CN112941101A - Method, system and application for transient expression of blueberry fruits - Google Patents

Abstract

The invention provides a method for blueberry fruit gene expression, which comprises the following steps: punching the surface of the blueberry fruit to obtain punched blueberry fruit; immersing the perforated blueberry fruits into the agrobacterium infection suspension to obtain a blueberry fruit infection suspension mixture; putting the blueberry fruit infection suspension mixture into a vacuum environment to obtain vacuum-treated blueberry fruits, wherein the pressure of the vacuum environment is 0.01-0.085MPa, and the treatment time is 3-15 min; the agrobacterium infection suspension comprises recombinant agrobacterium and agrobacterium infection liquid; the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a Ti auxiliary plasmid; the T-DNA fragment of the T-DNA donor vector contains a target gene with an expression element; the agrobacterium infection liquid contains 2- (N-morpholine) ethanesulfonic acid. The invention also discloses application of the method in blueberry ACO1 gene expression.

Description

Method, system and application for transient expression of blueberry fruits

Technical Field

The invention belongs to the technical field of agricultural biology, and relates to a method, a system and application for transient expression of blueberry fruits, in particular to a method and a system for transient expression of blueberry fruits based on vacuum infiltration and application of ACO1 gene overexpression.

Background

Transient transfection is one way to introduce DNA into eukaryotic cells. In transient transfection, recombinant DNA is introduced into a highly infectious cell line to obtain transient and high-level expression of the gene of interest. At present, the common transient expression method in fruits is an injection method, but the method is mostly suitable for fruits with soft pulp, such as tomatoes, strawberries and the like.

Blueberries (Latin: Vaccinium Spp. English: Blueberry), also known as Vaccinium myrtillus and blueberries, belong to the Ericaceae (Ericaceae) Vaccinium subfamily (Vaccinioideae) plant genus Vaccinium. The blueberry is rich in nutrition, not only is rich in conventional nutrient components, but also contains extremely rich flavonoid and polysaccharide compounds. The blueberry fruit contains effective substances for preventing cranial nerve aging, enhancing cardiac function, improving eyesight, resisting cancer and the like.

Because the cell combination of blueberry fruits is too tight, the structure and the characteristics of the fruits are different from those of the fruits studied in the past, and the transient expression method for common fruits is not suitable for the blueberry fruits, so the method of needle injection is not feasible.

Since agrobacterium can only infect cells at the wound of plant tissue in the presence of a specific induction factor, and the infection is directly carried out by using an injection mode in the researches, the infection efficiency is severely limited. Subsequent research work has higher requirements on the transient transfection efficiency in the blueberry fruit, so that the demand of an efficient transient transfection method for the blueberry fruit is very urgent.

Disclosure of Invention

The invention particularly relates to a method for transient expression of blueberry fruits based on vacuum infiltration. The method comprises the steps of suspending and activating the agrobacterium by using agrobacterium infection liquid; pricking blueberry fruits with toothpick heads; putting the blueberry fruit in an agrobacterium infection solution, and vacuumizing to promote the agrobacterium to permeate plant tissues; and (4) dark culturing the blueberry fruits infected by the agrobacterium. The method combines fruit pretreatment and vacuum treatment to realize the infiltration of the agrobacterium into the blueberry fruits, thereby realizing the high-efficiency impregnation of blueberry fruit cells by the agrobacterium and realizing the high-efficiency transient expression of exogenous genes.

In order to solve the problems of low efficiency of infecting blueberry fruits by agrobacterium in the prior art and the like, the invention provides a method for blueberry fruit gene expression in a first aspect, which comprises the following steps:

s1: punching the surface of the blueberry fruit to obtain punched blueberry fruit;

s2: immersing the punched blueberry fruits into an agrobacterium infection suspension to obtain a blueberry fruit infection suspension mixture;

the agrobacterium infection suspension comprises recombinant agrobacterium and an agrobacterium infection solution;

the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a TI auxiliary plasmid;

the T-DNA fragment of the T-DNA donor vector contains a target gene with an expression element, a site for inserting the target gene with the expression element, or a DNA fragment for replacing the target gene with the expression element;

the agrobacterium infection solution contains 2- (N-morpholine) ethanesulfonic acid, magnesium chloride and acetosyringone;

s3: and putting the blueberry fruit infection suspension mixture into a vacuum environment to obtain the blueberry fruit subjected to vacuum treatment, wherein the pressure of the vacuum environment is 0.01-0.085MPa, and the treatment time is 3-15 min.

In some embodiments, the gene expression is transient gene expression.

In some embodiments, in step S1, the blueberry fruit is selected from the blueberry fruits of the green season.

In some embodiments, in step S1, the depth of the perforations is 4-5 mm.

In some embodiments, in step S1, the inner diameter of the punch is 1-2 mm.

In some embodiments, in step S1, the number of holes punched in a blueberry fruit is 3-10.

In some embodiments, in step S1, the holes of a blueberry fruit are punched at intervals of 5-15 mm.

In some embodiments, in step S1, the punching is performed using a sterile needle or a sterile rod.

In some embodiments, in step S2, the T-DNA donor vector and the Ti helper plasmid are simultaneously or sequentially transformed into the agrobacterium tumefaciens host bacterium to form the recombinant agrobacterium.

In some embodiments, in step S2, the T-DNA donor vector is transformed into the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid to form the recombinant agrobacterium.

In some embodiments, in step S2, the gene of interest is recombined into the T-DNA donor vector using the Gateway cloning method.

In some embodiments, in step S2, the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105.

In some embodiments, in step S2, the promoter of the gene of interest in the T-DNA donor vector is a NOS promoter, a MAS promoter or a CaMV 35S promoter.

In some embodiments, in step S2, the terminator of the gene of interest in the T-DNA donor vector is a NOS terminator.

In some embodiments, in step S2, the T-DNA donor vector is a binary expression vector.

In some embodiments, in step S2, the T-DNA donor vector is a binary expression vector pCAMBIA-1303 or a binary expression vector Gateway^TM293 vector.

In some embodiments, in step S2, the agrobacterium-infected fluid comprises: 8-12mM MgCl₂150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, aqueous solution, pH 5.0-6.0.

In some embodiments, in step S2, the Agrobacterium-infected liquid is used after filter sterilization with a frit having a pore size of 0.02 μm.

