CN112946262A

CN112946262A - PCV3 double-antigen sandwich ELISA antibody detection kit and application thereof

Info

Publication number: CN112946262A
Application number: CN202110104238.9A
Authority: CN
Inventors: 屈勇刚; 梁晏; 李静; 杨瑞钰; 谷思颖; 魏其; 任敏; 宋敏; 何高明
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2021-01-26
Filing date: 2021-01-26
Publication date: 2021-06-11

Abstract

The invention aims to provide a PCV3 double-antigen sandwich ELISA antibody detection kit and application thereof, which can sensitively, quickly and accurately detect PCV3 antibody, have the characteristics of strong specificity, good repeatability, higher detection accuracy rate for different animals and accurate and reliable detection result, and are detection methods with broad spectrum.

Description

PCV3 double-antigen sandwich ELISA antibody detection kit and application thereof

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a PCV3 double-antigen sandwich ELISA antibody detection kit.

Background

The circovirus belongs to the genus circovirus of the family circovirus, and the genome is a circular single-stranded DNA of about 2 kb. The circovirus can infect a variety of animals, including pigs, cattle, dogs, ducks, chickens, foxes, fish, and the like. Circovirus encodes mainly two open reading frames (rep and cap). In 2015, american researchers detected a novel circovirus (PCV3) associated with dermatitis nephrotic syndrome, reproductive disorders, myocarditis, and multiple system inflammation in the united states by metagenomic sequencing. At present, porcine circovirus type III is a swine disease seriously harming the swine industry in China, and antibody detection is the key of prevention and control. Meanwhile, the infection of the circovirus to other animals is a potential threat affecting the breeding industry.

However, current research on ELISA antibody detection kits for PCV3 focuses on indirect ELISA diagnostic methods. If the application number is: 201810004832.9 patent of invention, porcine circovirus type 3 ELISA antibody detection kit and application number are: 201710184107.X, the invention patent of novel porcine circovirus type 3 ELISA antibody detection kit and application thereof, most established serological detection kits are indirect ELISA diagnostic kits established by taking PCV3Cap protein as an antigen, and the kits are limited by the species of the detected animals. The invention provides a double-antigen sandwich ELISA antibody detection kit of PCV3Cap protein, which is suitable for detecting various host antibodies, can be applied to the detection of PCV3 antibodies of various types in clinical detection, is expected to provide a practical means for PCV3 epidemiological research and clinical disease detection, and has wide development value in the fields of cultivation and epidemic disease detection.

Disclosure of Invention

In order to solve the technical problem that PCV3 antibody detection is limited by the species of the detected animals in the prior art, the invention aims to provide a PCV3 double-antigen sandwich ELISA antibody detection kit which can sensitively, quickly and accurately detect PCV3 antibody, has the characteristics of strong specificity, good repeatability, higher detection accuracy for different types of animals and accurate and reliable detection results, is a detection kit with broad spectrum, and has important significance for PCV3 infection prevention and control.

The invention is realized by the following technical scheme:

the invention provides a PCV3 double-antigen sandwich ELISA antibody detection kit, which adopts PCV3Cap_40-372The recombinant protein is used as a coating antigen and adopts PCV3Cap_376-645HRP as enzyme-labeled detection antigen.

The PCV3 double-antigen sandwich ELISA antibody detection kit further comprises carbonate buffer solution, PBST, skimmed milk powder, TMB color development liquid and 2MH₂SO₄And (4) stopping the solution.

The invention provides a PCV3 double-antigen sandwich ELISA antibody detection kit, which is used for detecting PCV3Cap_40-372The primer sequences adopted in the preparation process of the recombinant protein are shown as SEQ ID NO.1 and SEQ ID NO.2, and PCV3Cap_376-645The sequences of the primers adopted in the preparation process of HRP are shown as SEQ ID NO.3 and SEQ ID NO. 4.

Further, the invention also provides application of the PCV3 double-antigen sandwich ELISA antibody detection kit in detection of PCV3 antibodies.

