates to a vector comprising a nucleic acid molecule provided by the invention.

In another aspect, the invention also relates to a host cell transformed with a nucleic acid molecule or vector as described above.

In some embodiments, the host cell includes bacterial, eukaryotic, yeast and baculovirus systems.

In some embodiments, the host cell is a eukaryotic cell, further a mammalian cell.

Mammalian cell lines useful for expression in the art include: chinese Hamster Ovary (CHO) cells, HeLa cells, melengus mouse kidney cells, mouse myeloma cells.

In some embodiments, the host cell is a CHO cell.

According to one aspect of the invention, the invention also relates to a method for producing a binding protein as described above, said method comprising the steps of:

culturing the host cell as described above in suitable culture conditions and recovering the binding protein as described above from the culture medium or from the cultured host cell.

In another aspect, the invention also relates to the use of a binding protein as described above for the preparation of a product for the diagnosis of a disease associated with a change in PCT levels.

In some embodiments, the disease associated with a change in PCT levels is an infectious disease, sepsis, Systemic Inflammatory Response Syndrome (SIRS), multiple organ failure syndrome (MODS).

In some embodiments, the infectious disease comprises a bacterial infection, a fungal infection, or a parasitic infection.

In another aspect, the present invention also relates to a method of detecting PCT in a test sample, comprising:

a) contacting PCT antibody in the test sample with a binding protein of the invention under suitable reaction conditions to form an immune complex;

b) detecting the presence of the immune complex.

In the above embodiments, the presence of said immune complex in step b) is indicative of the presence of said PCT antigen in said test sample.

In the above embodiments, the binding protein may be labeled with an indicator showing signal intensity to allow the immune complex to be easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

in this embodiment, the binding protein is in the form of a first antibody that forms a partner antibody with the second antibody for binding to a different epitope of PCT;

the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the PCT antigen;

in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.

Further, another aspect of the present invention relates to a detection reagent or kit comprising the binding protein as described above.

In some embodiments, the reagent or kit further comprises one or more of a pharmaceutically acceptable excipient, buffer, stabilizer, diluent, or carrier.

The separated binding protein provided by the invention has strong activity, can specifically recognize and bind PCT protein, has high affinity, and has better affinity compared with the PCT antibody commonly used in the market at present.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an electrophoretogram of a monoclonal antibody against human PCT in example 1 of the present invention.

Detailed Description

The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Definition of terms

"isolated binding protein comprising an antibody binding domain", "isolated binding protein", "binding protein" broadly refer to any protein or protein fragment comprising at least one complementarity determining region, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies, minimum recognition units for antibodies, antibodies themselves, and single chain derivatives of these antibodies and fragments. "antibody" broadly refers to any antigenic compound binding fragment or protein that includes an antigenic compound binding fragment, including polyclonal antibodies, monoclonal antibodies. The type of antibody may be selected from IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgM, IgD and IgE. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric antibodies, humanized antibodies, and related synthetic isomeric forms. The term "antibody" is used interchangeably with "immunoglobulin".

"monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population in which the individual antibodies contained are identical except for a few naturally occurring mutations that may be present. The modifier "monoclonal" indicates only the identity of the antibody and is obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring any particular method for producing the antibody.

An "antigen-binding portion" (or simply "antibody portion") refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., PCT). Such "fragments" are, for example, between about 8 and about 1500 amino acids, suitably between about 8 and about 745 amino acids, suitably about 8 to about 300 amino acids, for example about 8 to about 200 amino acids, or about 10 to about 50 or 100 amino acids in length. It has been shown that the antigen binding function of an antibody can be performed by fragments of a full-length antibody.

By "variable region" or "variable domain" of an antibody is meant that certain portions of the variable region of the antibody differ in sequence, which results in the binding and specificity of each particular antibody for its particular antigen. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". Variability is concentrated in three segments called Complementarity Determining Regions (CDRs) or hypervariable regions in the light and heavy chain variable regions, i.e. the VL or VH consists of framework regions interrupted by three CDR hypervariable regions. The CDRs are primarily responsible for binding to antigen.

"backbone", "framework" or "FR" refers to highly conserved portions of variable domains. The variable domains of the unmodified heavy and light chains each contain 4 contiguous regions separated by CDRs (FR1, FR2, FR3 and FR 4). The FR regions are the more conserved portions of the variable regions, which mainly adopt a β -sheet configuration interspersed with 3 CDRs that form loops and, in some cases, join the β -sheet structural portions. The CDRs in each chain are held close together by the FRs and, together with the CDRs from the other chains, facilitate the formation of the antigen binding site of the antibody.

Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.

"conservative variants" refers to variants that substantially retain the characteristics of their parent, such as basic immunological biological, structural, regulatory, or biochemical characteristics. Generally, the amino acid sequence of a conservative variant of a polypeptide differs from the parent polypeptide, but the difference is limited so that the sequence with the parent polypeptide is very similar to the conservative variant overall and is identical in many regions. The difference in amino acid sequence between the conservative variant and the parent polypeptide can be, for example: substitutions, additions, and deletions of one or more amino acid residues and any combination thereof. The amino acid residue that is substituted or inserted may or may not be encoded by the genetic code. A conservative variant of a polypeptide may occur naturally, or it may be a non-naturally occurring variant. Non-naturally occurring conservative variants of the polypeptide may be generated by mutagenesis techniques or by direct synthesis.

"purified" or "isolated" means that the protein, polypeptide, or nucleic acid is not in its natural medium or in its natural form. Thus, the term "isolated" refers to a molecule that is substantially free from its natural environment. For example, an isolated protein is substantially free of cellular material or other proteins from the cell or tissue source from which it is derived. The term "isolated" also refers to a formulation wherein the isolated protein is sufficiently pure to be capable of being administered as a pharmaceutical composition, or at least 70-80% (w/w) pure, more preferably at least 80-90% (w/w) pure, even more preferably 90-95% pure, and most preferably at least 95%, 96%, 97%, 98%, 99% or 100% (w/w) pure. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

"affinity" denotes the equilibrium constant for reversible binding of 2 reagents and is denoted as K_D. The affinity of a binding protein for a ligand, such as the affinity of an antibody for an epitope, can be, for example, about 100 nanomolar (nM) to about 0.1nM, about 100nM to about 1 picomolar (pM), or about 100nM to about 1 femtomolar (fM). The term "affinity" as used herein means 2 or more reagentsThe complex of (a) is resistant to dissociation after dilution. Apparent affinity can be determined by methods such as enzyme-linked immunosorbent assay (ELISA) or any other technique familiar to those skilled in the art.

"identity" means that when optimally aligned and compared between two peptides or two nucleic acid molecules, at least about 80% of the nucleotides are identical, typically at least about 90% to 95%, and more preferably at least about 98% to 99.5% of the nucleotides are identical, although appropriate nucleotide insertions or deletions. Alternatively, substantial identity also exists when the fragments hybridize to the complement of the strand under selective hybridization conditions. The percent identity between two sequences is the proportion of sequences in which they are identical in nucleotide or amino acid residue at the same position (i.e.,% identity-the number of identical positions/total number of positions x 100), taking into account the number of gaps that need to be introduced to achieve optimal alignment of the two sequences and the length of each gap. Sequence comparison and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.

Exemplary embodiments of the invention

In some embodiments, the antigen binding domain has at least 80%, 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to the complementarity determining region of an amino acid sequence described below.

In some embodiments, the binding protein has a K with PCT_DThe value is less than or equal to 8.72 multiplied by 10^-10mol/L; or K_DThe value is less than or equal to 8 x 10^-10mol/L; or K_DThe value is less than or equal to 7 x 10^-10mol/L; or K_DThe value is less than or equal to 6 x 10^-10mol/L；K_DValue less than or equal to 5X 10^-10mol/L; or K_D≤4×10^-10mol/L, or K_DThe value is less than or equal to 3X 10^-10mol/L; or K_D≤2×10^-10mol/L, or K_D≤1×10^- ¹⁰mol/L, or K_D≤9×10^-11mol/L, or K_D≤8×10^-11mol/L, or K_D≤7×10^-11mol/L, or K_D≤6×10^- ¹¹mol/L, or K_D≤5×10^-11mol/L, or K_D≤4×10^-11mol/L, or K_D≤3×10^-11mol/L, or K_D≤2×10^- ¹¹mol/L, or KD is less than or equal to 1 x 10^-11mol/L; or 1.04X 10^-11mol/L≤K_D≤8.72×10^-10Affinity of mol/L.