In some embodiments, in step S2, the propagation medium of the recombinant agrobacterium is LB liquid medium containing an antibiotic.

In some embodiments, in step S2, the propagation medium of the recombinant Agrobacterium is LB liquid medium containing 30-80mg/l rifampicin and 50-150mg/l kanamycin.

In some embodiments, in step S2, the propagation culture of the recombinant agrobacterium is performed to the use concentration OD₆₀₀＝0.5-1.0。

In some embodiments, in step S2, the agrobacterium infection suspension is prepared by:

centrifuging the culture of the recombinant agrobacterium, and removing a supernatant to obtain a first precipitate;

washing the first precipitate with the agrobacterium-infected liquid, centrifuging, and removing a supernatant to obtain a second precipitate;

and re-suspending the second precipitate by using the agrobacterium infection liquid to obtain the agrobacterium infection suspension.

In some embodiments, in step S2, the conditions for each centrifugation are: centrifuging at 4000-.

In some embodiments, in step S2, the agrobacterium-infected liquid is activated for use, and the activating step is: culturing the recombinant agrobacterium with LB liquid culture medium to bacterial liquid OD₆₀₀＝0.5-1.0。

In some embodiments, in step S2, the gene of interest is the EGFP gene.

In some embodiments, in step S3, the pressure of the vacuum environment is 0.016-0.08 MPa.

In some embodiments, in step S3, the processing time is 5-10 min.

In some embodiments, in step S3, the vacuum-treated blueberry fruit is washed clean.

In some embodiments, in step S3, the composition of the wash solution is: 8-12mM MgCl₂150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

The method further comprises the steps of:

s4: and (4) culturing the blueberry fruits subjected to vacuum treatment in a dark environment.

In some embodiments, in step S4, the incubation temperature is 20-28 ℃.

In some embodiments, in step S4, the culturing period is 1-10 days.

In some embodiments, the humidity of the cultivation in step S4 is 65-80%.

In some embodiments, in step S4, the humidity is maintained in a solution environment of: 8-12mM MgCl₂150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

In a second aspect, the invention provides a system for gene expression of blueberry fruit, the system comprising:

the punching device is used for punching the blueberry fruits;

a sealable container for holding blueberry fruit;

a vacuum evacuation device for evacuating the sealable container;

the method comprises the following steps of (1) carrying out agrobacterium infection suspension, wherein the agrobacterium infection suspension comprises recombinant agrobacterium and an agrobacterium infection solution; the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a Ti auxiliary plasmid; the T-DNA fragment of the T-DNA donor vector contains a target gene with an expression element, a site for inserting the target gene with the expression element, or a DNA fragment for replacing the target gene with the expression element; the agrobacterium infection solution contains 2- (N-morpholine) ethanesulfonic acid.

In some embodiments, the gene expression is transient gene expression.

In some embodiments, the puncturing device is a sterile needle or a sterile rod.

In some embodiments, the diameter of the sterile needle is 1-2 mm.

In some embodiments, the sterile shaft has a diameter of 1-2 mm.

In some embodiments, said T-DNA donor vector is transformed into said agrobacterium tumefaciens host bacterium containing said Ti helper plasmid to form said recombinant agrobacterium.

In some embodiments, said gene of interest is recombined into said T-DNA donor vector using the Gateway cloning method, resulting in said T-DNA donor vector containing said gene of interest.

In some embodiments, said T-DNA donor vector and said Ti helper plasmid are used to transform said agrobacterium tumefaciens host bacterium, simultaneously or sequentially, to form said recombinant agrobacterium.

In some embodiments, the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105.

In some embodiments, in the T-DNA donor vector, the promoter of the gene of interest is a NOS promoter, a MAS promoter, or a CaMV 35S promoter.

In some embodiments, in the T-DNA donor vector, the terminator of the gene of interest is a NOS terminator.

In some embodiments, the T-DNA donor vector is a binary expression vector.

In some embodiments, the T-DNA donor vector is a binary expression vector pCAMBIA-1303 or a binary expression vector Gateway^TM293 vector.

In some embodiments, the agrobacterium infection fluid comprises the following components: 8-12mM MgCl₂150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

In some embodiments, the Agrobacterium-infected liquid is formed after filter sterilization using a frit having a pore size of 0.02 μm.

In some embodiments, the gene of interest is the EGFP gene.

In some embodiments, the system further comprises: a centrifugal machine.

In a third aspect, the invention provides the use of the method of the first aspect or the system of the second aspect in the blueberry expression of an exogenous gene.

In some embodiments, the exogenous gene is a transiently expressing exogenous gene.

In some embodiments, the variety of blueberry is selected from JE, duke, jewelry, regez, mist, early blue, blue gold, blue tower, and tao rou.

The fourth aspect of the invention provides an operation method for expressing blueberry ACO1 genes in blueberry fruits, which comprises the following steps: the blueberry ACO1 gene is used as a target gene, and the target gene is transferred into blueberry fruits by using the method of the first aspect of the invention.

In some embodiments, the protein sequence encoded by the blueberry ACO1 gene is shown in SEQ ID No. 6.

In some embodiments, the coding sequence of the blueberry ACO1 gene is shown in SEQ ID No. 5.

In a fifth aspect, the invention provides the use of the method of operation of the fourth aspect of the invention for improving blueberry quality, the improvement comprising:

(1) increase in soluble sugars;

(2) the hardness of the fruits is reduced;

(3) increasing the content of anthocyanin.

The invention has the beneficial effects that: the method for improving the infection of the blueberry fruit by the agrobacterium tumefaciens is provided, and the agrobacterium tumefaciens is infiltrated into fruit tissues by combining fruit period selection and vacuum treatment, so that the blueberry cells are efficiently infected by the agrobacterium tumefaciens; and the high-efficiency transient expression of exogenous genes in the blueberry fruits can be realized.

1) The gene expression has tissue specificity, the genetic operation in the blueberry fruit can better research the gene expression condition in the fruit, and the research result is prevented from being effective in other tissues but ineffective in the fruit.

The fruit is directly used for genetic research, which is more beneficial to promoting the scientific research of improving the fruit.

2) The transgenic plant has high manufacturing cost and long time for tissue culture and plant propagation, and the invention can be rapidly researched.

