CN112941181A - Method for detecting cfDNA mutation information in peripheral blood of subject - Google Patents

Abstract

The invention discloses a method for detecting cfDNA mutation information in peripheral blood of a detected person, which comprises the following steps: performing DNA extraction on the peripheral blood sample to obtain cfDNA in the peripheral blood sample; constructing a library based on cfDNA to obtain a cfDNA library; performing hybridization capture based on the cfDNA library to obtain a target sequence; carrying out gene sequencing on the target sequence to obtain sequencing data; and performing data analysis based on the sequencing data to obtain mutation information. The method provided by the invention can be used for detecting benign and malignant pulmonary nodules, and is noninvasive and high in sensitivity.

Description

Method for detecting cfDNA mutation information in peripheral blood of subject

The application is filed as6/06/07/2017Application No. is201710422812.9The invention is named asA kind of Kit for detecting benign or malignant pulmonary nodules and application thereofDivisional application of the patent application.

Technical Field

The application relates to the field of gene detection, in particular to a method for detecting cfDNA mutation information in peripheral blood of a detected person.

Background

Lung cancer is the most common malignant tumor with the highest morbidity and mortality in the world, and the number of deaths per year is about 140 thousands, accounting for 18% of all malignant tumor deaths. Professor Peto, a famous oncologist in england predicts: if China does not control smoking and control air pollution in time, more than 100 ten thousand patients will develop lung cancer every year by 2025 years. With the current detection methods, about 75% of lung cancer patients are diagnosed with advanced stage, and the 5-year survival rate is about 15.6%. The public lacks of screening consciousness and a method for scientifically identifying lung nodules, so that the incidence rate of lung cancer is high. Lung cancer is manifested in the form of lung nodules, and therefore, the key to early screening of lung cancer is accurate diagnosis of lung nodules.

The lung nodules are small focal, rounded-like, imagewise appearing densely-shaded, and may be single-shot or multiple-shot. Diffuse or multiple nodules, generally resulting from extrathoracic metastasis or active infection, have a relatively low probability of primary lung cancer. Isolated lung nodules have no typical symptoms, and are often single, clear-bordered, high-density, soft tissue shadows with a diameter of less than or equal to 3cm and surrounded by pneumo-containing tissue. With the popularization and wide application of CT examination in lung cancer and the low-dose CT screening of lung cancer developed in recent years, the detection rate of lung nodules is gradually increased, and the lung nodules may represent malignant tumors such as in-situ adenocarcinoma and invasive adenocarcinoma; or a precancerous condition, such as AAH; or benign lesions including focal interstitial fibrosis or organizing pneumonia, inflammation and hemorrhage. CT manifestations of benign and malignant lesions are very similar. Retrospective studies have shown that 8 large lung cancer screening programs performed by CT images show that the prevalence of lung nodules is 8% -51% and the incidence of malignant tumors is 1.1% -12%. However, CT is only an imaging result, can only determine basic information such as the size and shape of a nodule, needs to be observed by a doctor with naked eyes, and cannot be used as a result of confirmed diagnosis depending on professional knowledge and experience of the doctor.

In order to diagnose the pulmonary nodules, the current clinical practice is: when the imaging cannot be judged, the pathological diagnosis of the nodular tissue is performed by taking the tissue by operation or performing needle biopsy. Tissue biopsy, which can diagnose whether nodules are cancerous from a cellular level, is the current gold standard for lung nodule diagnosis. However, since tissue biopsy diagnosis of lung nodules is not advocated in the clinic, there are two reasons: firstly, the size of a lung nodule is generally smaller than 3cm, and the nodule tissue can be accurately obtained by puncturing by virtue of abundant experience of a doctor; ② the operation is an invasive means with certain risk of complications. There is another auxiliary detection means in clinic, namely tumor marker. Tumor markers are generally protein markers associated with cancer. Since such protein markers are affected by the subject itself, interpretation of the results is affected. Therefore, tumor markers can only assist in the diagnosis of cancer and are less sensitive. Clinically, a detection means capable of diagnosing pulmonary nodules in a noninvasive and high-sensitivity manner is needed.

