CN112941172B

CN112941172B - Primer probe composition for detecting TNNC1 gene mutation and application thereof

Info

Publication number: CN112941172B
Application number: CN202110401301.5A
Authority: CN
Inventors: 赵跃; 张世梅
Original assignee: Dali University
Current assignee: Dali University
Priority date: 2021-04-14
Filing date: 2021-04-14
Publication date: 2022-05-31
Anticipated expiration: 2041-04-14
Also published as: CN112941172A

Abstract

The invention relates to a primer probe composition for detecting TNNC1 gene mutation and application thereof, wherein the primer probe composition comprises a primer and a probe for detecting TNNC1 gene mutation site c.19G > C, the primer comprises nucleic acid sequences shown in SEQ ID NO. 1-2, the probe comprises a wild type probe and a mutant type probe, the wild type probe comprises a nucleic acid sequence shown in SEQ ID NO.3, and the mutant type probe comprises a nucleic acid sequence shown in SEQ ID NO. 4. The primer probe composition has high specificity and sensitivity, can be used for carrying out real-time fluorescent PCR (polymerase chain reaction) on a new mutation site c.19G > C of a TNNC1 gene, and can realize simple, quick, accurate and economic judgment of the genotype.

Description

Primer probe composition for detecting TNNC1 gene mutation and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a primer probe composition for detecting TNNC1 gene mutation and application thereof, in particular to a primer probe composition for detecting TNNC1 gene mutation site c.19G > C and application thereof.

Background

Hypertrophic Cardiomyopathy (HCM) is a common and complex hereditary heart disease, and no effective treatment method except heart transplantation exists at present, so that serious economic burden is caused to families and society. The main pathological feature of HCM is asymmetric thickening of left ventricle, bifurcate or ventricular septum, normally, the cardiomyocytes are regularly assembled into parallel linear muscle fibers, but the muscle fibers of HCM patients are short, wide, thick, diffuse and disordered, and can cause diastolic dysfunction. The pathogenesis of HCM often occurs in a family-focused manner, based on molecular genetics as gene mutations.

Troponin is located on actin filaments, is a central regulatory protein of striated muscle contraction, and comprises three subunits of troponin T2, troponin I3 and troponin C1(Cardiac tropin C1, and the coding gene is TNNC 1). The TNNC1 gene (GenBank: NG-008963.1) is located on the long arm 3p21.1 of chromosome 3, has a total length of 2951bp, totally encodes 161 amino acids and is used for encoding Ca²⁺One of the most important genes of the trapping sensitive protein, TNNC1 gene structure and function, determines whether thick and thin myofilaments can slide normally. The research shows that after the TNNC1 gene is mutated, the Ca-pair of muscle fibers can be increased²⁺Trapping of (2) and promoting Ca²⁺Circulatory disturbance, compensatory hypertrophy of cardiac myocytes, and finally HCM.

Gene detection and family screening of HCM patients can provide important guidance for clinical diagnosis, which is mainly embodied as: (1) prenatal diagnosis, guiding prepotency; (2) assisting in definite diagnosis and carrying out clinical intervention; (3) and (4) family screening, and performing family disease occurrence risk assessment and management.

At present, the detection method of genetic disease gene mutation comprises the following steps: PCR-RFLP analysis, SNP shot multiplex PCR technology, nucleic acid molecule hybridization and fluorescence quantitative PCR, high resolution dissolution curve analysis, capillary electrophoresis sequencing, high-throughput sequencing and other methods. The capillary electrophoresis technology is the gold standard for gene mutation detection, but is difficult to popularize from a laboratory to clinic due to the defects of high requirement on equipment, high price and the like, and the fluorescent quantitative PCR has the characteristics of rapidness, simplicity, convenience, economy, accuracy and the like.

CN102965428A discloses a kit for detecting genetic cardiac hypertrophy related gene mutation samples, aiming at all exon fragments of genes ACTC1, ACTN2, BRAF, CALR3, CASQ2, CSRP3, GLA, HRAS, JPH2, KRAS, LAMP2, LDB3, MAP2K1, MYBPC3, MYH6, MYH7, MYL2, MYL3, MYLK2, MYOZ2, PRKAG2, RAF1, SOS1, TCAP, TNNC1, TNNI3, TNNT2, TPM1, TTN, TTR and VCL, but the process is very tedious, the time consumption is long, and the price is very expensive depending on a large-scale gene sequencing platform.