3) Some genetic operations are lethal to plants, and corresponding operations cannot develop to obtain complete transgenic plants, so that the research work of related gene transgenic models of blueberries is limited, the defects can be avoided by operating from fruits, the blueberry genetics can be researched more comprehensively, and a new model is provided for improving the quality of the blueberries.

According to the invention, the gene ACO1 is constructed on a plant expression vector and is introduced into blueberries for expression, the physiological biochemical and molecular biological detection related to fruit ripening is carried out on the respectively obtained ACO1 overexpression blueberries, the ACO1 is confirmed to change the ripening process of the blueberries, and a foundation is laid for the capability of improving the ripening process of the blueberries and other non-respiratory climacteric fruits by using the gene in the later stage.

The invention respectively separates and clones a complete cDNA fragment and a C-terminal specific terminal sequence fragment of a blueberry fruit ripening gene, transfers a target gene into a receptor plant by using an agrobacterium-mediated method and expresses the target gene in an excessive way, and then verifies the function of the gene in the blueberry fruit ripening process through experiments, thereby laying a foundation for the later-stage capacity of improving the blueberry and other non-respiratory transition type fruit ripening processes by using the gene.

Drawings

FIG. 1 is a diagram of a map of pCAMBIA-1300 binary expression vector.

FIG. 2 is a graph showing a comparison of the relative values of the RNA expression levels of EGFP.

FIG. 3 shows the PCR amplification electropherogram of blueberry ACO1 gene, wherein lane 4 is Marker, and the molecular lengths are: 2000bp, 1500bp, 1000bp, 750bp, 500bp, lanes 1-3 are the results of three parallel processes of example 2 on the amplification of endogenous blueberry ACO1 gene; lanes 4-6 are the results of three parallel treatments of amplification of the blackberry ACO1 gene in the recombinant plasmid of example 2.

FIG. 4 shows Gateway^TM pDONR^TM221vector map schematic.

FIG. 5 shows Gateway^TMMap schematic of 293 vector.

FIG. 6 is a schematic diagram of the comparison of blueberry ACO1 gene expression level.

FIG. 7 is a control schematic of soluble sugar content.

FIG. 8 is a comparison of the content of anthocyanins.

FIG. 9 is a comparative graph showing fruit firmness.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Referring to the kit, the procedure was performed according to the instructions of the kit.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1: transient expression method based on vacuum infiltration is utilized to express EGFP gene in blueberry fruit

1. Agrobacterium culture

Binary expression vector pCAMBIA-1300: sequence information: https:// www.ncbi.nlm.nih.gov/nucleotide/KX400856.1, can refer to FaPAO5 rules springs/spring levels as a signaling along the street berry from road pending [ J ]. Plant Direct,2020,4(5), donation from professor of Shenyuanyue of Beijing college of agriculture, the map of which is shown in FIG. 1.

Agrobacterium tumefaciens GV3101 was purchased from Bomeide.

And (3) transferring the binary expression vector pCAMBIA-1300 into the obtained competent agrobacterium tumefaciens GV3101 by a freeze-thaw transformation method to obtain the transformed agrobacterium tumefaciens.

After Agrobacterium tumefaciens GV3101 strain containing pCAMBIA-1300 binary expression vector is activated conventionally, the activation steps are: picking single colony in LB liquid culture medium of 5-10ml, placing in constant temperature shaking table (200rpm/30 ℃) overnight, pouring out bacterial liquid, adding fresh LB liquid culture medium of 5-10ml, continuing shaking until bacterial liquid OD₆₀₀≈0.5-1.0。

Culturing in 10ml LB liquid medium (containing 50mg/l Rif (rifampin) +100mg/l Kan (kanamycin)) at 30 deg.C for about 12h to OD₆₀₀And the concentration is about 0.8, and the next step of experiment is carried out. A total of 3 parts of the same Agrobacterium culture were prepared.

2. Selection of blueberry fruit

According to the blueberry fruit development law, the blueberry fruit development stage is divided into 6 stages: a green period: about 6 days after fruit setting; middle green period: about 14 days after fruit setting; ③ period of heavy green: the whole fruit is light green; fourthly, initial purple period: the initial part of the fruit surface turns purple; the purple stage: large area of fruit surface is changed into purple; sixthly, the full violet stage: the fruit surface turns purple.

The 'jewelry' variety of big green blueberry fruits with consistent development period, no insect eyes, no deformity and uniform size are selected.

3. Fruit pretreatment

Punching 6 holes with the same depth (depth: 4-5mm) on the blueberry fruits from all directions by using sterilized toothpicks, wherein the spacing distance between the holes is kept consistent (distance: 4 mm). The pre-treated fruit required immediate follow-up experiments.

4. Infection with Agrobacterium

Preparing an agrobacterium infection solution: 10mM MgCL₂200 μ M AS (acetosyringone), 10mM MES (2- (N-morpholine) ethanesulfonic acid), aqueous, pH 5.7; after the preparation, the mixture is filtered and sterilized by a filter head with the specification of 0.02 mu m.

Preparing an agrobacterium infection control solution: 10mM MgCl₂200 μ M AS, aqueous solution, pH 5.7, after preparation was sterilized by filtration through a 0.02 μ M filter.

Centrifuging 10ml of agrobacterium liquid at 6000rpm for 5min, removing supernatant, washing with 10ml of prepared agrobacterium infection liquid for 1 time, centrifuging at 6000rpm for 5min, removing supernatant, and re-suspending with 10ml of the agrobacterium infection liquid to obtain suspension 1.

Meanwhile, another 1 part of 10ml of agrobacterium liquid is taken for centrifugation for 5min, the supernatant is removed, and 10ml of agrobacterium infection control liquid is used for heavy suspension, so that suspension 2 is obtained.

Experimental groups: the porous fruits were carefully transferred with tweezers into the aforementioned suspension 1 and gently immersed therein. The sample was placed in a vacuum desiccator (model GM-0.33A, available from Tianjin, Jinteng laboratories, Inc.) and evacuated to a pressure of 0.08MPa for 5 min.