In some embodiments, the binding protein is a "functional fragment" of an antibody, which typically has the same specificity as the antibody from which it is derived. As those skilled in the art can surmise from the description of the present invention and the means of the related art, the antibody fragment of the present invention can be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.

In some embodiments, the framework region sequence is a human framework sequence, such that a humanized antibody is formed.

In some embodiments, the constant region sequences of the present application include heavy chain constant regions, such as a μ chain, δ chain, γ chain, α chain, or ε chain constant regions of an IgG1, IgG2, IgG3, IgG4, IgA, IgE, IgM, or IgD. Light chain constant regions, kappa light chain constant regions or lambda light chain constant regions may also be included.

The constant regions are not directly involved in the binding of antibodies to antigens, but they exhibit different effector functions, such as participation in antibody-dependent cytotoxicity of antibodies.

Alternatively, in another embodiment, the constant region sequence may be substituted for at least one amino acid residue while maintaining the binding protein activity or affinity.

In some embodiments, the constant region sequences of the present application are human sequences to make up a humanized antibody.

In some embodiments, the nucleic acid sequences described herein are operably linked to an expression control sequence in a suitable expression vector and the expression vector is employed to transform a suitable host cell. "operably linked" means that the coding sequence is linked to the regulatory sequences in a manner that allows for expression of the coding sequence. Regulatory sequences are selected to direct the expression of the protein of interest in a suitable host cell, and include, but are not limited to, promoters, enhancers and other expression control elements.

By "host cell" is meant a cell into which a recombinant expression vector has been introduced. It is understood that such terms refer not only to the particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein.

In some embodiments, the nucleic acids of the invention or fragments thereof may be inserted into a suitable vector to form a cloning or expression vector carrying the nucleic acid fragments of the invention. Such novel vectors are also part of the present invention. By "vector" is meant a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. In addition, certain vectors are capable of directing the expression of genes to which they are operatively linked.

The cloning and expression vectors of the invention are capable of autonomous replication and thus provide high copy numbers for high level expression or high level replication purposes for subsequent cloning. The expression vector may comprise a promoter for driving expression of the nucleic acid fragment of the invention, optionally a nucleic acid sequence encoding a signal peptide for secretion or integration of the peptide expression product into a membrane, a nucleic acid fragment of the invention, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector, when introduced into a host cell, may or may not be integrated into the genome of the host cell. Vectors typically carry a replication site, as well as a marker sequence capable of providing phenotypic selection in transformed cells.

In other embodiments, the invention further comprises the step of introducing the vector comprising the nucleic acid into a host cell, which may employ any available technique. For eukaryotic cells, suitable techniques may include, for example, calcium phosphate transfection, DEAE dextran, electroporation, liposome-mediated transfection, and transduction using retroviruses or other viruses (e.g., vaccinia, or for insect cells, baculovirus). For bacterial cells, suitable techniques may include, for example, calcium chloride transformation, electroporation, and transfection using bacteriophages. Preferred host cells of the invention are derived from mammalian cells, such as CHO cells. The transformed cells are capable of replicating the nucleic acid fragments of the invention.

In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.

Many known nucleic acid manipulation techniques and methods, such as preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in: short Protocols in Molecular Biology, 2 nd edition, eds. Ausubel et al, John Wiley & Sons, 1992.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

This example provides an exemplary method for the preparation of procalcitonin antibodies.

S1, constructing an expression plasmid:

restriction enzyme, Prime Star DNA polymerase in this example was purchased from Takara;

the MagExtractor-RNA extraction kit was purchased from TOYOBO;

BD SMART^TMRACE cDNA Amplification Kit was purchased from Takara;

pMD-18T vector was purchased from Takara;

the plasmid extraction kit is purchased from Tiangen corporation;

primer synthesis and gene sequencing were done by Invitrogen;

the Anti-PCT monoclonal antibody is secreted as an existing hybridoma cell strain and is recovered for later use.