Liquid biopsy (liquid biopsy) is one of the ten major breakthrough technologies published in 2015 years by the journal MIT Technology Review, is a hot emerging field of current transformed medical research, and is expected to be used for curative effect assessment and prognosis judgment of diseases. Early studies showed that the Circulating Tumor Cell (CTC) capture analysis technique is a potential biomarker for tumor genotyping, but this technique is quite slow in clinical development. The ultrasensitive gene detection test enables detection of mutated DNA, i.e., circulating tumor DNA (ctDNA), in plasma free DNA (cfDNA) of tumor patients. ctDNA is extracellular DNA in a cell-free state, which is released into the blood circulation after shedding or apoptosis of tumor cells. In plasma cfDNA of cancer patients, ctDNA accounts for only 1%, even 0.01%. As the disease progresses, ctDNA in the blood also changes. The ctDNA in blood is dynamically monitored in real time in the disease progression process, the variation information related to tumors is obtained, the early cancer screening is carried out, and the clinical medication is guided, which is important for the diagnosis and treatment of the cancers.

The ctDNA is used as genetic information derived from tumor cells, contains tumor mutation information, changes the mutation frequency of genes along with the process of tissue canceration, analyzes the cancer related gene mutation information through a sequencing technology, and realizes the detection and monitoring of the cancer. According to the research of Evgeny Izumchenko and the like at the medical college of John Hopkins university, the lung nodules develop from adenomatous hyperplasia (AAH), in situ carcinoma (AIS) and invasive adenocarcinoma (MIA), and the mutation rate of genes such as TP53 and EGFR is obviously increased along with the continuous increase of the mutation rate of the genes caused by the canceration of cells. Differentiation of tissue lesion and tissue canceration gene mutation conditions can distinguish whether tissues of a patient are cancerated or not in diagnosis, so that misdiagnosis is avoided, and the purpose of accurate diagnosis is achieved. Furthermore, as the ctDNA derived from the peripheral blood of tumor tissue, it can also be used to distinguish whether the lung nodule is cancerated or not by detecting the different gene mutation conditions of the peripheral blood of the patient with lung nodule.

Disclosure of Invention

The invention aims to provide a kit for detecting whether a pulmonary nodule is benign or malignant by taking peripheral blood as a sample and performing high-throughput sequencing and application thereof.

In order to solve the technical problems, the invention adopts the following technical scheme:

a kit for detecting whether a lung nodule is benign or malignant, comprising: comprises the following components:

(A) a detection reagent, which is streptavidin-treated magnetic beads;

(B) a first detector component, the detector component being an autonomously designed adapter;

(C) a second detection component, which is a primer designed for 358 genes associated with lung nodules;

(D) a third detection component, which is 75642 capture probes designed for 358 genes associated with lung nodules.

In the technical scheme (A), streptavidin-treated magnetic beads are adopted to purify a sample and a PCR product.

In the technical scheme (B), the nucleotide sequence of the adapter part is:

5 '-P-ACTGNNNNNNNNNNNNNNNAGATCGGAAGACACGTCTGAACTCCAGTCACXXXXXXXXXTGAGCATACGGCAAGAAGACGAACGAACUAATGATACGGACCCGACGAGATCACTCTCTTCCCCACACACGACCGTCCGATCT-3'. In this sequence, from the 5' end, P is a phosphorylation Tag, "ACTG" is a Tag sequence, "NNNNNNNNNNNN" is a Poly N sequence, N represents a random base, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" is a hairpin sequence, "XXXXXXXX" is a first index sequence, and the same X represents a random sequence, i.e., the first index sequence is a randomly generated 8bp sequence, which is a Tag for distinguishing different samples during sequencing, "TAGAGCATACGGCAGAAGACGAAC" is a first universal primer binding sequence, "U" is dUTP, "AATGATACGGCGACCACCGAG" is a second universal primer binding sequence, "ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT" is a hairpin sequence, and the two hairpin sequences before and after annealing form a hairpin structure.