The invention provides an application of a PCV3 double-antigen sandwich ELISA antibody detection kit in detection of PCV3 antibodies, which is characterized by comprising the following steps:

(1) with PCV3Cap_40-372The recombinant protein is used as an antigen coating enzyme label plate, each hole is 100 mu L, the coating protein is used as a carbonate buffer solution (pH9.6), and the serum to be detected is prepared according to the following steps of 1: (25-200) diluting to 5.0-0.1 mu g/mL; coating for 1-2h or coating overnight at 4 ℃, adding 250 mu LPBST into each hole, washing for 5min for 3 times, and patting dry the ELISA plate each time;

(2) adding 200 mu L of 5% skimmed milk powder into each well of the ELISA plate obtained in the step (1), sealing at 37 ℃, sealing for 30-90min, and washing in the same step as the step (1);

(3) loading 100 mu L of the enzyme label plate obtained in the step (2) into each hole, setting a negative control, acting for 2h at 37 ℃, and washing the enzyme label plate in the same step (1);

(4) on the basis of the step (3), an enzyme-labeled antigen PCV3Cap_376-645HRP in 1: (500-2000)Diluting by multiple times, adding 100 mu L of the solution into each hole, incubating at 37 ℃ for 30-90min, and washing in the same step (1);

(5) adding 100 mu L of TMB color development liquid into each hole of the ELISA plate obtained in the step (4), and developing for 10-30min at 37 ℃ in a dark place;

(6) adding 100 mu L of 2MH into each hole of the ELISA plate obtained in the step (4)₂SO₄The OD value is read at 450nm in the enzyme-labeling instrument by using the stop solution;

(7) judging the result of the OD value obtained in the step (6), wherein the OD450nm value of the positive serum of the immune group and the OD of the non-immune negative serum_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Preferably, the antigen concentration is diluted to 1.0. mu.g/mL, and the serum dilution is 1: 50.

preferably, the optimal recombinant antigen coating conditions are 4 ℃ overnight.

Preferably, the optimal reaction time of the serum is 60 min.

Preferably, the working concentration of the enzyme-labeled antigen is that the enzyme-labeled antigen is expressed according to the following ratio of 1:500 dilutions were performed with an incubation time of 60 min.

Preferably, the substrate is allowed to act for 20 min.

The following beneficial effects can be achieved by implementing the specific invention content of the invention:

the invention aims to provide a PCV3 double-antigen sandwich ELISA antibody detection kit, which can sensitively, quickly and accurately detect PCV3 antibody, has the characteristics of strong specificity, good repeatability, higher detection accuracy for different animals and accurate and reliable detection result, is a detection kit with broad spectrum, has important significance for PCV3 infection prevention and control, provides simple, quick and low-cost technical support for PCV3 serum epidemiology monitoring, and has wide application value.

Drawings

Is free of

Detailed Description

The present invention will be described below by way of examples, but the present invention is not limited to the following examples. The equipment and materials involved in the invention:

reagents used in the present invention: carbonate buffer solution, PBST, skimmed milk powder, TMB color developing solution, MH₂SO₄。

The materials used in the invention are as follows: an ELISA plate, a thermostat, an ELISA reader, a liquid-transfering gun, a suction head and an ultra-clean workbench.

All reagents, instruments and raw materials used in the present invention are well known in the art and are not intended to limit the practice of the present invention, and other reagents and equipment well known in the art may be used in the practice of the following embodiments of the present invention.

The first embodiment is as follows: PCV3 double-antigen sandwich ELISA antibody detection kit

The invention provides a PCV3 double-antigen sandwich ELISA antibody detection kit, which adopts PCV3Cap_40-372The recombinant protein is used as a coating antigen and adopts PCV3Cap_376-645HRP as enzyme labeling detection antigen, carbonate buffer solution, PBST, skimmed milk powder, TMB color developing solution, and 2MH₂SO₄And (4) stopping the solution.

(4) on the basis of the step (3), an enzyme-labeled antigen PCV3Cap_376-645HRP in 1: (500-2000) performing a dilution by multiple ratio, adding 100. mu.L of the diluted solution into each well, incubating at 37 ℃ for 30-90min, and performing a washing step in the same way as in the step (1);

(7) judging the result of the OD value obtained in the step (6), wherein the OD of the positive serum of the immune group_450nmValue and non-immune negative serum OD_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Example two: preparation of coating antigen and enzyme-labeled detection antigen

1. Construction of recombinant plasmid PCV3Cap_40-372And PCV3Cap_376-645

1.1 primers

2 pairs of truncated PCV3Cap_40-372And PCV3Cap_376-645Specific primers for the genes were as follows:

PCV3Cap_40-372the primer sequences are as follows:

SEQ ID NO.1：CGGAATTCATGCGTCGTCGTCGTCGTCATCGTCGTCGTTA

SEQ ID NO.2:CCGCTCGAGTTAATCGTCTTGCAGCCAGGTATTGGTGGTCC

PCV3Cap_376-645the primer sequences are as follows:

SEQ ID NO.3：CCGGAATTCATGGTACGCAGAAAGCAGCACCCGCAAAG

SEQ ID NO.4：CCGCTCGAGTTACAGAACGCTTTTGTAGCGGATCCAGAC。

1.2PCV3Cap_40-372and PCV3Cap_376-645Amplification of genes

PCV3Cap is amplified by PCR by taking PCV3Cap plasmid as a template and SEQ ID NO.1-SEQ ID NO.4 as primers_40-372And PCV3Capp_376-645Genes and reaction conditions are as follows: 5min at 94 ℃; 30s at 94 ℃; 30s at 62 ℃; 40s at 72 ℃; 35 cycles; the reaction system is shown in Table 1, and the temperature is 72 ℃ for 10min and the temperature is 4 ℃.

Table 1: PCR reaction system

Components	Volume of
		Upstream primer F	1μL
Downstream primer R	1μL
		Form panel	1μL
2 × TaqDNA polymerase	10μL
		ddH₂O	7μL
General System	20μL

1.3 recovery of the Gene of interest

The PCR product was subjected to 1% agarose gel electrophoresis.

1.4 recombinant plasmidsT-PCV3Cap_40-372And T-PCV3Cap_376-645Construction of

The target fragment obtained above was ligated to T vector at 25 ℃ for 5min, and the reaction system is shown in Table 2.

Table 2: t-vector ligation systems

mu.L of the ligation product was mixed with 50. mu.L of DH 5. alpha. competent cells and transformed as described in experiment one. Positive clones were picked and cultured overnight in 5mL of Amp-containing resistant liquid medium at 37 ℃ and 200 r/rpm. The plasmid extraction steps are as above.

1.5 recombinant plasmid pET-32a-PCV3Cap_40-372And pET-32a-PCV3Cap_376-645Construction of

Recombination plasmid T-PCV3Cap Using restriction enzymes EcoR I and Xho I_40-372、T-PCV3Cap_376-64Carrying out double enzyme digestion with pET-32a vector under the following reaction conditions: the water bath is carried out at 37 ℃ for 1.5h, and the reaction system is shown in the table 3.

Table 3: double enzyme digestion reaction system

And (3) carrying out 1% agarose gel electrophoresis on the enzyme digestion product, and recovering and purifying the enzyme digestion product fragment by using a gel recovery method after the electrophoresis is finished.

PCV3Cap_40-372、PCV3Cap_376-645The gene and pET-32a vector use T4 ligase, and the reaction conditions are as follows: the ligation was carried out overnight at 16 ℃ and the expression vector ligation system is shown in Table 4 below.

Table 4: recombinant vector ligation system

And transforming the ligation product into DH5 alpha competent cells, extracting recombinant plasmids, and performing PCR, double enzyme digestion and sequencing identification.

2. Recombinant protein expression and identification

Selecting a recombinant plasmid pET-32a-PCV3Cap with correct sequencing_40-372And pET-32a-PCV3Cap_376-645BL21 expression competent cells were transformed, and the positive clone was cultured with shaking at 37 ℃ until OD of the bacterial liquid_600nmWhen the concentration reaches about 0.5-0.7, IPTG with the final concentration of 0.5mmol/L is added for induction for 6 h. Recombinant proteins were identified by SDS-PAGE and Westernblot.

3. Purification of recombinant proteins

Inducing to express 5mL bacterial liquid, centrifuging to collect thalli, suspending the precipitate by PBS, adding 5 xSDS-PAGE sample buffer, and water bathing at 100 ℃ for 10 min. SDS-PAGE was carried out by a conventional method without inserting a sample comb when preparing an SDS-PAGE gel concentrate. After electrophoresis, the gel was taken out, stained with 0.3mol/L KCl for 5min to clearly see a white band, the desired band was excised, washed with PBS 3 times, the gel was completely crushed with 500. mu.L PBS, centrifuged at 12000r/rpm for 2min, and the supernatant was taken to determine the protein concentration and SDS-PAGE was performed to identify the protein purity.