Design and synthesis of S11 primer:

5' RACE upstream primers for heavy and light chain amplification:

SMARTER II A Oligonucleotide：

5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；

5'-RACE CDS Primer(5'-CDS)：5’>(T)₂₅VN<3’(N＝A,C,G,orT；V＝A,G,orC)；

Universal Primer A Mix(UPM):

5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’；

Nested Universal Primer A(NUP):

5’>AAGCAGTGGTATCAACGCAGAGT<3’；

mIgG CKR：5’>TTTTCCTTTTGAATTCCTAACACTCATTCCTGTTGAAGC<3’；

mIgG CHR：5’>TTTTCCTTTTGAATTCTCATTTACCAGGAGAGTGGGAGA<3’。

cloning and sequencing of variable region gene of S12 antibody:

extracting RNA from hybridoma cell strain secreting Anti-PCT monoclonal antibody, and extracting with SMARTER^TMRACE cDNA Amplification Kit andSMARTER II A Oligonucleotide and 5' -CDS primer in the kit are used for first strand cDNA synthesis, and the obtained first strand cDNA product is used as PCR amplification template. The Light Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIgG CKR primers, and the Heavy Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIgG CHR primers. The primer pair of Light Chain can amplify target band about 0.75KB, and the primer pair of Heavy Chain can amplify target band about 1.4 KB. The product was purified and recovered by agarose gel electrophoresis, and the product was subjected to A addition reaction with rTaq DNA polymerase, inserted into pMD-18T vector, transformed into DH 5. alpha. competent cells, and after colonies were grown, 4 clones of the Heavy Chain and Light Chain genes were cloned, respectively, and sent to Invitrogen corporation for sequencing.

Sequence analysis of the S13Anti-PCT antibody variable region genes:

putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 336bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the Heavy Chain primer pair, the VH gene sequence is 357bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

Construction of S14 recombinant antibody expression plasmid:

pcDNA^TM 3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody gene in the pMD-18T, the light chain and heavy chain gene specific primers of the Anti-PCT antibody are designed, two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases, and the primers are as follows:

PCT-HF：

5’>CCCAAGCTTGCCACCATGGAATGGAGCTGGGTCTTTC<3’

PCT-HR:

5’>CCCGAATTCTCATTATTTACCAGGAGAGTGGGAGAGGCTCTTCTC<3’

PCT-LF:

5’>CCCAAGCTTGCCACCATGGATTCACAGGCCCAGGTTCTTA<3’

PCT-LR:

5’>CCCGAATTCTCATTAACACTCATTCCTGTTGAAGCTCTTGACAA<3’

a0.74 KB Light Chain gene fragment and a 1.42KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.

S2. Stable cell strain screening

Transient transfection of CHO cell with S21 recombinant antibody expression plasmid and determination of expression plasmid activity

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, the mixture is transferred into an electric rotating cup and is electrically rotated, the sampling counting is carried out on 3 rd, 5 th and 7 th days, and the sampling detection is carried out on 7 th day.

The coating solution diluted the recombinant PCT protein (self-produced, 141220) to the indicated concentration, 100. mu.l per well, overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1 hr, and adding blocking solution (120 μ l per well); adding diluted cell supernatant at 100 μ l/well, 37 deg.C for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu l per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader. The results show that the OD of the reaction after the cell supernatant is diluted 1000 times is still larger than 1.0, and the OD of the reaction without the cell supernatant is smaller than 0.1, which indicates that the antibodies generated after the plasmid is transiently transformed are all active on the recombinant PCT protein.

Linearization of S22 recombinant antibody expression plasmid

The following reagents were prepared: 50 mul Buffer, 100 mul DNA/tube, 10 mul Puv I enzyme, and sterile water to 500 mul, water bath enzyme digestion overnight at 37 ℃; sequentially extracting with equal volume of phenol/chloroform/isoamyl alcohol (lower layer) 25:24:1 and then chloroform (water phase); precipitating with 0.1 volume (water phase) of 3M sodium acetate and 2 volumes of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration.

S23 recombinant antibody expression plasmid stable transfection, pressurized screening of stable cell strain

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, and the mixture is transferred into an electric rotating cup and is electrically rotated, and the next day is counted; 25 u mol/L MSX 96 hole pressure culture about 25 days.

Observing the marked clone holes with cells under a microscope, and recording the confluence degree; taking culture supernatant, and sending the culture supernatant to a sample for detection; selecting cell strains with high antibody concentration and relative concentration, transferring the cell strains into 24 holes, and transferring the cell strains into 6 holes after 3 days; after 3 days, the seeds were kept and cultured in batches, and the cell density was adjusted to 0.5X 10⁶cells/ml, 2.2ml, cell density 0.3X 10⁶cell/ml, 2ml for seed preservation; and (4) 7 days, carrying out batch culture supernatant sample sending detection in 6 holes, and selecting cell strains with small antibody concentration and cell diameter to transfer TPP for seed preservation and passage.