Meanwhile, a comparison group 1 is made, and the difference from the experimental group is that the vacuum pumping treatment is carried out, the pressure is 0.016MPa, and the pressure is kept for 5 min; the control group 2, except that no vacuum treatment, had the same experimental conditions as the experimental group; the difference between the control group 3 and the experimental group is that 0.08MPa is kept for 10 min; control group 4, the difference from the experimental group, was that the fruits were infested with suspension 2 and kept under vacuum pressure of 0.08MPa for 5 min. The suspension 1 was also injected into the fruit from the surface of the blueberry fruit by sucking with a syringe without a needle, and used as a control group 5.

5. Dark culture of infected sample

The fruits of the experimental and control groups 1-4 were removed and washed 2 times with 30ml of the Agrobacterium-free infection solution described above. At the same time, a layer of filter paper was laid in a glass plate and 5ml of sterile, previously described Agrobacterium infection solution was added for wetting. The washed fruits were gently placed on filter paper, placed in a dark environment, and cultured at 24 ℃. For blueberry fruits injected with the bacterial liquid, the blueberry fruits are directly cultured in the dark at room temperature and carefully moisturized (the humidity is 90%).

6. Fruit RNA extraction

Respectively taking about 0.5g of each fruit which is cultured in dark for nine days and then placed for nine days, grinding the fruit in liquid nitrogen, and extracting the total RNA of the fruit by using a plant total RNA extraction kit (purchased from Tiangen company) according to the operation of a kit specification.

qPCR assay analysis of over-expressed Gene expression in blueberry

Quantitative PCR analysis is carried out on potential EGFP RNA in total RNA of the blueberry fruits treated in the previous steps by taking F1(SEQ ID NO.1) and R1(SEQ ID NO.2) as primers.

F1：5’-ATGGTGAGCAAGGGCGAGGAG

R1：5’-TTACTTGTACAGCTCGTCCATGC

The RNA expression level of EGFP in the control group 5 is 1, the relative values of the RNA expression levels of EGFP in other groups are calculated, the EGFP in other groups are tested for three times in parallel, the average value is taken, the result of qPCR (fluorescent dye method) experiment analysis is shown in figure 2, A, B, C, D, E, F respectively and sequentially shows the RNA expression levels of EGFP in blueberry fruits treated by the experiment group, the control group 1, the control group 2, the control group 3, the control group 4 and the control group 5, and the representative difference is obvious.

It can be seen that the RNA expression level of EGFP was very low in control group 2 which had not been treated with vacuum and control group 4 which had been treated with the Agrobacterium-infected control solution.

EGFP was expressed in a moderate amount of RNA in control group 5 injected with a syringe.

In the experimental group, the RNA expression level of EGFP was higher in the control group 1 and the control group 3.

Therefore, the methods in the experimental group, the control group 1 and the control group 3 can effectively express the exogenous genes in the blueberry fruits.

Example 2: cloning of the ACO1 Gene

According to GenBank number: the Arabidopsis thaliana ACO1 gene of NM _127517, the homologous gene corresponding to the blueberry from Blast at www.vaccinium.org website, utilizes Snapgene software to design primers F2(SEQ ID NO.3) and R2(SEQ ID NO.4) for amplifying blueberry ACO1 gene, and has the following sequence.

F2：5’-ATGGAGGTCCCTGTTATAGACTTTGA

R2：5’-TCAAACCGGAAGACTCTGGTGC

Aiming at blueberry (jewelry) fruits, a plant total RNA extraction kit is used for extracting total RNA.

Reverse transcription: the reverse transcription kit of Tiangen is used.

And performing PCR amplification on the blueberry ACO1 gene by using F2 and R2 by using cDNA as a template.

The amplified product was electrophoresed on an agarose gel, and a band of about 900bp in length was observed (FIG. 3, left side of Marker, lanes 1 to 3).

Sequencing the amplified product to obtain a blueberry ACO1 gene coding sequence (SEQ ID NO.5) as follows:

5’-ATGGAGGTCCCTGTTATAGACTTTGATAAGCTTGATGGTGAGAAGAGAGGTGAAACCATGGCACTTCTCCACCAAGCTTGTGAAAAGGGGGGCTTCTTTCAGATTGAGAACCATGGAATTGACACAGAGTTGATGGACAAAGTCAAGTACTTGGTGAATCAGCATTATGAGGAGAATATGAAAAAAAGCTTCTACGAATCGGACATAGCCAAGGGATTGGAGGAGAAAAGGATTACCTCTGATACAGACTGGGAAAGCACCTTCTTCGTTTGGCATCGTCCGAATTCCAACATCAATGAGCTCACAAACCTCTCAGATGACCTCCGCATGACGATGGATGCGTATATCAATCAACTGATCAAGCTAGCAGAGAAACTGTCGGAGCTCATGTGCGAAAATCTTGGTTTAGAGAAAGATTACATAAAGGAAGCATTTTCAGGAAGCAAAGGTCCATCTGTAGGAACCAAAGTGGCTAAATACCCACAATGTCCTCACCCTGAACTTGTTAGAGGGCTTCGTGAGCATACGGATGCTGGTGGGATCATTCTCTTACTCCAAGACGATGAAGTCCCAGGTCTTCAATTCCATAAAGATGGAAAATGGGTAGAAATTCCACCTTCTAAGAATAACAGCATCTTTATCAACACAGGTGATCAAGTGGAAGTGGTAACTAATGGAAGGTACAAGAGTACTTTGCACCGTGTAATCGCAGATAAGAACGGAAGCAGAATCTCTATCGCCACCTTCTACAATCCCGCTGGAGATGCTGTCATTTCTCCAGCTCCCAAACTCTTATACCCCAACCACTTCCGTTTTCAAGATTATCTGAACCTTTATGGTTCAACTAAGTTTGAAGACAAGGGTCCCCGATTCGAATCCATGAAGAAAATGCCGAACGGGCACCAGAGTCTTCCGGTTTGA

the corresponding amino acid sequence (SEQ ID NO.6) of the blueberry ACO1 gene protein is as follows: MEVPVIDFDKLDGEKRGETMALLHQACEKGGFFQIENHGIDTELMDKVKYLVNQHYEENMKKSFYESDIAKGLEEKRITSDTDWESTFFVWHRPNSNINELTNLSDDLRMTMDAYINQLIKLAEKLSELMCENLGLEKDYIKEAFSGSKGPSVGTKVAKYPQCPHPELVRGLREHTDAGGIILLLQDDEVPGLQFHKDGKWVEIPPSKNNSIFINTGDQVEVVTNGRYKSTLHRVIADKNGSRISIATFYNPAGDAVISPAPKLLYPNHFRFQDYLNLYGSTKFEDKGPRFESMKKMPNGHQSLPV

Example 3: construction of ACO1 gene overexpression vector and transformation of agrobacterium

In this example, the Gateway cloning technique was used, and the vectors used in the steps (II), (III) and (IV) were purchased from Thermo Fisher Scientific, Inc. and were used according to the vector instructions.