HRP-labeled recombinant protein

Determination of PCV3Cap_376-645The concentration of the recombinant protein was adjusted to 0.5-2.0mg/mL, and the minimum volume of the labeling reaction was 100. mu.L. The recombinant protein was mixed with HRP activating solution according to 10: 1 and incubated at room temperature (20-25 ℃) for 1h or at 4 ℃ with gentle stirring overnight. Adding 10 mu L of NaCNBH as a reducing agent₃Incubate at room temperature for 15 min. HRP storage buffer (2X) was added in an amount equal to the reaction volume, incubated at room temperature for 15min and stored at 4 ℃ until use.

Example three: PCV3 double-antigen sandwich ELISA antibody detection kit

With PCV3Cap_40-372Recombinant proteins as antibodies100 mu L of primary coated enzyme label plate, using carbonate buffer solution (pH9.6) for coating protein, and mixing the serum to be detected according to the ratio of 1: diluting to 5.0 mug/mL by a multiple ratio of 25; coating for 1h, adding 250 mu L PBST into each hole, washing for 5min for 3 times, and patting dry the enzyme label plate each time; adding 5% skimmed milk powder 200 μ L per well, sealing at 37 deg.C for 30min, and washing; loading 100 mu L of sample into each hole, setting a negative control, acting at 37 ℃ for 2h, and washing the same as the above steps; enzyme-labeled antigen PCV3Cap_376-645HRP in 1:500, adding 100 mu L of the diluted solution into each hole, incubating at 37 ℃ for 30min, and washing the solution in the same way as the above; adding 100 μ L of TMB color developing solution into each well, and developing at 37 deg.C in dark for 10 min; add 100. mu.L of 2MH per well₂SO₄The OD value is read at 450nm in the enzyme-labeling instrument by using the stop solution; judging the obtained OD value, wherein the OD of the positive serum of the immune group_450nmValue and non-immune negative serum OD_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Example four: PCV3 double-antigen sandwich ELISA antibody detection kit

With PCV3Cap_340-372The recombinant protein is used as an antigen coating enzyme label plate, each hole is 100 mu L, the coating protein is used as a carbonate buffer solution (pH9.6), and the serum to be detected is prepared according to the following steps of 1: diluting to 2.50 mu g/mL by a 50-fold ratio; coating for 2h, adding 250 mu LPBST into each hole, washing for 5min for 3 times, and patting dry the ELISA plate each time; adding 5% skimmed milk powder 200 μ L per well, sealing at 37 deg.C for 45min, and washing; loading 100 mu L of sample into each hole, setting a negative control, acting at 37 ℃ for 2h, and washing the same as the above steps; enzyme-labeled antigen PCV3Cap_376-645HRP in 1:500, adding 100 mu L of the diluted solution into each hole, incubating at 37 ℃ for 30-90min, and washing the solution in the same way as the above; adding 100 μ L of TMB color developing solution into each well, and developing at 37 deg.C in dark for 15 min; add 100. mu.L of 2MH per well₂SO₄The OD value is read at 450nm in the enzyme-labeling instrument by using the stop solution; judging the obtained OD value, wherein the OD of the positive serum of the immune group_450nmValue and non-immune negative serum OD_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Example five: PCV3 double-antigen sandwich ELISA antibody detection kit

With PCV3Cap_40-372The recombinant protein is used as an antigen coating enzyme label plate, each hole is 100 mu L, the coating protein is used as a carbonate buffer solution (pH9.6), and the serum to be detected is prepared according to the following steps of 1: diluting to 1.0 mug/mL by a 50-fold ratio; coating at 4 ℃ overnight, adding 250 mu LPBST into each hole, washing for 5min for 3 times, and patting dry the ELISA plate each time; adding 5% skimmed milk powder 200 μ L per well, sealing at 37 deg.C for 60min, and washing; loading 100 mu L of sample into each hole, setting a negative control, acting at 37 ℃ for 2h, and washing the same as the above steps; enzyme-labeled antigen PCV3Cap_376-645HRP in 1:500, adding 100 mu L of the diluted solution into each hole, incubating at 37 ℃ for 60min, and washing the solution in the same way as the above; adding 100 μ L of TMB color developing solution into each well, and developing at 37 deg.C in dark for 20 min; add 100. mu.L of 2MH per well₂SO₄The OD value is read at 450nm in the enzyme-labeling instrument by using the stop solution; judging the obtained OD value, wherein the OD of the positive serum of the immune group_450nmValue and non-immune negative serum OD_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Example six: PCV3 double-antigen sandwich ELISA antibody detection kit