In the technical scheme (C), the primers designed for 358 genes related to pulmonary nodules include a forward primer and a reverse primer designed for site L858R of EGFR gene, and specifically include the following:

forward primer at site L858R of EGFR gene: CATACCGCAGCATGTCAACTAG, respectively;

reverse primer of EGFR gene L858R site: GAGCCCTGGTCCCTGGTGGACT are provided.

In the technical scheme (D), the 75642 capture probes designed for 358 genes associated with pulmonary nodules include an EGFR gene exon 18 upstream probe and a EGFR gene exon 18 downstream probe, which are specifically as follows:

EGFR gene No. 18 exon upstream probe:

5’-CGCAGCATGTCAAGATCACAGATTTTGGGC-3’；

EGFR gene exon 18 downstream probe:

5’-GGCCAAACTGCTGGGTGCGGAAGAGAAAGA-3’。

the method for diagnosing the pulmonary nodule by using the kit comprises the following steps:

obtaining a peripheral blood sample provided by a patient and performing separation of serum and blood cells;

(2) extracting and separating DNA of obtained serum, and performing library building, hybridization and capture on the sample DNA; capture using the kits described herein;

(3) sequencing the library captured in the step (2), analyzing data, and determining the mutated gene and mutation frequency.

75642 capture probes are independently designed for 358 genes related to lung nodules and used for regional capture of cfDNA in plasma, so that regional information is obtained.

Preferably, the capture probe has a biotin label at its 3' end. It should be noted that the biotin label can be combined with streptavidin, so that a target fragment in ctDNA can be screened, other unnecessary cfDNA fragments can be removed, and a target gene can be captured.

The application the kit only need peripheral blood sample detect, need not perform the operation or puncture and obtain the pulmonary nodule tissue, reduced the operation risk, realized not having the wound and detected. Meanwhile, 75642 capture probes for 358 genes related to lung nodules are designed to carry out region capture on cfDNA in plasma, and the generated data is subjected to big data analysis through a second generation sequencing technology, so that the mutation condition of the genes related to lung nodules is obtained.

In the present application, the 358 genes related to the pulmonary nodule comprise: a driving gene related to the growth and proliferation of lung cancer cells, an anti-cancer gene for inhibiting the growth and proliferation of cells, a related gene in a signal path, a related gene of other tumors (such as alveolar cell carcinoma, carcinoid and the like) in the lung, and a related gene of benign tumors (such as hamartoma, tuberculoma and the like). Although the genes cannot directly cause the canceration of cells, the genes indirectly influence the proliferation and differentiation of the cells, so that the information of the genes is an important reference basis for judging the benign and malignant lung nodules.

Preferably, the 358 genes associated with lung nodules include: 35 lung cancer cell proliferation and differentiation driving genes, 41 lung cancer cell proliferation and differentiation cancer suppressor genes, 89 lung cancer signal channel related genes, 124 other lung cancer related genes and 69 benign tumor related genes.

The kit takes ultra-micro cfDNA in plasma as a detection object, and the cfDNA reflects the current gene state, so that the gene mutation condition of a lung nodule patient can be reflected in real time, and the current patient can be judged to be a benign lung nodule or a malignant lung nodule (lung cancer).

It should be noted that the detection result of the kit of the present application is only used for analyzing and judging the biological information of benign lung nodules and lung cancer genes, and provides a judgment basis for distinguishing benign and malignant lung nodules.

The kit for detecting ultramicro ctDNA mutation information in peripheral blood of a detected person comprises the following steps: point mutation, gene rearrangement, amplification, deletion, insertion and the like of the lung tumor related genes, thereby providing an important analysis basis for the diagnosis of the illness state of the examined person.

It should be noted that, in the present application, cfDNA refers to DNA fragments free from peripheral blood, and these fragments include ctDNA, which is extracellular DNA in a cell-free state, and which is released after tumor cells are shed or apoptosis, and enters blood circulation. In plasma cfDNA of cancer patients, ctDNA accounts for only 1%, even 0.01%. Therefore, the application firstly proposes that 75642 capture probes are designed aiming at 358 genes related to lung nodules, and the probes are used for capturing cfDNA libraries in a large range, so that ultra-micro ctDNA can be captured sufficiently, and important information can be obtained.