S3. recombinant antibody production

S31 cell expanding culture

After the cells are recovered, the cells are cultured in a shaking flask with the specification of 125ml, the inoculation volume is 30ml, the culture medium is 100% Dynamis culture medium, and the cells are placed in a shaking table with the rotation speed of 120r/min, the temperature of 37 ℃ and the carbon dioxide of 8%. Culturing for 72h, inoculating and expanding culture at an inoculation density of 50 ten thousand cells/ml, wherein the expanding culture volume is calculated according to production requirements, and the culture medium is 100% Dynamis culture medium. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.

S32 shake flask production and purification

Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started when the culture was carried out for 72h in a shake flask, 3% of the initial culture volume was fed daily to HyCloneTM Cell BoostTM Feed 7a, and one thousandth of the initial culture volume was fed daily to Feed 7b, up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13. Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody was subjected to reducing SDS-PAGE, and 4. mu.g of an external control antibody was used as a control, and the electrophoretogram was shown in FIG. 1. Two bands were shown after reducing SDS-PAGE, 1 with 50kD Mr and 28kD Mr (light chain).

Example 2

Antibody affinity analysis and activity identification

The antibody obtained in example 1 was analyzed to have a light chain having a sequence shown in SEQ ID NO. 11 and a heavy chain having a sequence shown in 12. The antibody has certain capacity of combining PCT and better affinity, and in order to further screen an antibody with better affinity, the applicant performs mutation on the light chain CDR and the heavy chain CDR of the antibody.

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-F (X1) -S-V (X2) -T-S-D-Y-T (X3) -W-H;

CDR-VH2 is Y-V (X1) -D-F-R-G-S-T-N (X2) -Y-N-P-S-L (X3) -K (X4) -S;

CDR-VH3 is A-K (X1) -R-G-S-Y (X2) -D;

complementarity determining region (WT) of light chain:

CDR-VL1 is R-S-S-R (X1) -S-IL (X2) -H-S-N-G-V (X3) -T-Y-I (X4) -F;

CDR-VL2 is Q (X1) -M-T (X2) -N-I (X3) -A-S;

CDR-VL3 is A-N (X1) -N-L (X2) -E-I (X3) -P-W-T;

wherein, X1, X2, X3 and X4 are all the sites to be mutated.

TABLE 1 mutant sites associated with antibody Activity

Based on the CDR sequences of WT obtained by the above analysis, the above mutation was performed at the corresponding site in Table 1, and the activity of each antibody after mutation was determined.

Diluting the recombinant PCT protein (self-produced, 141220) to 1 mu g/ml by the coating solution for microplate coating, wherein each well is 100 mu l, and the temperature is 4 ℃ overnight; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1 hr, and adding blocking solution (120 μ l per well); adding diluted PCT monoclonal antibody 100 μ l/well, 37 deg.C, 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu l per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader.

TABLE 2 antibody Activity assay data

From the above table, the antibody activity after mutation is significantly improved, wherein the activity effect of mutation 1 is the best, so that mutation 1 is used as a framework sequence for further mutation and screening, and the affinity thereof is determined, the sites after partial mutation are shown in table 3, and the affinity analysis results of the corresponding binding proteins are shown in table 4.

TABLE 3 mutation sites related to antibody affinity

Affinity assay

Performing enzyme immunoassay in the same manner as activity identification, and performing four gradients of 0.5. mu.g/ml, 0.25. mu.g/ml, 0.125. mu.g/ml and 0.0625. mu.g/ml; the antibody was diluted in a 2-fold gradient starting at 100ng/ml to 0.195ng/ml loading. And obtaining the OD values corresponding to different antibody concentrations under the conditions of no coating concentration. Under the same coating concentration, the antibody concentration is used as an abscissa and the OD value is used as an ordinate, logarithmic mapping is carried out, and the antibody concentration at 50% of the maximum OD value is calculated according to a fitting equation; substitution into the formula: k ═ n-1)/(2 × (n × Ab '-Ab)) the reciprocal of the affinity constant was calculated, where Ab and Ab' respectively represent the antibody concentration at 50% of maximum OD value at the corresponding coating concentration (Ag, Ag '), and n ═ Ag/Ag'; every two coating concentrations can be combined to calculate a K value, finally, all K values are averaged, and the reciprocal value is calculated to be the affinity constant K_D。

Table 4 affinity assay data

As can be seen from Table 4, the mutant sequences corresponding to the mutation sites listed in Table 3 all have better affinity.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 5 mutations with WT as backbone

Table 6 affinity assay data

From the analysis of tables 5 and 6, the mutant sequences corresponding to the above mutation sites all have certain affinity.