With PCV3Cap_40-372The recombinant protein is used as an antigen coating enzyme label plate, each hole is 100 mu L, the coating protein is used as a carbonate buffer solution (pH9.6), and the serum to be detected is prepared according to the following steps of 1: diluting to 0.5 mug/mL by 100 times; coating at 4 ℃ overnight, adding 250 mu L PBST into each hole, washing for 5min for 3 times, and patting dry the enzyme label plate each time; adding 5% skimmed milk powder 200 μ L per well, sealing at 37 deg.C for 90min, and washing; loading 100 mu L of sample into each hole, setting a negative control, acting at 37 ℃ for 2h, and washing the same as the above steps; enzyme-labeled antigen PCV3Cap_376-645HRP in 1:1000, adding 100 mu L of the diluted solution into each hole, incubating for 90min at 37 ℃, and washing the solution in the same way as the above; adding 100 mu L of TMB color development liquid into each hole, and developing for 30min at 37 ℃ in a dark place; add 100. mu.L of 2MH per well₂SO₄The OD value is read at 450nm in the enzyme-labeling instrument by using the stop solution; judging the obtained OD value, wherein the OD of the positive serum of the immune group_450nmValue and non-immune negative serum OD_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Example seven: PCV3 double-antigen sandwich ELISA antibody detection kit

With PCV3Cap_40-372The recombinant protein is used as an antigen coating enzyme label plate, each hole is 100 mu L, the coating protein is used as a carbonate buffer solution (pH9.6), and the serum to be detected is prepared according to the following steps of 1: 200) diluting to 0.1 mug/mL; coating at 4 ℃ overnight, adding 250 mu L PBST into each hole, washing for 5min for 3 times, and patting dry the enzyme label plate each time; adding 5% skimmed milk powder 200 μ L per well, sealing at 37 deg.C for 90min, and washing; loading 100 mu L of sample into each hole, setting a negative control, acting at 37 ℃ for 2h, and washing the same as the above steps; enzyme-labeled antigen PCV3Cap_376-645HRP in 1: 2000, adding 100 mu L of the diluted solution into each hole, incubating for 90min at 37 ℃, and washing the solution in the same way as the above; adding 100 mu L of TMB color development liquid into each hole, and developing for 30min at 37 ℃ in a dark place; add 100. mu.L of 2MH per well₂SO₄The OD value is read at 450nm in the enzyme-labeling instrument by using the stop solution; judging the obtained OD value, wherein the OD of the positive serum of the immune group_450nmValue and non-immune negative serum OD_450nmIf the ratio of the values is greater than 2.1, the test piece can be determined to be positive.

Example eight: optimal antigen coating concentration and optimal serum dilution optimization

Based on the third to seventh examples, the purified PCV3Cap is titrated by a square matrix method_40-372The recombinant protein solution was coated with a coating solution (carbonate buffer, pH9.6) in a gradient of 5.0. mu.L/mL, 2.50. mu.g/mL, 1.0. mu.g/mL, 0.5. mu.g/mL, 0.1. mu.g/mL, 100. mu.L/well, 200. mu.L of a 5% nonfat dry milk blocking solution was added to each well, the solution was blocked at 37 ℃ for 2h, and 250. mu.L of BST was added to each well and washed for 5min for 3 times, each time, the plate was blotted dry. And (3) diluting the yin and yang blood serum according to the ratio of 1:25,1: 50,1: 100,1: 200 times diluted, 100 u L/hole longitudinal plate, each concentration line, 37 degrees C incubator for 1 h; plates were washed as above and HRP-labeled recombinant PCV3Cap was diluted with diluent_376-645(PCV3Cap_376-645HRP) with 1: diluting by 500 times, adding an enzyme label plate at a concentration of 100 mu L/hole, and incubating for 1h in an incubator at 37 ℃; washing the plate, adding TMB into the ELISA plate at 100 μ L/hole, and reacting in dark room for 20 min; stop solution was added at 50. mu.L/well,OD measurement with microplate reader immediately_450nmThe value is obtained. The criteria for optimal working conditions of ELISA were positive/negative OD_450nmThe value (P/N) ratio is maximal. The measurement results are shown in table 5:

table 5: optimal antigen coating concentration and optimal serum dilution optimization

Note: each data is the average of 2 replicates

According to the detection result, PCV3Cap_40-372Protein concentration was set up with 5 dilution gradients, serum dilution gradient from 1:25, 4 gradients are set at the beginning, other conditions are consistent, the results of the double-antigen sandwich ELISA detection are shown in the table 1, and the results show that the antigen concentration is diluted to 1.0 mu g/mL, the serum dilution is 1: at 50, the P/N value is maximum.