Preferably, the data analysis includes removing low quality data, clipping the data, and removing polyN error information; removing low quality data includes removing mapping quality Q10 data; cutting data comprises cutting and removing the barcode data, 7-10nt behind the barcode and the last 8-10nt of reads; removing the polyN error information includes removing data of more than 20 consecutive polyNs in the data.

Compared with the prior art, the invention has the beneficial effects that:

1. the kit takes ctDNA in peripheral blood as a detection object, 75642 capture probes are designed aiming at 358 genes related to pulmonary nodules, and ctDNA gene information is read through a high-throughput sequencing platform, so that the variation condition of the genes related to the pulmonary nodules is comprehensively, accurately and timely reflected. And the ctDNA is used as a detection object, tissue biopsy is not needed, and detection can be completed only by a small amount of peripheral blood, so that noninvasive detection is really realized.

2. The detection kit provided by the invention is used for performing capture sequencing analysis on important genes related to benign and malignant lung nodules in ctDNA (deoxyribonucleic acid), and provides important basis for early disease screening of lung cancer and discrimination of benign and malignant lung nodules.

Drawings

FIG. 1 is a gel diagram showing the results of quality control and detection of cfDNA extracted from LN201601 (indicated by "1" in the figure) and LN201602 (indicated by "2" in the figure) in example 2 of the present application;

FIG. 2 is a diagram showing quality control analysis of cfDNA extracted from LN201601 in example 2 of the present application;

FIG. 3 is a diagram showing quality control analysis of cfDNA extracted from LN201602 in example 2 of the present application;

FIG. 4 is a gel diagram showing the results of quality control tests of cfDNA libraries constructed from LN201601 (shown as "A4") and LN201602 (shown as "A5") in example 2 of the present application;

FIG. 5 is a picture of the quality control analysis of the cfDNA library of LN201601 in example 2 of the present application;

FIG. 6 is a picture of quality control analysis of cfDNA library of LN201602 in example 2 of the present application;

FIG. 7 is a gel diagram showing the quality control test results of the ctDNA hybridization library in example 2 of the present application;

FIG. 8 is a diagram of quality control analysis of ctDNA hybridization library in example 2 of the present application;

FIG. 9 is a graph showing the results of mutation detection in samples numbered LN201601(Nocancer) and LN201602(Cancer) in example 2 of the present application.

Detailed Description

The lung cancer is the malignant tumor with the highest morbidity and mortality in the world, about 75% of lung cancer patients in China belong to the late stage in diagnosis, and the 5-year survival rate is about 15.6%, which is related to the lack of screening and the lack of a method for scientifically identifying lung nodules. With the widespread use of low-dose CT, the rate of lung nodule detection has increased exponentially, and conventional imaging diagnostic methods have failed to meet the requirements of accurate diagnosis for doctors and patients. Therefore, comprehensive genome analysis of lung nodules provides an important basis for screening early lung cancer.

Aiming at the phenomenon, the application creatively provides a noninvasive, accurate and real-time pulmonary nodule diagnosis gene detection kit by combining the prior technical advantages of the applicant and the urgent needs of lung cancer early screening and pulmonary nodule diagnosis in the market.

Compared with an invasive and risky detection means of operation or needle biopsy, the detection object is the micro ctDNA in the peripheral blood, a noninvasive detection method is realized, and the risk of the detection object is greatly reduced. In addition, the probe component in the detection kit of the application covers 358 genes which are known to be related to lung nodules at present and comprises 35 lung cancer cell proliferation and differentiation driving genes, 41 lung cancer cell proliferation and differentiation cancer suppressor genes, 89 lung cancer signal channel related genes, 124 other lung cancer related genes and 69 benign tumor related genes.

The subject of the present application is ctDNA, which has certain difficulties in capturing cfDNA because early cancer cells produce very low amounts of free circulating tumor DNA, even lower than 0.01% of total cfDNA, which is a lower proportion for benign lung nodules, and the half-life of cfDNA is typically only two hours. The method realizes the accurate detection of the target gene by optimizing the extraction of the cfDNA, constructing the library, hybridizing, capturing and amplifying the target cfDNA in an ultramicro manner, amplifying signals, and ensuring the high sensitivity and accuracy of low initial quantity.