In conclusion, the number of mutation sites causing HCM disease is large, and early molecular detection and prevention are particularly critical, so that a simple, rapid, economic and accurate mutation screening method is established, and the method has important significance for prevention, auxiliary clinical diagnosis and prognosis evaluation of HCM.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a primer probe composition for detecting TNNC1 gene mutation and application thereof, the primer probe composition is used for carrying out real-time fluorescence PCR, and the mutation genotype can be judged according to the result of a fluorescence signal, so that the primer probe composition is convenient and economic, and has important significance for prevention, auxiliary clinical diagnosis and prognosis evaluation of HCM.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a primer probe composition for detecting TNNC1 gene mutation, which comprises a primer and a probe for detecting a new mutation site c.19G > C of a TNNC1 gene (a 19 th base G of a coding region of the gene is mutated into C), wherein the primer comprises a nucleic acid sequence shown in SEQ ID NO. 1-2, the probe comprises a wild type probe and a mutant type probe, the wild type probe comprises a nucleic acid sequence shown in SEQ ID NO.3, and the mutant type probe comprises a nucleic acid sequence shown in SEQ ID NO. 4.

SEQ ID NO.1 (forward primer): 5'-GGCAGGGCTATTTAAGTCAAGG-3' are provided.

SEQ ID No.2 (reverse primer): 5'-AAGGCACGTAGGCCTTCTCCTTG-3' are provided.

SEQ ID NO.3：GATGACATCTACAAGGCTGCGGTA。

SEQ ID NO.4：ATGACATCTACAAGCCTGCGGTAG。

According to the invention, the primer has high specificity, can specifically amplify a sequence (210bp) containing a mutation site, the probe also has high specificity, the wild type probe and the mutant type probe are respectively and specifically combined with the wild type site and the mutant type site, and the wild type probe and the mutant type probe are adopted, so that the gene mutation and the mutant genotype can be judged in one real-time fluorescent PCR reaction, and thus, the rapid and low-cost detection is realized, and the detection result has high accuracy.

Preferably, the probe is a Taqman probe.

Preferably, the 5' end of the nucleic acid sequence of the Taqman probe is marked with a fluorescent group.

Preferably, the 3' end of the nucleic acid sequence of the Taqman probe is marked with a quenching group.

Preferably, the fluorophore comprises FAM or HEX.

Preferably, the quencher group comprises MGB.

Preferably, the fluorescent group labeled at the 5 'end of the nucleic acid sequence of the wild-type probe is different from the fluorescent group labeled at the 5' end of the mutant-type probe.

Preferably, the fluorescent group labeled at the 5' end of the nucleic acid sequence of the wild-type probe is FAM.

Preferably, the fluorescent group labeled at the 5' end of the nucleic acid sequence of the mutant probe is HEX.

In the artificial diploid organism, cells contain two groups of chromosomes, so that three mutant genotypes are available, wherein the 19 th base G of the coding region of the gene in 2 genes is mutated into C (TNNC1-19CC), the 19 th base G of the coding region of the gene in 2 genes is not mutated (TNNC1-19GG), and the 19 th base G of the coding region of the gene in 1 gene is mutated into C (TNNC1-19 GC).

In a second aspect, the invention provides the use of the primer probe composition according to the first aspect in the preparation of a product for detecting a pathogenic gene of hypertrophic cardiomyopathy.

In a third aspect, the invention provides a kit for detecting mutation of the TNNC1 gene, which comprises the primer probe composition for detecting mutation of the TNNC1 gene in the first aspect.

Preferably, the kit further comprises a PCR reaction solution and/or a dye.

Preferably, said PCR reaction solution comprises DNA polymerase and Mg²⁺Buffer, dNTPs and water.

Preferably, the dye comprises a Rox correction dye.

Preferably, the kit further comprises a quality control product.

Preferably, the quality control product comprises a wild-type quality control product, a mutant quality control product and a hybrid mutant quality control product.