The applicant makes a paired antibody experiment between the above antibody in table 4 and another internal antibody (an antibody paired with an antibody of the original WT sequence), and verified by a double-antibody sandwich method paired experiment, the specificity of the above antibody can be maintained at an original high level without significant change, which indicates that the above antibody and the WT antibody before mutation recognize the same epitope. But showed higher sensitivity due to the increased activity and affinity of the mutant antibody.

Stability analysis

The antibodies in the above examples are respectively placed in 4 ℃ (refrigerator), -80 ℃ (refrigerator), 37 ℃ (incubator) for 21 days, samples for 7 days, 14 days, 21 days are taken for state observation, and activity detection is carried out on the samples for 21 days, the results show that no obvious protein state change is seen after the antibodies are placed in three conditions for 21 days, and the activity does not show the trend of decreasing with the increase of temperature, which indicates that the antibodies all have excellent stability, and the mutation of the sites has no influence on the stability of the antibodies.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., Ltd

<120> an isolated binding protein comprising a procalcitonin antigen binding domain

<130> 20191018

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> PRT

<213> Artificial Synthesis

<400> 1

Asp Ile Val Met Thr Gln Ala Ala Phe Ser Asn Pro Val Thr Leu Gly

1 5 10 15

Thr Ser Ala Ser Ile Ser Cys

20

<210> 2

<211> 15

<212> PRT

<213> Artificial Synthesis

<400> 2

Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro His Leu Leu Ile Tyr

1 5 10 15

<210> 3

<211> 32

<212> PRT

<213> Artificial Synthesis

<400> 3

Gly Val Pro Asp Arg Phe Ser Ser Ser Gly Ser Gly Thr Asp Phe Ala

1 5 10 15

Leu Arg Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys

20 25 30

<210> 4

<211> 11

<212> PRT

<213> Artificial Synthesis

<400> 4

Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

1 5 10

<210> 5

<211> 25

<212> PRT

<213> Artificial Synthesis

<400> 5

Asp Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Val Lys Pro Ser Gln

1 5 10 15

Ser Leu Ser Leu Thr Cys Thr Val Thr

20 25

<210> 6

<211> 14

<212> PRT

<213> Artificial Synthesis

<400> 6

Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met Gly

1 5 10

<210> 7

<211> 30

<212> PRT

<213> Artificial Synthesis

<400> 7

Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe Leu Val

1 5 10 15

Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys

20 25 30

<210> 8

<211> 12

<212> PRT

<213> Artificial Synthesis

<400> 8

Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

1 5 10

<210> 9

<211> 106

<212> PRT

<213> Artificial Synthesis

<400> 9

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 25 30

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210> 10

<211> 323

<212> PRT

<213> Artificial Synthesis

<400> 10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly

<210> 11

<211> 219

<212> PRT

<213> Artificial Synthesis

<400> 11

Asp Ile Val Met Thr Gln Ala Ala Phe Ser Asn Pro Val Thr Leu Gly

1 5 10 15

Thr Ser Ala Ser Ile Ser Cys Arg Ser Ser Arg Ser Ile Leu His Ser

20 25 30

Asn Gly Val Thr Tyr Ile Phe Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro His Leu Leu Ile Tyr Gln Met Thr Asn Ile Ala Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Ser Ser Gly Ser Gly Thr Asp Phe Ala Leu Arg Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Asn Asn

85 90 95

Leu Glu Ile Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

115 120 125

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

130 135 140

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

145 150 155 160

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

165 170 175

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

180 185 190

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

195 200 205

Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

210 215

<210> 12

<211> 438

<212> PRT

<213> Artificial Synthesis

<400> 12

Asp Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Val Lys Pro Ser Gln

1 5 10 15

Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Phe Ser Val Thr Ser Asp

20 25 30

Tyr Thr Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp

35 40 45

Met Gly Tyr Val Asp Phe Arg Gly Ser Thr Asn Tyr Asn Pro Ser Leu

50 55 60

Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe

65 70 75 80

Leu Val Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Lys Arg Gly Ser Tyr Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr

100 105 110

Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro

115 120 125

Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val

130 135 140

Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser

145 150 155 160

Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu

165 170 175

Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser

180 185 190

Gln Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val

195 200 205

Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys

210 215 220

Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys

225 230 235 240

Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val

245 250 255

Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp

260 265 270

Asp Val Glu Val His Thr Ala Gln Thr Lys Pro Arg Glu Glu Gln Phe

275 280 285

Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp

290 295 300

Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe

305 310 315 320

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys

325 330 335

Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys

340 345 350

Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp

355 360 365

Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys

370 375 380

Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser

385 390 395 400

Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr

405 410 415

Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser

420 425 430

Leu Ser His Ser Pro Gly

435

Claims

1. An isolated binding protein comprising a procalcitonin antigen-binding domain, wherein said antigen-binding domain comprises at least one complementarity determining region of an amino acid sequence; or conservative variants obtained by conservative mutation by one or more amino acid addition, deletion, substitution or modification to the following amino acid sequences, said conservative variants having at least 80% sequence identity with the complementarity determining regions of the following amino acid sequences:

CDR-VH1 is G-X1-S-X2-T-S-D-Y-X3-W-H, wherein,

x1 is F, V or L, X2 is L, V or I, X3 is S or T;

the CDR-VH2 is Y-X1-D-F-R-G-S-T-X2-Y-N-P-S-X3-X4-S,

x1 is L, V or I, X2 is D, K or N, X3 is I or L, X4 is K or R;

CDR-VH3 is A-X1-R-G-S-X2-D, wherein,

x1 is K or R, X2 is Y, V or F;

the CDR-VL1 is R-S-S-X1-S-X2-H-S-N-G-X3-T-Y-X4-F, wherein,

x1 is R or K, X2 is IL, II, LL or LI, X3 is L, V or I, X4 is I or L;

the complementarity determining region CDR-VL2 is X1-M-X2-N-X3-A-S, wherein,

x1 is N, Q or H, X2 is T or S, X3 is I, V or L;

the CDR-VL3 is A-X1-N-X2-E-X3-P-W-T, wherein,

x1 is Q or N, X2 is I or L, X3 is L or I;

preferably, the first and second liquid crystal materials are,

in the complementarity determining region CDR-VH1, X3 is S;

in the complementarity determining region CDR-VH2, X4 is R;

in the complementarity determining region CDR-VH3, X1 is R;

in the complementarity determining region CDR-VL1, X1 is K;

in the complementarity determining region CDR-VL2, X2 is S;

in the complementarity determining region CDR-VL3, X1 is Q;

preferably, in the complementarity determining region CDR-VH1, X1 is independently selected from F;

preferably, in the complementarity determining region CDR-VH1, X1 is independently selected from V;

preferably, in the complementarity determining region CDR-VH1, X1 is independently selected from L;

preferably, in the complementarity determining region CDR-VH1, X2 is independently selected from L;

preferably, in the complementarity determining region CDR-VH1, X2 is independently selected from V;

preferably, in the complementarity determining region CDR-VH1, X2 is independently selected from I;

preferably, in the complementarity determining region CDR-VH2, X1 is independently selected from L;

preferably, in the complementarity determining region CDR-VH2, X1 is independently selected from V;

preferably, in the complementarity determining region CDR-VH2, X1 is independently selected from I;

preferably, in the complementarity determining region CDR-VH2, X2 is independently selected from D;

preferably, in the complementarity determining region CDR-VH2, X2 is independently selected from K;

preferably, in the complementarity determining region CDR-VH2, X2 is independently selected from N;

preferably, in the complementarity determining region CDR-VH2, X3 is independently selected from I;

preferably, in the complementarity determining region CDR-VH2, X3 is independently selected from L;

preferably, in the complementarity determining region CDR-VH3, X2 is independently selected from Y;

preferably, in the complementarity determining region CDR-VH3, X2 is independently selected from V;

preferably, in the complementarity determining region CDR-VH3, X2 is independently selected from F;

preferably, in the complementarity determining region CDR-VL1, X2 is independently selected from IL;

preferably, in the complementarity determining region CDR-VL1, X2 is independently selected from II;

preferably, in the complementarity determining region CDR-VL1, X2 is independently selected from LL;

preferably, in the complementarity determining region CDR-VL1, X2 is independently selected from LI;