Example nine: optimization of optimal coating time for recombinant antigens

Eighty-group PCV3Cap based on the third to third embodiments_40-372The protein coating conditions were set to 3 groups; 1h, 2h, 4 ℃ overnight, ELISA assays were performed with known PCV3 negative and positive sera, 1 control in parallel per condition, with the other conditions unchanged, and OD read_450nmValue as negative serum OD_450nmValue N, positive serum OD_450nmThe value is P, and the OD of the negative serum and the positive serum of each group is compared_450nmValue and P/N value, optimizing the optimal coating condition of the antigen. Three different groups of coating conditions were set, and the other conditions were optimized, and the results of performing the double antigen sandwich ELISA are shown in table 6.

Table 6: optimization of optimal coating time

Note: each data is the average of 2 replicates

According to the mapping result, the optimal coating condition is that the coating is carried out overnight at 4 ℃, and the P/N value is maximum.

Example ten: optimization of optimal reaction time of serum

Based on the above three to nine examples, the sera were diluted in the optimized optimal ratio and the incubation time of the sera was set to 4 groups: performing ELISA detection under optimized conditions for 30min, 45min, 60min and 90min, and reading OD on microplate reader_450nmValue, OD of positive and negative serum in each group was compared_450nmValue, optimize optimal serum action time. Comparing OD of negative and positive serum of each group_450nmOptimizing the value and the P/N value, and optimizing the optimal sealing liquid and the sealing time. Four groups of different sealing conditions are set, the other conditions are the optimal conditions, the results of the double-antigen sandwich ELISA detection are shown in the table 7,

table 7: optimization of optimal reaction time of serum

Note: each data is the average of 2 replicates

As shown in Table 7, the P/N value was the largest when the blocking time was 1 h.

Example eleven: optimization of enzyme-labeled antigen optimal working concentration and action time

Based on the third to tenth examples, the enzyme-labeled antigen PCV3Cap_376-645HRP at 1:500, 1:1000, 1: 2000, set 4 groups for incubation time: performing ELISA detection at 30min, 45min, 60min, and 90min to read OD_450nmValue, OD of positive and negative serum in each group was compared_450nmValue, OD of positive and negative serum in each group was compared_450nmAnd optimizing the optimal enzyme-labeled antigen dilution concentration and incubation time. The other conditions were optimized, and the results of the double antigen sandwich ELISA assay are shown in Table 8.

Table 8: optimization of enzyme-labeled antigen optimal working concentration and action time

Note: each data is the average of 2 replicates

According to the measurement results, as shown in Table 8, when the enzyme-labeled antigen dilution is 1:500, when the action time is 60min, the P/N value is maximum.

Example twelve: optimization of optimal action time of substrate

Based on the third to eleventh embodiments, 4 ELISA plates were tested according to the optimized ELISA conditions, substrate buffer TMB was added, and the plates were placed in a dark room for 4 sets of action time: 10min, 15min, 20min, 30min, adding stop solution, and comparing OD of positive and negative serum_450nmValue, optimize optimal substrate action time. 4 groups of different substrate action time are set, and the other groups are the optimal conditions, and the results of the double-antigen sandwich ELISA detection are shown in the table 9.

Table 9: optimization of optimal action time of substrate

Note: each data is the average of 2 replicates

As shown in the results of the measurement in Table 9, the P/N value was the largest when the substrate was allowed to act for 20 min.

Example thirteen: determination of critical value

Based on the above three to twelve examples, PCV3 negative serum was detected according to the optimized invention conditions, and OD of the sample was recorded_450nmValues and calculating the mean (X) and Standard Deviation (SD); OD of serum to be detected_450nmWhen the value is more than or equal to X +3SD, the positive PCV3 is judged, and the OD of the serum to be detected_450nmWhen the value is less than or equal to X +2SD, the PCV3 is judged to be negative, and the suspicious character exists between the two. Known 20 negative pig serum is detected by a double-antigen sandwich ELISA kit established according to the optimal conditions, and 20 serum OD is calculated_4500nmThe average value was 0.155, the standard deviation was 0.035,OD of serum to be detected_450nmWhen the value is more than or equal to X +3SD and is 0.26, the PCV3 is judged to be positive, and the OD of the serum to be detected is_450nmWhen the value ≦ X +2SD was 0.225, PCV3 was judged negative.