The kit comprises a primer probe composition with high specificity and sensitivity and a PCR reaction system, and can conveniently prepare a real-time fluorescent PCR system.

Preferably, the preparation method of the quality control product comprises the following steps:

(1) performing PCR amplification by taking a wild type or mutant genome as a template, wherein the nucleic acid sequence of a primer amplified by the PCR is shown as SEQ ID NO.5 and SEQ ID NO.6, the amplification length is 401bp, the reaction procedure of the PCR amplification is shown as table 1, and purifying a PCR product;

SEQ ID NO.5：5’-ACTCAGGCCAGCCTGAGATCACT-3’；

SEQ ID NO.6：5’-ACCTCCTCCACCACCCTTCAGAC-3’；

TABLE 1

(3) Respectively cloning the purified fragments onto a vector, transforming the vector into escherichia coli, selecting monoclone, screening out positive clone strains, and extracting plasmids;

(4) carrying out capillary electrophoresis detection on the plasmid vector containing the cloned target fragment by using a capillary electrophoresis apparatus;

(5) and (2) analyzing the variable sites by using DNAstar sequence analysis software by taking the gene sequence of the hg19 human genome target gene TNNC1 as a template to obtain a wild type quality control product (plasmid containing wild type fragments) and a mutant type quality control product (plasmid containing mutant fragments), and mixing the wild type quality control product and the mutant type quality control product according to the molar ratio of 1:1 to obtain the heterozygous mutant type quality control product.

The genotype of the quality control product is known, and the quality control product can be used for verifying the specificity and reliability of the primer probe composition.

In a third aspect, the present invention provides a method for using the kit for detecting TNNC1 gene mutation according to the second aspect for the purpose of non-disease diagnosis and/or treatment, the method comprising:

and extracting a genome, taking the genome as a template, carrying out real-time fluorescence PCR detection by using the kit for detecting the TNNC1 gene mutation, and analyzing the result.

Preferably, the genome is derived from any one of or a combination of at least two of human peripheral blood, myocardial tissue, lymphoid organs, spleen, bone marrow, or liver.

Preferably, the reaction conditions for the real-time fluorescent PCR detection include:

pre-denaturation: 93-98 deg.C (such as 94 deg.C, 95 deg.C, 96 deg.C or 97 deg.C), 25-35 s (such as 26s, 27s, 28s, 29s, 30s, 31s, 32s, 33s or 34 s);

and (3) cyclic extension: 93-98 deg.C (such as 94 deg.C, 95 deg.C, 96 deg.C or 97 deg.C) denaturation for 3-7 s (such as 4s, 5s or 6s), 63-65 deg.C annealing and extension for 30-40 s (such as 31s, 32s, 33s, 34s, 35s, 36s, 37s or 38s), 35-45 cycles (such as 36, 37, 38, 40, 42, 43 or 44);

circulating external extension: 59-61 ℃ for 1-3 min.

In a preferred embodiment, the kit for detecting TNNC1 gene mutation is used for non-disease diagnosis and/or treatment, and the method comprises:

extracting a genome, taking the genome as a template, and carrying out real-time fluorescence PCR detection by using the kit for detecting TNNC1 gene mutation, wherein the detection reaction conditions comprise: pre-denaturation at 93-98 ℃ for 25-35 s; denaturation at 93-98 ℃ for 3-7 s, annealing at 63-65 ℃ and extension for 30-40 s, and 35-45 cycles; extending for 1-3 min at 59-61 ℃, and analyzing the result.

Compared with the prior art, the invention has the following beneficial effects:

(1) the primer probe composition has high specificity and sensitivity, can be used for carrying out real-time fluorescent PCR (polymerase chain reaction) on a new mutation site c.19G > C of a TNNC1 gene, and can realize simple, quick, accurate and economic judgment of the genotype;

(2) the kit is simple, convenient and low in cost, can be efficiently applied to real-time fluorescence PCR, and has the advantages that the obtained result accuracy can reach 100 percent, and the repeatability is good.