In one implementation of the present application, the sequencing depth of cfDNA reaches 10,000x or more, and the average effective sequencing depth reaches 2000x, so that the sequencing sensitivity can reach 0.1%.

The terms referred to in this application are to be interpreted as follows:

the capture probe is 75642 short nucleotide sequences of 358 genes related to lung nodules, ensures that all genes related to benign lung nodules and malignant lung nodules can be covered, and carries out high-sensitivity and high-specificity capture.

Hybrid capture refers to a process of removing excess cfDNA by binding a desired cfDNA fragment from a large amount of cfDNA using a designed 358 gene probe.

PCR amplification refers to the amplification of DNA fragments by using PCR technology, so that ultra-micro DNA fragments are amplified into a certain amount of DNA fragments to meet the experimental requirements.

The present application is described in further detail below with reference to specific embodiments and the attached drawings. The following examples are intended to be illustrative of the present application only and should not be construed as limiting the present application.

Example 1: composition of kit for detecting benign or malignant pulmonary nodules

Table 1: composition of kit for detecting benign or malignant pulmonary nodules

Numbering	Name (R)	Volume of	Specification of
				A	Streptavidin magnetic bead	5mL	24 times of
B	Adapter	120μL	24 times of
				C	PCR primer	2OD	24 times of
D	Pulmonary nodule 358 gene probe	24μL	24 times of
				E	H2O	2mL

Table 1 above defines the composition of a kit for detecting whether a lung nodule is benign or malignant, and the components of the kit are further described below:

A) the streptavidin magnetic bead in the reagent kit is purified from a sample and a PCR product by a magnetic bead adsorption method of streptavidin treatment. Can be specifically combined with biotin at the 3' end of the probe, and has the effect of purifying and enriching PCR products.

B) The adapter in the kit is designed by the applicant, and the nucleotide sequence of part of the adapter is as follows:

5 '-P-ACTGNNNNNNNNNNNNNNAGAGTCGGAAGAGCACACACTGTGAACTCCAGTCACXXXXXXXXXTGAGCATACGGCAAGAAGACGAACUAATGATACGGACCCGACGAGATCACTCTCTTCCCTACGACGACCGCTCTTCCGATCT-3' (SEQ ID NO: 1). In this sequence, from the 5' end, P is a phosphorylation Tag, "ACTG" is a Tag sequence, "NNNNNNNNNNNN" is a Poly N sequence, N represents a random base, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" is a hairpin sequence, "XXXXXXXX" is a first index sequence, and the same X represents a random sequence, i.e., the first index sequence is a randomly generated 8bp sequence, which is a Tag for distinguishing different samples during sequencing, "TAGAGCATACGGCAGAAGACGAAC" is a first universal primer binding sequence, "U" is dUTP, "AATGATACGGCGACCACCGAG" is a second universal primer binding sequence, "ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT" is a hairpin sequence, and the two hairpin sequences before and after annealing form a hairpin structure. The adapter sequence of this example was synthesized by life technology.

C) The primers designed for 358 genes related to lung nodules in the kit comprise a forward primer and a reverse primer designed for an EGFR gene L858R locus, and specifically comprise the following steps:

forward primer at site L858R of EGFR gene: CATACCGCAGCATGTCAACTAG (SEQ ID NO: 2);

reverse primer of EGFR gene L858R site: GAGCCCTGGTCCCTGGTGGACT (SEQ ID NO: 3).

D) 75642 capture probes designed for 358 genes related to pulmonary nodules are arranged in the kit, wherein an upstream probe and a downstream probe of an EGFR gene No. 18 exon are specifically as follows:

EGFR gene No. 18 exon upstream probe:

5’-CGCAGCATGTCAAGATCACAGATTTTGGGC-3’(SEQ ID NO：4)；

EGFR gene exon 18 downstream probe:

5’-GGCCAAACTGCTGGGTGCGGAAGAGAAAGA-3’(SEQ ID NO：5)。

the kit comprises a detection component of a primer designed aiming at 358 genes related to the pulmonary nodule, wherein the 358 genes related to the pulmonary nodule comprise: a driving gene related to the growth and proliferation of lung cancer cells, an anti-cancer gene for inhibiting the growth and proliferation of cells, a related gene in a signal path, a related gene of other tumors (such as alveolar cell carcinoma, carcinoid and the like) in the lung, and a related gene of benign tumors (such as hamartoma, tuberculoma and the like). In particular to 35 lung cancer cell proliferation and differentiation driving genes, 41 lung cancer cell proliferation and differentiation cancer suppressor genes, 89 lung cancer signal channel related genes, 124 other lung cancer related genes and 69 benign tumor related genes.