(one) primer design

The blueberry ACO1 gene coding sequence shown in SEQ ID NO.5 is transferred into a blueberry (variety: jewelry) genome by the specific method as follows:

primers F3(SEQ ID NO.7) and R3(SEQ ID NO.8) for adding attB joints to blueberry ACO1 gene were designed according to blueberry ACO1 gene coding sequence (SEQ ID NO.5) by using Snapgene software, and the sequences are as follows.

F3:5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGTCCCTGTTATAGA

R3:5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAAACCGGAAGACTCTGGTGC

PCR was carried out using F3 and R3 as primers and the same materials and methods as in example 2, and the amplification product was referred to as attB-ACO1 product.

(II) BP reaction

1. A1.5 ml centrifuge tube was taken, and the following ingredients were added at room temperature and mixed well:

attB-ACO1 product (. gtoreq.10 ng/. mu.l; final content 15-150ng), 1-7. mu.l 221vector (150 ng/. mu.l) 1. mu.l (i.e., donor vector Gateway)^TM pDONR^TM221vector, available from Thermo Fisher Scientific, inc, for structural drawing see fig. 4);

TE buffer, pH 8.0, was added to a final volume of 8. mu.l.

2. BP close^TMII enzyme mix was placed on ice for 2min, vortexed 2 times for 2s each.

3. Add 2. mu.l BP clone to the sample mixture of step 1^TMII enzyme mix, mix the reaction product by simple vortexing twice.

4. Unused BP close^TMII the enzyme mix is stored in a refrigerator at-20 ℃.

And (3) incubating the mixture obtained in the step 3 for 1h at the temperature of 5.25 ℃.

6. The reaction was stopped by adding 1. mu.l of protease K solution. And (3) incubating for 10min at 37 ℃ to obtain a BP reaction product.

(III) transformation

Mu.l of the BP reaction product (code: 221-ACO1) was added to 50. mu.l of Trans 1-T1 E.coli competent cells, gently mixed, incubated on ice for 30min, heat-shocked at 42 ℃ for 60s, added to 500. mu.l of LB medium, and shake-cultured at 37 ℃ and 180rpm for 1 hour. Mu.l and 100. mu.l of the recombinant vector were applied to LB (50mg/l kanamycin) solid plates, followed by positive identification, sequencing (preservation of sequencing colonies), and quality improvement to obtain recombinant donor vectors for use.

(tetra) LR reaction

Reagent: gateway^TM LR Clonase^TMII Enzyme Mix

1. A1.5 ml centrifuge tube was taken, and the following ingredients were added at room temperature and mixed well:

1–7μL 221-ACO1(50–150ng)；

1 μ L293 vector (150 ng/. mu.L) (i.e., the object vector Gateway)^TM293vector from Thermo Fisher Scientific, see FIG. 5 for structural drawing);

TE buffer, pH 8.0, added to a final volume of 8. mu.L.

2. LR clone^TMII enzyme mix was placed on ice for 2min, vortexed 2 times for 2s each.

3. Add 2. mu.l LR clone to the sample mixture of step 1^TMII enzyme mix, mix the reaction product by simple vortexing twice.

4. Unused LR clone^TMII the enzyme mix is stored in a refrigerator at-20 ℃.

And (3) incubating the mixture obtained in the step 3 for 1h at the temperature of 5.25 ℃.

6. The reaction was stopped by adding 1. mu.l of protease K solution. And (4) incubating for 10min at 37 ℃ to obtain an LR reaction product.

(V) transformation

Mu.l of LR reaction product (293-ACO1) was added to 5. mu.l of Trans 1-T1 E.coli competent cells, mixed gently, incubated on ice for 30min, heat-shocked at 42 ℃ for 60s, added to 500. mu.l of LB medium, and shake-cultured at 37 ℃ and 180rpm for 1 h. Mu.l and 100. mu.l were applied to LB (100. mu.g/ml spectinomycin) solid plates, respectively, after which positive identification, colony preservation, and recombinant 293 plasmid extraction were performed. The obtained competent Agrobacterium tumefaciens GV3101 was transformed in the same manner as in step 1 of example 1 to obtain a transformed Agrobacterium.

The blueberry ACO1 gene was amplified by PCR using the aforementioned F2 and R2, and the recombination was successful as verified by agarose gel electrophoresis (FIG. 3, right side of Marker, lanes 5-7).

Example 4: infection of fruit

1. Selection of blueberry fruit

The same procedure as in step 2 of example 1 was followed to select "jewelry" variety of large green stage blueberry fruit.

2. Fruit pretreatment

Same as in step 3 of example 1.

3. Infection with Agrobacterium

The pre-treated blueberry fruit was infected with the transformed agrobacterium prepared in example 3, the procedure was the same as in example 1, step 4.

And (3) obtaining the blueberry fruit infected by the recombinant agrobacterium.

4. Dark culture of infected sample

Same as the experimental group in example 1. Dark culture was performed for 2 days.

Example 5: determination of ACO1 expression amount

The blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (two groups of blueberry fruits are fruits in the same batch) are respectively subjected to content determination of ACO1-OE (namely RNA of ACO1 gene in the blueberry fruits) in the blueberry fruits.

(1) Extracting total RNA of blueberry fruit

And extracting the total RNA in 3 blueberry fruits in each group by using a total RNA extraction kit of the Tiangen plant.

(2)qPCR

F4(SEQ ID NO.9) and R4(SEQ ID NO.10) are used as primers to carry out quantitative PCR (fluorescent dye method) analysis on the potential ACO1 gene expression quantity in the total RNA of each blueberry fruit.