Example fourteen: specific invention

Based on the third to thirteenth embodiments, the double-antigen sandwich ELISA kit established according to the optimal conditions has negative effect results on positive serum of PCV2, PRRSV, CSFV and PRV, which indicates that the established ELISA kit has good specificity, and the results are shown in Table 10.

Table 10: specific invention

Example fifteen: repetitive invention

Repeat invention in batch: and (3) coating the purified protein in the same batch on an ELISA plate, detecting 4 serum samples, repeating 5 groups for each sample, determining the double-antigen sandwich ELISA kit according to the same conditions, and performing statistical analysis on the repeated variation coefficient.

Batch to batch repeat invention: and (3) coating the ELISA plate with 5 groups of purified proteins of different batches, detecting 4 serum samples, detecting, performing double-antigen sandwich ELISA kit determination according to the same conditions, and performing statistical analysis on the repeated variation coefficient. The results of the in-batch duplicate measurements are shown in Table 11. The results of the batch-to-batch repetition of 4 serum samples tested for 5 different batches of proteins using the established double antigen sandwich ELISA kit are shown in Table 12.

Table 11: in-batch repeatability invention

According to the detection results shown in table 11, the established double-antigen sandwich ELISA kit is used for detecting 4 serum samples of the same batch of protein, and the results show that the variation coefficients are 3.628%, 2.633%, 4.346% and 3.787%, respectively, which indicates that the kit has better repeatability.

Table 12: batch-to-batch repeatability invention

According to the detection results in table 12, the coefficients of variation are shown to be 5.491%, 3.398%, 5.296% and 8.735%, respectively, indicating that the kit has better repeatability.

Example sixteen: sensitive invention

The sensitivity of the kit is detected by detecting the positive serum diluted by times at the ratio of 1:40, 1:80, 1:160, 1:320, 1:640, 1:1280 and 1:2560 by using the established double-antigen sandwich ELISA kit. The positive sera were diluted at a ratio of 1:40, 1:80, 1:160, 1:320, 1:640, 1:1280, 1:2560, and the results are shown in Table 13. ,

table 13: results of the invention

Dilution factor of serum

1:40

1:80

1:160

1:320

1:640

1:1280

1:2560

OD value

0.831

0.776

0.592

0.473

0.358

0.274

0.168

The result of the judgment

+

-

As shown in the determination results in Table 10, when the dilution of the positive serum is 1:1280, the determination result is still positive, which indicates that the double-antigen sandwich ELISA detection kit has high sensitivity.

Example seventeen: comparison of detection results of double antigen sandwich method and indirect method

96 parts of bovine-derived and porcine-derived sera are detected by using the double-antigen sandwich ELISA kit established by the invention and a swine-derived and bovine-derived PCV3 indirect ELISA kit established in a laboratory, and the two kits are used for retesting inconsistent serum samples, so that the coincidence rate of PCV3 double-antigen sandwich ELISA results is evaluated. The results of the detection of 96 parts of bovine-derived and porcine-derived sera by the double-antigen sandwich ELISA kit and the bovine-derived and porcine-derived PCV3 indirect ELISA kit established by the invention are shown in tables 14 and 15.

Table 14: results of bovine serum sample testing

Double antigen sandwich method	Indirect method	Detecting the amount	The result of the detection
				+	+	58	Positive for
-	-	33	Negative of
				-	+	2	Is not optimized
+	-	3	Is not optimized

Table 15: pig serum sample detection result

Double antigen sandwich method	Indirect method	Detecting the amount	The result of the detection
				+	+	54	Positive for
-	-	39	Negative of
				-	+	1	Is not optimized
+	-	2	Is not optimized

According to the detection results in tables 14 and 15, 61 positive parts and 35 negative parts are detected by the bovine serum double-antigen sandwich method, the positive rate is 63.54% (61/96), 60 positive parts and 36 negative parts are detected by the indirect ELISA kit, the positive rate is 62.50% (60/96), and the coincidence rate is 94.79% (91/96); the swine serum double antigen sandwich method detects 56 positive parts and 40 negative parts, the positive rate is 58.33 percent (56/96), the indirect ELISA kit detects 55 positive parts and 41 negative parts, the positive rate is 57.29 percent (55/96), and the coincidence rate is 95.83 percent (92/96).