The lung nodule related gene screening method comprises the following steps:

(1) integrating the existing literature and report aiming at the sequencing of the sample of the pulmonary sarcoidosis case, and integrating the somatic mutation gene in each literature;

(2) the preferential screening genes integrated in each document are integrated together, screening is carried out, and the repetitive genes are removed.

Although the genes cannot directly cause the canceration of cells, the genes indirectly influence the proliferation and differentiation of the cells, so that the information of the genes is an important reference basis for judging the benign and malignant lung nodules.

Example 2: pulmonary nodule Gene detection in two patients (benign pulmonary nodule sample numbering LN201601 and malignant pulmonary nodule sample LN201602, respectively)

The detection method comprises the following steps:

1. a blood sample from a patient is taken and isolated, as follows:

the peripheral blood taken needs to be stored at 4 ℃ and processed within two hours.

(1) The cells were centrifuged at 1600g for 10min at 4 ℃ and the supernatant (plasma) was dispensed into 2.0mL centrifuge tubes. Subpackaging the lower layer blood cells into 2mL freezing tubes to obtain the required blood cells;

(2) centrifuging at 16000g for 10min at 4 deg.C to remove residual cells, and transferring the supernatant into a new 2.0mL centrifuge tube to obtain the desired plasma. The samples were then stored in a-80 ℃ freezer or dry ice to be assayed.

2. Extracting cfDNA from the separated serum, extracting or purifying the nucleic acid by Ningbo City Yongding biotechnology Limited according to the kit instruction.

Quality control of cfDNA: the concentration of each sample was determined using qubit2.0 and the fragment size of cfDNA was detected using Agilent 2100.

The results showed that about 10mL of peripheral blood was collected from both LN201601 and LN201602 samples, 4.5mL and 5mL of plasma were isolated, and 2.1 ng/. mu.L and 3.6 ng/. mu.L of cfDNA were isolated; the size running chart of the extracted cfDNA fragment is shown in figure 1, and the size distribution of the cfDNA fragment of two samples is shown in figures 2 and 3 through analysis of a detection instrument with software, wherein an obvious peak exists at 180bp, and a small peak exists at 320bp, so that the cfDNA fragment meets the characteristics of the cfDNA, and the quality control of the cfDNA is qualified.

3. Leukocyte DNA (gDNA) extraction and fragmentation

It is noted that sequencing and analysis of gDNA is a necessary analysis for this application to filter out genetic mutations in cfDNA as a control for subsequent analysis of cfDNA.

3.1 extraction of leukocyte DNA from blood cells was carried out using a blood genome DNA extraction kit from Tiangen Biochemical technology (Beijing) Ltd, and gDNA was extracted according to the kit instructions.

3.2 the leukocyte gDNA extracted is cut by NEBNext dsDNA Fragments, then is recovered and purified by an OMEGA Gel Extraction Kit, and the fragment of about 100-250bp is collected. The concentration of the recovered fragmented DNA was determined by Qubit2.0.

The results show fragmented gDNA after recovery of LN201601 and LN201602 samples.

The total amount is 242ng and 158ng respectively, and the requirement of library construction initial amount is met.

4. Extracting cfDNA and fragmented gDNA for end repair, connecting A-tailing with Adapter, constructing a Library of Pre-PCR reaction system DNA by adopting Kapa Biosystems KAPA HTP Library Preparation Kit, the operation process refers to an instruction book, and related reaction components are configured according to the instruction book; it is noted that the primers used in PCR and the attached Adapter are components of the kit of the present application.