F4：5’-AAAGGTCCATCTGTAGG

R4：5’-GTAAGAGAATGATCCCA

(3) Results

After the ACO1 gene is over-expressed, the ACO1 gene expression level in the fruit is obviously increased, and the experimental data are analyzed by SPSS for difference significance. The experiment was set up in triplicate and the data was analyzed by taking the average of three replicates (see FIG. 6 for gene expression control).

Example 6: determination of soluble sugar content

Blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (two groups of blueberry fruits are fruits of the same batch) are respectively subjected to blueberry soluble sugar content measurement.

(1) Measurement method

The measurement of soluble sugar in fruit was carried out using a digital display sugar meter (Shanghai apparatus electro-physical optical apparatus Co., Ltd., model WYA-3S). According to the method of the instrument specification, respectively smearing the blueberry fruit juice on a sugar measuring instrument, reading the reading, wherein the unit is as follows: % of the total weight of the composition.

(2) Measurement results

Experimental data the significance of differences analysis was performed using SPSS. The experiment was set up in triplicate and the data was analyzed by taking the average of three replicates (see figure 7 for soluble sugar content control).

After the ACO1 gene is over-expressed, the content of soluble sugar in the fruit is obviously increased, so that compared with wild blueberries, the fruit ripening is promoted by over-expression of the ACO1 gene.

Example 7: anthocyanin content determination

The blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (two groups of blueberry fruits are fruits in the same batch) are respectively subjected to anthocyanin content measurement.

(1) Measurement method

(i) Preparation of anthocyanin extract

The main anthocyanin in the blueberry is pelargonidin-3 glucoside, and the anthocyanin extracting solution mainly takes pelargonidin-3 glucoside as an extraction main component. The extracting solution is prepared by the following steps of: methanol: water: glacial acetic acid 60 mL: 60mL of: 30mL of: 15mL of anthocyanin extract is prepared according to the proportion of 165 mL.

(ii) Extraction of anthocyanins

Weighing about 3.0g of frozen blueberry fruits, freezing by liquid nitrogen, grinding, completely adding into a 50mL centrifuge tube, accurately adding 20mL of prepared anthocyanin extract, carrying out water bath for 4h at 40 ℃, cooling to room temperature, then carrying out 15000Xg, 4 ℃, centrifuging for 20min (Eppendorf5804R) to remove impurities such as cell fragments, carefully absorbing a proper amount of supernatant into a new centrifuge tube by using a pipette gun, adding a prepared buffer solution, and diluting by corresponding times.

(iii) Determining the total content of anthocyanidin by pH differential method

1mL of the prepared sample (supernatant) was added with 4mL of 0.4M sodium acetate (NaAc) buffer solution having a pH of 4.5 or 4mL of 0.025M potassium chloride (KCl) buffer solution having a pH of 1.0, mixed well, allowed to stand at room temperature for 20min, transferred into a cuvette having an optical path length of 1cm, measured for absorbance at 495nm and 700nm using a UV-2102C-type UV-visible spectrophotometer, and double distilled water (ddH) was used₂O) zero-setting, repeated 3 times per developmental period.

The concentration of anthocyanidin is calculated as follows:

concentration of anthocyanidin (mg. g)^-1)＝A x MW x DF x1000/ε

A ═ a (a495nm, Ph 1.0 to a700nm, Ph 1.0) - (a495nm, Ph 4.5 to a700nm, Ph 4.5) (i.e., the difference between absorbance values at 495nm and 700nm minus the difference between absorbance values at 495nm and 700nm under Ph 1.0 and Ph 4.5), MW is molar mass (433.2g/mol), DF is dilution factor, and ∈isabsorbance coefficient (15600).

The blueberry is mainly calculated by the molar absorption coefficient (15600) of anthocyanin pelargonium-3-glucoside (pelargonidin-3-glucoside). The anthocyanin content (mg) in 1g of the sample was finally expressed.

(2) Measurement results

Experimental data the significance of differences analysis was performed using SPSS. The experiment was set up in triplicate and the data was analyzed by taking the average of three replicates (see figure 8 for anthocyanin content control).

After the ACO1 gene is over-expressed, the anthocyanin content of the fruits is obviously increased, so that the fruit ripening is promoted by over-expression of the ACO1 gene compared with wild blueberries.

Example 8: measurement of fruit hardness

The blueberry fruits infected by the recombinant agrobacterium cultured in the dark in the example 4 and wild blueberry fruits (the three groups of blueberry fruits are fruits in the same batch) are respectively subjected to fruit hardness measurement.

(1) Measurement method

Using GY-4 fruit durometer (Leiende, GY-4) Measuring hardness perpendicular to the surface of the fruit, wherein the hardness unit is selected to be kg/cm²。

(2) Measurement results

Experimental data the significance of differences analysis was performed using SPSS. The experiment was set up in triplicate and the data was analyzed by taking the average of three replicates (see figure 9 for fruit firmness control).

After the ACO1 gene is over-expressed, the hardness of the fruit is obviously reduced, so that compared with wild blueberries, the fruit ripening is promoted by over-expression of the ACO1 gene.

It will be appreciated by those skilled in the art that the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The embodiments disclosed above are therefore to be considered in all respects as illustrative and not restrictive. All changes which come within the scope of or equivalence to the invention are intended to be embraced therein.

Sequence listing

<110> agriculture Co Ltd in Dafeng Yuan Shandong

<120> method, system and application for transient expression of blueberry fruits

<130> C1CNCN210157

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggtgagca agggcgagga g 21

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttacttgtac agctcgtcca tgc 23

<210> 3

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggaggtcc ctgttataga ctttga 26

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaaccgga agactctggt gc 22

<210> 5

<211> 921

<212> DNA

<213> blueberry (Vaccinium spp)