preferably, in the complementarity determining region CDR-VL1, X3 is independently selected from L;

preferably, in the complementarity determining region CDR-VL1, X3 is independently selected from V;

preferably, in the complementarity determining region CDR-VL1, X3 is independently selected from I;

preferably, in the complementarity determining region CDR-VL1, X4 is independently selected from I;

preferably, in the complementarity determining region CDR-VL1, X4 is independently selected from L;

preferably, in the complementarity determining region CDR-VL2, X1 is independently selected from N;

preferably, in the complementarity determining region CDR-VL2, X1 is independently selected from Q;

preferably, in the complementarity determining region CDR-VL2, X1 is independently selected from H;

preferably, in the complementarity determining region CDR-VL2, X3 is independently selected from I;

preferably, in the complementarity determining region CDR-VL2, X3 is independently selected from V;

preferably, in the complementarity determining region CDR-VL2, X3 is independently selected from L;

preferably, in the complementarity determining region CDR-VL3, X2 is independently selected from I;

preferably, in the complementarity determining region CDR-VL3, X2 is independently selected from L;

preferably, in the complementarity determining region CDR-VL3, X3 is independently selected from L;

preferably, in the complementarity determining region CDR-VL3, X3 is independently selected from I;

preferably, the mutation site of each complementarity determining region is selected from any one of the following sequences:

alternatively to this, the first and second parts may,

in the complementarity determining region CDR-VH1, X3 is T;

in the complementarity determining region CDR-VH2, X4 is K;

in the complementarity determining region CDR-VH3, X1 is K;

in the complementarity determining region CDR-VL1, X1 is R;

in the complementarity determining region CDR-VL2, X2 is T;

in the complementarity determining region CDR-VL3, X1 is N;

preferably, the binding protein has a K with Procalcitonin (PCT)_D≤8.72×10^-10Affinity of mol/L.

2. The isolated binding protein comprising an antigen binding domain according to claim 1, wherein at least 3 CDRs are included in the binding protein; alternatively, the binding protein comprises at least 6 CDRs;

preferably, the binding protein is a monoclonal antibody, a nanobody, a F (ab')₂One of, Fab', Fab, Fv, scFv, diabody, and antibody minimal recognition unit;

preferably, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 which have the sequences shown in SEQ ID NO. 1-4 in sequence, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 which have the sequences shown in SEQ ID NO. 5-8 in sequence.

3. The isolated binding protein comprising an antigen binding domain according to claim 1 or 2, wherein the binding protein further comprises an antibody constant region sequence;

preferably, the constant region sequence is selected from the group consisting of constant region sequences of one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD;

preferably, the species of the constant region is from cattle, horses, cows, pigs, sheep, goats, mice, dogs, cats, rabbits, camels, donkeys, deer, mink, chickens, ducks, geese, turkeys or humans;

preferably, the constant region is of murine origin;

preferably, the first and second liquid crystal materials are,

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown as SEQ ID NO. 10.

4. An isolated nucleic acid molecule which is DNA or RNA encoding the binding protein of any one of claims 1 to 3.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A host cell comprising the nucleic acid molecule of claim 4 or the vector of claim 5;

preferably, the host cell is a mammalian cell;

more preferably, the host cell is a Chinese Hamster Ovary (CHO) cell, a HeLa cell, a young hamster kidney cell, a mouse myeloma cell.

7. A method of producing the binding protein of any one of claims 1 to 3, comprising the steps of:

culturing the host cell of claim 6 under suitable culture conditions and recovering the produced binding protein from the culture medium or from the cultured host cell.

8. Use of a binding protein according to any one of claims 1 to 3 in the manufacture of a product for the diagnosis of a disease associated with a change in PCT levels.

Preferably, the disease associated with a change in PCT levels is an infectious disease, sepsis, multiple organ failure syndrome (MODS);

preferably, the infectious disease comprises a bacterial infection, a fungal infection or a parasitic infection.

9. A method of detecting PCT in a test sample, comprising:

a) contacting a PCT antigen in the test sample with the binding protein of claim 3 under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex;

b) detecting the presence of the immune complex;

preferably, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

preferably, in step a), a second antibody is further included in the immune complex, said second antibody binding to the PCT antigen.

10. A reagent or kit comprising a binding protein according to any one of claims 1 to 3;

preferably, the reagent or kit further comprises one or more of a buffer, a stabilizer, a diluent or a carrier.