Drawings

FIG. 1 shows the amplification results of the genomic templates of the samples in example 1, wherein M is DNA molecular weight marker, negative is negative control, and 1 and 2 are two technical repetitions;

FIG. 2 is a diagram showing the capillary electrophoresis detection of the wild-type quality control TNNC1, c.19G;

FIG. 3 shows capillary electrophoresis detection of a mutant control TNNC1, c.19C;

FIG. 4 is an amplification curve of a sensitivity test for primer probes of the TNNC1-19GG genotype;

FIG. 5 is a standard curve for the sensitivity test of primer probes of the TNNC1-19GG genotype;

FIG. 6 is an amplification curve of the sensitivity test of the primer probe for TNNC1-19CC genotype;

FIG. 7 is a standard curve for the sensitivity test of primer probes for the TNNC1-19CC genotype;

FIG. 8 is an amplification curve of specific detection of a primer probe using a wild-type quality control as a template, in which FAM represents a wild-type probe and HEX represents a mutant-type probe;

FIG. 9 is an amplification curve of specific detection of a primer probe using a mutant quality control as a template, in which FAM represents a wild-type probe and HEX represents a mutant-type probe;

FIG. 10 is an amplification curve of specific detection of a primer probe using a heterozygous mutant type quality control as a template, wherein FAM represents a wild type probe and HEX represents a mutant type probe;

FIG. 11 is a distribution of a scattergram for specific detection using different genotypes as templates, wherein the abscissa represents the base C and the ordinate represents the base G;

FIG. 12 is a distribution of a genotyping scattergram of TNNC1, c.19G > C mutation sites detected by real-time fluorescence for 22 patients with hypertrophic cardiomyopathy of known genotypes, wherein the abscissa represents the base C and the ordinate represents the base G.

Detailed Description

The technical solutions of the present invention are further described by the embodiments with reference to the drawings, but the present invention is not limited to the scope of the embodiments. The reagents and methods used in the examples were, unless otherwise specified, those which were conventional and those which were conventional were used.

In the embodiment of the invention, the clinical sample is from a hypertrophic cardiomyopathy patient, and the patient signs an informed consent which is approved by medical ethics committee of university; a small genome extraction kit was purchased from Axygen; ex Taq PCR reaction solution was purchased from TaKaRa; the DNA purification kit is purchased from Shanghai worker; PCR reaction solution is purchased from Dalibao organisms; rox calibration dyes were purchased from a Dalibao organism.

Example 1

Referring to 2011 guidelines for diagnosing hypertrophic cardiomyopathy of the American Heart Association, peripheral venous blood of 1 familial hypertrophic cardiomyopathy proband (a patient signs an informed consent and is approved by the medical ethics Commission of university of China) clinically diagnosed in the cardiovascular department of medicine is obtained, genomes of the hypertrophic cardiomyopathy proband are extracted, a pathogenic mutation site related to HCM pathogenesis is searched through a whole exon sequencing technology, a new mutation site related to HCM, namely TNNC1, c.19G > C (19 th base G of a coding region of a gene is mutated into C) is discovered through comparison and analysis of sequencing results, the mutation causes the change of A7P of amino acid of a TNNC1 gene, and the new mutation site is detected and verified by a mutation screening method of real-time fluorescence PCR.

This example constructs positive quality control of wild type and mutant type, including the following steps:

(1) and (3) extracting a genome: draw 1mL patientPeripheral venous blood, after anticoagulation with EDTA, whole genome was extracted using a commercial small-scale genome extraction kit (Axygen, USA), subjected to agarose gel electrophoresis, and concentration and OD value were measured, OD_260/280Is available between 1.8 and 2.0;

(2) performing PCR amplification by using the genome in the step (1) as a template, wherein the nucleic acid sequence of the PCR amplification primer is shown as SEQ ID No.5 (5'-ACTCAGGCCAGCCTGAGATCACT-3') and SEQ ID No.6 (5'-ACCTCCTCCACCACCCTTCAGAC-3'), the amplification length is 401bp, the reaction conditions of the PCR amplification are shown in Table 2, and the reaction system of the PCR amplification is as follows:

taking sterile water as a template to carry out amplification as negative control, repeating the technology twice, carrying out agarose gel electrophoresis after the PCR amplification reaction is finished, and displaying that the size of a target fragment is consistent with the expected size as shown in figure 1 by an electrophoresis result, and purifying the target fragment by using an agarose gel DNA purification kit;

TABLE 2

(3) Cloning the purified fragment onto a PMD-18T vector, transforming into Escherichia coli JM109, selecting a single clone, screening out a positive clone strain, and extracting a plasmid of the positive clone strain;

(4) carrying out capillary electrophoresis detection on the plasmid vector containing the cloned target fragment by using an ABI3130 capillary electrophoresis apparatus;

(5) the mutant site was analyzed by using DNAstar sequence analysis software with reference to the gene sequence of hg19 human genome target gene TNNC1 as a template.