<400> 5

atggaggtcc ctgttataga ctttgataag cttgatggtg agaagagagg tgaaaccatg 60

gcacttctcc accaagcttg tgaaaagggg ggcttctttc agattgagaa ccatggaatt 120

gacacagagt tgatggacaa agtcaagtac ttggtgaatc agcattatga ggagaatatg 180

aaaaaaagct tctacgaatc ggacatagcc aagggattgg aggagaaaag gattacctct 240

gatacagact gggaaagcac cttcttcgtt tggcatcgtc cgaattccaa catcaatgag 300

ctcacaaacc tctcagatga cctccgcatg acgatggatg cgtatatcaa tcaactgatc 360

aagctagcag agaaactgtc ggagctcatg tgcgaaaatc ttggtttaga gaaagattac 420

ataaaggaag cattttcagg aagcaaaggt ccatctgtag gaaccaaagt ggctaaatac 480

ccacaatgtc ctcaccctga acttgttaga gggcttcgtg agcatacgga tgctggtggg 540

atcattctct tactccaaga cgatgaagtc ccaggtcttc aattccataa agatggaaaa 600

tgggtagaaa ttccaccttc taagaataac agcatcttta tcaacacagg tgatcaagtg 660

gaagtggtaa ctaatggaag gtacaagagt actttgcacc gtgtaatcgc agataagaac 720

ggaagcagaa tctctatcgc caccttctac aatcccgctg gagatgctgt catttctcca 780

gctcccaaac tcttataccc caaccacttc cgttttcaag attatctgaa cctttatggt 840

tcaactaagt ttgaagacaa gggtccccga ttcgaatcca tgaagaaaat gccgaacggg 900

caccagagtc ttccggtttg a 921

<210> 6

<211> 306

<212> PRT

<213> blueberry (Vaccinium spp)

<400> 6

Met Glu Val Pro Val Ile Asp Phe Asp Lys Leu Asp Gly Glu Lys Arg

1 5 10 15

Gly Glu Thr Met Ala Leu Leu His Gln Ala Cys Glu Lys Gly Gly Phe

20 25 30

Phe Gln Ile Glu Asn His Gly Ile Asp Thr Glu Leu Met Asp Lys Val

35 40 45

Lys Tyr Leu Val Asn Gln His Tyr Glu Glu Asn Met Lys Lys Ser Phe

50 55 60

Tyr Glu Ser Asp Ile Ala Lys Gly Leu Glu Glu Lys Arg Ile Thr Ser

65 70 75 80

Asp Thr Asp Trp Glu Ser Thr Phe Phe Val Trp His Arg Pro Asn Ser

85 90 95

Asn Ile Asn Glu Leu Thr Asn Leu Ser Asp Asp Leu Arg Met Thr Met

100 105 110

Asp Ala Tyr Ile Asn Gln Leu Ile Lys Leu Ala Glu Lys Leu Ser Glu

115 120 125

Leu Met Cys Glu Asn Leu Gly Leu Glu Lys Asp Tyr Ile Lys Glu Ala

130 135 140

Phe Ser Gly Ser Lys Gly Pro Ser Val Gly Thr Lys Val Ala Lys Tyr

145 150 155 160

Pro Gln Cys Pro His Pro Glu Leu Val Arg Gly Leu Arg Glu His Thr

165 170 175

Asp Ala Gly Gly Ile Ile Leu Leu Leu Gln Asp Asp Glu Val Pro Gly

180 185 190

Leu Gln Phe His Lys Asp Gly Lys Trp Val Glu Ile Pro Pro Ser Lys

195 200 205

Asn Asn Ser Ile Phe Ile Asn Thr Gly Asp Gln Val Glu Val Val Thr

210 215 220

Asn Gly Arg Tyr Lys Ser Thr Leu His Arg Val Ile Ala Asp Lys Asn

225 230 235 240

Gly Ser Arg Ile Ser Ile Ala Thr Phe Tyr Asn Pro Ala Gly Asp Ala

245 250 255

Val Ile Ser Pro Ala Pro Lys Leu Leu Tyr Pro Asn His Phe Arg Phe

260 265 270

Gln Asp Tyr Leu Asn Leu Tyr Gly Ser Thr Lys Phe Glu Asp Lys Gly

275 280 285

Pro Arg Phe Glu Ser Met Lys Lys Met Pro Asn Gly His Gln Ser Leu

290 295 300

Pro Val

305

<210> 7

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggggacaagt ttgtacaaaa aagcaggctt catggaggtc cctgttatag a 51

<210> 8

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggggaccact ttgtacaaga aagctgggtc tcaaaccgga agactctggt gc 52

<210> 9

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aaaggtccat ctgtagg 17

<210> 10

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtaagagaat gatccca 17

Claims (10)

1. A method for blueberry fruit gene expression, the method comprising the steps of:

s1: punching the surface of the blueberry fruit to obtain punched blueberry fruit;

s2: immersing the punched blueberry fruits into an agrobacterium infection suspension to obtain a blueberry fruit infection suspension mixture;

the agrobacterium infection suspension comprises recombinant agrobacterium and an agrobacterium infection solution;

the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a TI auxiliary plasmid;

the T-DNA fragment of the T-DNA donor vector contains a target gene with an expression element, a site for inserting the target gene with the expression element, or a DNA fragment for replacing the target gene with the expression element;

the agrobacterium infection solution contains 2- (N-morpholine) ethanesulfonic acid, magnesium chloride and acetosyringone;

s3: and putting the blueberry fruit infection suspension mixture into a vacuum environment to obtain the blueberry fruit subjected to vacuum treatment, wherein the pressure of the vacuum environment is 0.01-0.085MPa, and the treatment time is 3-15 min.

2. The method of claim 1, wherein the gene expression is transient gene expression;

preferably, in step S1, the blueberry fruit is selected from the blueberry fruits in the big green stage;

preferably, in step S1, the depth of the perforation is 4-5 mm;

preferably, in step S1, the inner diameter of the punch hole is 1-2 mm;

preferably, in step S1, the number of holes punched in a blueberry fruit is 3-10;

preferably, in step S1, the distance between different holes punched in a piece of blueberry fruit is 5-15 mm;

preferably, in step S1, the punching is performed using a sterile needle or a sterile rod.