Quality control of the library: the library was quantified by qubit2.0, the concentration of each sample was determined, and the DNA library fragment size was detected using Agilent 2100.

The results showed that the cfDNA library concentrations of the LN201601 and LN201602 samples were 53.2 ng/. mu.L and 65.2 ng/. mu.L, respectively, at 25. mu.L volumes each. The fragment size running map of the cfDNA library is shown in fig. 4, and the fragment size distribution of the cfDNA library of two samples is shown in fig. 5 and fig. 6 by analysis of the detection instrument with software, and an obvious peak is present around 300bp, because the two-end adaptors add up to 120bp, which is approximately 300bp together with the target fragment, which indicates that the constructed cfDNA library is qualified.

5. The hybridization capture of the target fragment and the DNA sequencing capture are carried out by utilizing a hybridization Kit SeqCap EZ Library Kit of Roche, and the specific operation is carried out according to the instructions of the Roche hybridization Kit, wherein a capture probe of the DNA target fragment is a Kit component of the application.

Quality control of the DNA library: the Qubit concentration measuring reagent was prepared, the concentration of each sample was measured, and the fragment size of the DNA library was detected by using Agilent 2100.

The results showed that the concentration of LN201601 and LN201602 samples after hybridization was 24 ng/. mu.L for a total of 25. mu.L. The fragment size running map of the library after the hybridization of the ctdnas of the two samples is shown in fig. 7, the fragment size distribution of the cfDNA library after the hybridization of the two samples is shown in fig. 8 through the analysis of the software carried by the detection instrument, and an obvious peak is formed around 300 bp. As the regions captured by the probes are the target fragment and the joint region, the sizes of the fragments are not changed, so that the sizes of the fragments after hybridization are not changed, and the requirements are met.

6. Sequencing the captured DNA library, performing bioinformatics analysis on the sequencing result, taking variation information, genotype information, SNP (single nucleotide polymorphism) and INDEL (intrinsic negative end effector) and the like, and further correcting and filtering the variation information to obtain higher-quality variation information.

7. And (4) analyzing results: FIG. 9 is a graph showing the results of mutation detection in both LN201601 and LN201602 samples. The average sequencing depth of the LN201601 and LN201602 samples after filtration exceeds 2000x, the requirement of data analysis is met, the total gene mutation number detected by the analyzed LN201601 sample is 12, while the total gene mutation number of the LN201602 sample reaches 134 and exceeds 10 times of the LN201601 sample, therefore, the LN201601 sample is judged to be a benign lung nodule, and the LN201602 sample is judged to be a malignant lung nodule. Since benign lung nodule cells are not yet cancerated, gene mutations are few theoretically, while cell canceration caused by multiple factors is caused by a plurality of gene mutations, and the number of gene mutations of a general malignant lung nodule sample is relatively large. And the pathological detection result also verifies the correctness of the pulmonary nodule gene detection. The reliability of the test kit to distinguish between benign and malignant lung nodules is demonstrated.

The foregoing is a more detailed description of the present application in connection with specific embodiments thereof, and it is not intended that the present application be limited to the specific embodiments thereof. For those skilled in the art to which the present application pertains, several simple deductions or substitutions may be made without departing from the concept of the present application, and all should be considered as belonging to the protection scope of the present application.

SEQUENCE LISTING

<110> Shenzhen Shanpulos Biotech Co., Ltd

<120> method for detecting cfDNA mutation information in peripheral blood of subject

<140> 202110262383X

<141> 2017-06-07

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 141

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (5)...(16)

<223> n is a, c, g, or t

<400> 1

actgNNNNNN NNNNNNagat cggaagagca cacgtctgaa ctccagtcac XXXXXXXXta 60

gagcatacgg cagaagacga acuaatgata cggcgaccac cgagatctac actctttccc 120

tacacgacgc tcttccgatc t 141

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

cataccgcag catgtcaact ag 22

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

gagccctggt ccctggtgga ct 22

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

cgcagcatgt caagatcaca gattttgggc 30

<210> 5

<211> 30

<212> DNA

<213> Artificial sequence

<400> 5

ggccaaactg ctgggtgcgg aagagaaaga 30

Claims (10)

1. A method of detecting cfDNA mutation information in peripheral blood of a subject, comprising: performing DNA extraction on the peripheral blood sample to obtain cfDNA in the peripheral blood sample; constructing a library based on cfDNA to obtain a cfDNA library; performing hybridization capture based on the cfDNA library to obtain a target sequence; carrying out gene sequencing on the target sequence to obtain sequencing data; performing data analysis based on the sequencing data to obtain mutation information;

wherein, performing library construction based on cfDNA comprises performing adaptor ligation, PCR primer ligation and amplification on the cfDNA; the adaptor comprises a Tag sequence, a Poly N sequence, a first hairpin sequence, a second hairpin sequence, a first index sequence, a first universal primer binding sequence, a second universal primer binding sequence and dUTP, wherein the first index sequence is used for distinguishing different peripheral blood samples, the Tag sequence is ACTG, the Poly N sequence is NNNNNNNNNNNN, the first hairpin sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, the second hairpin sequence is ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, the first index sequence is XXXXXXXXXXXXX, the first universal primer binding sequence is TAGAGCATACGGCAGAAGACGAAC, the second universal primer binding sequence is AATGATACGGCGACCACCGAG, and the 5' end of the adaptor is provided with a phosphorylation label; the PCR primers comprise a forward primer and a reverse primer which are designed aiming at the 18 th exon of the EGFR gene and a forward primer and a reverse primer which are designed aiming at the L858R locus of the EGFR gene, wherein the sequence of the forward primer aiming at the L858R locus of the EGFR gene is SEQ ID NO. 2, and the sequence of the reverse primer aiming at the L858R locus of the EGFR gene is SEQ ID NO. 3;

performing hybrid capture based on the cfDNA library comprises capturing the cfDNA library by using a capture probe to obtain the target sequence, wherein the capture probe comprises an upstream probe and a downstream probe aiming at the 18 th exon of the EGFR gene and an upstream probe and a downstream probe aiming at the L858R site of the EGFR gene, the upstream probe sequence aiming at the L858R site of the EGFR gene is SEQ ID NO. 4, and the downstream probe sequence aiming at the L858R site of the EGFR gene is SEQ ID NO. 5;

the data analysis comprises removing low-quality data, cutting data and removing polyN error information, wherein the removing of the low-quality data comprises removing data with mapping quality Q10, the cutting data comprises cutting data of the joint, data 7-10nt behind the joint and data 8-10nt last reads, and the removing of the polyN error information comprises removing more than 20 continuous polyN data in the data.

2. The method of claim 1, wherein:

the linker comprises the nucleotide sequence: 5 '-P-ACTGNNNNNNNNNNNNNNNAGATCGGAAGACACGTCTGAACTCCAGTCACXXXXXXXXXTGAGCATACGGCAAGAAGACGAACGAACUAATGATACGGACCCGACGAGATCACTCTCTTCCCCACACACGACCGTCCGATCT-3'.

3. The method of claim 1,

the PCR primers also include primers designed for the pulmonary nodule-associated gene.

4. The method of claim 1,

the capture probes also include probes designed for lung nodule-associated genes.

5. The method of claim 3 or 4,

the lung nodule related genes comprise a driving gene related to the proliferation and differentiation of lung cancer cells, an anti-cancer gene for inhibiting the growth and proliferation of the lung cancer cells, a lung cancer signal path related gene, other lung tumor related genes and a benign tumor related gene.

6. The method of claim 1,

the 3' end of the capture probe has a biotin label.

7. The method of claim 1,

in the linker, the first hairpin sequence and the second hairpin sequence form a hairpin structure.

8. The method of claim 1,

the Poly N sequence is a random base sequence, and the first index sequence is a random sequence of 8 bp.

9. The method of claim 1,

detecting cfDNA mutation information in peripheral blood of the subject, including information of mutation types of point mutation, gene rearrangement, amplification, deletion, insertion.

10. The method of claim 9, wherein the determination of benign or malignant lung nodules is made based on the number of point mutations, gene rearrangements, amplifications, deletions, and insertions detected.

Images