As can be seen from the capillary electrophoresis sequencing results shown in FIGS. 2 and 3, the wild-type quality control product (plasmid containing wild-type fragment) and the mutant-type quality control product (plasmid containing mutant fragment) were successfully constructed, and the wild-type quality control product and the mutant-type quality control product were mixed at a molar ratio of 1:1 to obtain the heterozygous mutant-type quality control product.

Example 2

This example demonstrates the sensitivity and specificity of the primer probe compositions of the invention.

(1) Sensitivity and repeatability of primer probe compositions

The wild type and the mutant type of the TNNC1 gene c.19G > C are respectively diluted by 10 times of gradient and used as templates, the primer probe composition is adopted to carry out real-time fluorescent PCR detection (ABI7500 real-time fluorescent PCR instrument), the reaction system is shown in table 3, the reaction conditions are shown in table 4, and the sensitivity of the primer probe composition is checked.

TABLE 3

Reaction components	Addition amount (μ L)
		PCR reaction solution	5
Rox correction dyes	0.1
		Forward primer	0.5
Reverse primer	0.5
		Wild-type probe	0.5
Mutant probe	0.5
		Form panel	0.8
Purified water	2.1

TABLE 4

As shown in FIGS. 4-7, the fluorescence threshold (Ct) value begins to increase with the decrease of the initial copy number of the template, and the linear relationship of the standard curve is better (R)²>0.98), the results show that the primer probe composition has higher amplification efficiency and sensitivity.

Subsequently, the reproducibility was verified, 3 replicates (inter-and intra-batch repeats) were performed, the Ct value of the template was observed, the coefficient of variation (p) was calculated as Standard Deviation (SD)/mean (X), and the sensitivity and reproducibility of the detection method were tested.

The results of the inter-and intra-batch replicates are shown in tables 5 and 6, respectively.

TABLE 5

TABLE 6

As can be seen from tables 5 and 6, the inter-lot and intra-lot repeat variation coefficients were less than 2%, indicating that the primer probe composition of the present invention has good reproducibility.

(2) Specificity of primer Probe composition

The results of real-time fluorescence PCR detection using the wild type, mutant and heterozygous mutant quality control samples prepared in example 1 as templates are shown in FIGS. 8 to 11, as shown in tables 3 and 4.

The wild-type sample response curve in FIG. 8 shows an increase in the fluorescence signal generated by the wild-type probe (FAM) and a very low fluorescence signal generated by the mutant probe (HEX); the curves for the mutant sample reactions in FIG. 9 show that only the mutant probes produce fluorescent signals, while the wild-type probes only have low fluorescent signals; the heterozygous mutant sample in FIG. 10 enables both the wild-type and mutant probes to show relatively high fluorescence signals; in addition, as shown in fig. 11, it is evident from the scattergram of the reaction results that samples of different genotypes are clustered individually, indicating that the primer probe composition of the present invention has high specificity, and can determine the mutant genotype according to the fluorescent signal result.

Example 3

In this example, TNNC1, c.19G > C mutation detection was performed on 22 patients with hypertrophic cardiomyopathy (known genotype sequenced by capillary electrophoresis, patient informed consent, and approved by university of medicine ethical Committee), and real-time fluorescence PCR reaction was performed using the kit of the present invention as described in tables 3 and 4, and the results were analyzed based on fluorescence signals, wherein GG genotype: the fluorescent probe has higher FAM fluorescent signal and lower HEX fluorescent signal; GC genotype: the difference between FAM fluorescence signal and HEX fluorescence signal is not large; CC genotype: has higher HEX fluorescence signal and lower FAM fluorescence signal. As shown in the genotyping scattergram of FIG. 12, the detection results were consistent with those of the capillary electrophoresis sequencing with an accuracy of 100% in 18 cases of GG genotypes, 2 cases of GC genotypes, and 2 cases of CC genotypes.