3. The method of claim 1, wherein in step S2, said T-DNA donor vector and said Ti helper plasmid are simultaneously or sequentially transformed into said agrobacterium tumefaciens host bacterium to form said recombinant agrobacterium;

preferably, in step S2, transforming said T-DNA donor vector into said agrobacterium tumefaciens host bacterium containing said Ti helper plasmid to form said recombinant agrobacterium;

preferably, in step S2, the gene of interest is recombined into the T-DNA donor vector using the Gateway cloning method;

preferably, in step S2, the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105;

preferably, in step S2, in the T-DNA donor vector, the promoter of the target gene is an NOS promoter, a MAS promoter or a CaMV 35S promoter;

preferably, in step S2, in the T-DNA donor vector, the terminator of the target gene is a NOS terminator;

preferably, in step S2, the T-DNA donor vector is a binary expression vector;

preferably, in step S2, the T-DNA donor vector is a binary expression vector pCAMBIA-1303 or a binary expression vector Gateway^TM293 vector;

preferably, in step S2, the agrobacterium infection solution comprises the following components: 8-12mM MgCl₂150-;

preferably, in step S2, the Agrobacterium tumefaciens-infected liquid is used after being sterilized by filtration through a filter tip having a pore size of 0.02. mu.m;

preferably, in step S2, the proliferation medium of the recombinant agrobacterium is LB liquid medium containing antibiotics;

preferably, in step S2, the propagation medium of recombinant Agrobacterium is LB liquid medium containing 30-80mg/l rifampicin and 50-150mg/l kanamycin;

preferably, in step S2, the recombinant Agrobacterium is cultured for proliferation until the use concentration is OD₆₀₀＝0.5-1.0；

Preferably, in step S2, the agrobacterium infection suspension is prepared by the steps of:

centrifuging the culture of the recombinant agrobacterium, and removing a supernatant to obtain a first precipitate;

washing the first precipitate with the agrobacterium-infected liquid, centrifuging, and removing a supernatant to obtain a second precipitate;

re-suspending the second precipitate with the agrobacterium infection liquid to obtain the agrobacterium infection suspension;

preferably, in step S2, the conditions for each centrifugation are: centrifuging at 4000-;

preferably, in step S2, the agrobacterium-infected liquid is activated and used, and the activating step is: culturing the recombinant agrobacterium with LB liquid culture medium to bacterial liquid OD₆₀₀0.5-1.0; preferably, in step S2, the gene of interest is the EGFP gene;

preferably, in step S3, the pressure of the vacuum environment is 0.016-0.08 MPa;

preferably, in step S3, the processing time is 5-10 min;

preferably, in step S3, the vacuum-treated blueberry fruit is cleaned;

preferably, in step S3, the composition of the washing solution is: 8-12mM MgCl₂150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

4. The method of claim 1, further comprising the steps of:

s4: culturing the blueberry fruits subjected to vacuum treatment in a dark environment;

preferably, in step S4, the culture temperature is 20-28 ℃;

preferably, in step S4, the cultivation time is 1-10 days;

preferably, in step S4, the humidity of the culture is 65-80%;

preferably, in step S4, the humidity is maintained in a solution environment of: 8-12mM MgCl₂150 μ M acetosyringone, 8-12mM 2- (N-morpholine) ethanesulfonic acid, pH 5.0-6.0.

5. A system for blueberry fruit gene expression, the system comprising:

the punching device is used for punching the blueberry fruits;

a sealable container for holding blueberry fruit;

a vacuum evacuation device for evacuating the sealable container;

the method comprises the following steps of (1) carrying out agrobacterium infection suspension, wherein the agrobacterium infection suspension comprises recombinant agrobacterium and an agrobacterium infection solution; the recombinant agrobacterium is agrobacterium tumefaciens host bacteria containing a T-DNA donor vector and a Ti auxiliary plasmid; the T-DNA fragment of the T-DNA donor vector contains a target gene with an expression element, a site for inserting the target gene with the expression element, or a DNA fragment for replacing the target gene with the expression element; the agrobacterium infection solution contains 2- (N-morpholine) ethanesulfonic acid.

6. The system of claim 5, wherein the gene expression is transient gene expression;

preferably, the perforating device is a sterile needle or a sterile rod;

preferably, the diameter of the thick part of the sterile needle is 1-2 mm;

preferably, the sterile shaft has a diameter of 1-2 mm;

preferably, said T-DNA donor vector is transformed into said Agrobacterium tumefaciens host bacterium containing said Ti helper plasmid to form said recombinant Agrobacterium;

preferably, the target gene is recombined into the T-DNA donor vector by adopting a Gateway cloning method to obtain the T-DNA donor vector containing the target gene;

preferably, said T-DNA donor vector and said Ti helper plasmid are used to transform said Agrobacterium tumefaciens host bacterium simultaneously or sequentially to form said recombinant Agrobacterium;

preferably, the agrobacterium tumefaciens host bacterium containing the Ti helper plasmid is agrobacterium tumefaciens GV3101 or agrobacterium tumefaciens EHA 105;

preferably, in the T-DNA donor vector, the promoter of the target gene is an NOS promoter, a MAS promoter or a CaMV 35S promoter;

preferably, in the T-DNA donor vector, the terminator of the target gene is an NOS terminator;

preferably, the T-DNA donor vector is a binary expression vector;

preferably, the T-DNA donor vector is a binary expression vector pCAMBIA-1303 or a binary expression vectorBody Gateway^TM293 vector;

preferably, the agrobacterium infection solution comprises the following components: 8-12mM MgCl₂150-;

preferably, the agrobacterium infection solution is formed after filtration sterilization by using a filter head with the pore diameter of 0.02 mu m;

preferably, the gene of interest is the EGFP gene;

preferably, the system further comprises: a centrifugal machine.

7. Use of the method of any one of claims 1-4 or the system of claim 5 or 6 in blueberry expression of exogenous genes;

preferably, the exogenous gene for expression is a transient exogenous gene for expression;

preferably, the variety of blueberry is selected from JE, duke, jewelry, regce, mist, early blue, blue gold, blue tower, and pottery soft.

8. An operation method for expressing blueberry ACO1 genes in blueberry fruits comprises the following steps: the blueberry ACO1 gene is used as a target gene, and the target gene is transferred into blueberry fruits by using the method of any one of claims 1-4.

9. The operation method as claimed in claim 8, wherein the protein sequence encoded by the blueberry ACO1 gene is shown in SEQ ID No. 6;

preferably, the coding sequence of the blueberry ACO1 gene is shown as SEQ ID NO. 5.

10. Use of the method of operation of claim 8 or 9 to improve blueberry quality, comprising:

(1) increase in soluble sugars;

(2) the hardness of the fruits is reduced;

(3) increasing the content of anthocyanin.

Images