Example eighteen: clinical serum test results

96 serum samples of a certain pig farm in Xinjiang area are detected by using the double-antigen sandwich ELISA kit established by the invention, so as to evaluate the positive condition of the PCV3 antibody in swinery at different growth stages. 56 parts of PCV3 positive serum in 96 parts of serum are detected by using the kit for detecting PCV3 antibody by using the double-antigen sandwich ELISA constructed by the invention, and the results are shown in Table 16.

Table 16: clinical serum test results

As shown in the test results in Table 16, the antibody positivity of the serum sample is 58.33% (56/96), and the test results of the swinery in different growth stages show that the positivity of the boar serum sample is 90% at most (9/10) and the positivity of the piglet serum sample is 14.28% at least (2/14).

As described above, the present invention can be better realized, the above-mentioned embodiments only describe the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements made to the technical solution of the present invention by those skilled in the art without departing from the design spirit of the present invention shall fall within the protection scope optimized by the present invention.

Sequence listing

<110> river university

<120> PCV3 double-antigen sandwich ELISA antibody detection kit and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Porcine circovirus type 3 (Porcine circovirus 3)

<400> 1

cggaattcat gcgtcgtcgt cgtcgtcatc gtcgtcgtta 40

<210> 2

<211> 41

<212> DNA

<213> Porcine circovirus type 3 (Porcine circovirus 3)

<400> 2

ccgctcgagt taatcgtctt gcagccaggt attggtggtc c 41

<210> 3

<211> 38

<212> DNA

<213> Porcine circovirus type 3 (Porcine circovirus 3)

<400> 3

ccggaattca tggtacgcag aaagcagcac ccgcaaag 38

<210> 4

<211> 39

<212> DNA

<213> Porcine circovirus type 3 (Porcine circovirus 3)

<400> 4

ccgctcgagt tacagaacgc ttttgtagcg gatccagac 39

Claims

1. A PCV3 double-antigen sandwich ELISA antibody detection kit is characterized by comprising PCV3Cap_40-372The recombinant protein is envelope antigen and PCV3Cap_376-645HRP is an enzyme-labeled detection antigen.

2. The PCV3 double-antigen sandwich ELISA antibody detection kit of claim 1, further comprising carbonate buffer solution, PBST, skim milk powder, TMB color developing solution, 2MH₂SO₄And (4) stopping the solution.

3. The PCV3 double-antigen sandwich ELISA antibody detection kit of claim 1, wherein PCV3Cap_40-372In the process of recombinant protein productionThe primer sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, and PCV3Cap_376-645The sequences of the primers adopted in the preparation process of HRP are shown as SEQ ID NO.3 and SEQ ID NO. 4.

4. The use of a PCV3 double antigen sandwich ELISA antibody detection kit according to any one of claims 1 to 3 for the detection of PCV3 antibodies.

5. The use of the PCV3 double-antigen sandwich ELISA antibody detection kit for detecting PCV3 antibody according to claim 4, wherein the use comprises the steps of:

6. The use of the PCV3 double antigen sandwich ELISA antibody detection kit according to claim 1 for detecting PCV3 antibodies, wherein the antigen concentration is diluted to 1.0 μ g/mL, and the serum dilution is 1: 50.

7. the use of a PCV3 double antigen sandwich ELISA antibody detection kit according to claim 1 for detecting PCV3 antibodies, wherein the optimal recombinant antigen coating conditions are 4 ℃ overnight coating.

8. The use of the PCV3 double antigen sandwich ELISA antibody detection kit according to claim 1 for detecting PCV3 antibodies, wherein the optimal serum reaction time is 60 min.

9. The use of the PCV3 double-antigen sandwich ELISA antibody detection kit for detecting PCV3 antibody according to claim 1, wherein the working concentration of enzyme-labeled antigen is 1:500 dilutions were performed with an incubation time of 60 min.

10. The use of the PCV3 double antigen sandwich ELISA antibody detection kit according to claim 1 for detecting PCV3 antibodies, wherein the substrate action time is 20 min.