In conclusion, the primer probe composition has high specificity and sensitivity, can be used for carrying out real-time fluorescence PCR (polymerase chain reaction) on the TNNC1 new mutation site c.19G > C, and can realize simple, quick, accurate and economic judgment on the genotype; the detection kit has the advantages of high amplification efficiency and sensitivity, good repeatability and specificity, simple operation, high accuracy, capability of detecting a plurality of samples at one time, low cost, short time consumption and extremely high application value.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> university of university

<120> primer probe composition for detecting TNNC1 gene mutation and application thereof

<130> 20210402

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

ggcagggcta tttaagtcaa gg 22

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

aaggcacgta ggccttctcc ttg 23

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

gatgacatct acaaggctgc ggta 24

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

atgacatcta caagcctgcg gtag 24

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence

<400> 5

actcaggcca gcctgagatc act 23

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence

<400> 6

acctcctcca ccacccttca gac 23

Claims

1. A primer probe composition for detecting TNNC1 gene mutation is characterized by comprising a primer and a probe for detecting a mutation site c.19G > C of which the position corresponds to 5045 th base of TNNC1 gene with the number of GenBank: NG-008963.1;

the nucleic acid sequence of the primer is shown as SEQ ID NO. 1-2;

the probes comprise wild type probes and mutant probes;

the nucleic acid sequence of the wild probe is shown as SEQ ID NO. 3;

the nucleic acid sequence of the mutant probe is shown as SEQ ID NO. 4.

2. The primer probe composition of claim 1, wherein the probe is a Taqman probe.

3. The primer probe composition of claim 2, wherein the 5' end of the nucleic acid sequence of the Taqman probe is labeled with a fluorescent group.

4. The primer probe composition of claim 2, wherein the Taqman probe is labeled at the 3' end with a quencher.

5. The primer probe composition of claim 3, wherein the fluorophore comprises FAM or HEX.

6. The primer-probe composition of claim 4, wherein the quencher group comprises MGB.

7. The primer probe composition of claim 1, wherein the wild-type probe has a fluorophore labeled at the 5 'end of the nucleic acid sequence that is different from the fluorophore labeled at the 5' end of the mutant-type probe.

8. The primer probe composition of claim 7, wherein the fluorescent group labeled at the 5' end of the nucleic acid sequence of the wild-type probe is FAM.

9. The primer probe composition of claim 7, wherein the fluorophore labeled at the 5' end of the nucleic acid sequence of the mutant probe is HEX.

10. A kit for detecting TNNC1 gene mutation, which comprises the primer probe composition for detecting TNNC1 gene mutation according to any one of claims 1 to 9.

11. The kit of claim 10, wherein the kit further comprises a PCR reaction solution and/or a dye.

12. The kit according to claim 11, wherein the PCR reaction solution comprises DNA polymerase, Mg²⁺Buffer, dNTPs and water.

13. The kit of claim 11, wherein the dye comprises a Rox calibration dye.

14. The kit of claim 10, further comprising a quality control.

15. The kit of claim 14, wherein the quality control substances comprise wild-type quality control substances, mutant quality control substances and hybrid mutant quality control substances.

16. A method for using the kit for detecting TNNC1 gene mutation according to claim 10 for non-disease diagnosis and/or treatment purposes, the method comprising:

17. The method of claim 16, wherein the genome is derived from any one of or a combination of at least two of human peripheral blood, myocardial tissue, lymphoid organs, spleen, bone marrow, or liver.

18. The method of claim 16, wherein the reaction conditions for real-time fluorescent PCR detection comprise: pre-denaturing at 93-98 ℃ for 25-35 s; denaturation at 93-98 ℃ for 3-7 s, annealing at 63-65 ℃ and extension for 30-40 s, and 35-45 cycles; extending for 1-3 min at 59-61 ℃.

19. The method according to any one of claims 16-18, wherein the method comprises: