CN112941092A - Copper ion induced recombinant protein expression system and induction method and application thereof - Google Patents

Abstract

The invention discloses a copper ion induced recombinant protein expression system and an induction method and application thereof, belonging to the field of gene and protein engineering. The invention fuses a promoter sequence PcopA of a copper-tolerant gene copA of escherichia coli and a coding gene of a recombinant protein through genetic engineering, converts the coding gene into an escherichia coli body with both copA and cueO genes knocked out by utilizing a pUC57-Kan vector, and adds exogenous copper ions into a culture medium to efficiently induce and express the recombinant protein. The system has strong anti-interference capability, and other impurities or strong acid conditions cannot influence the expression efficiency of the recombinant protein, so that the induction of the recombinant protein can be carried out by using industrial wastewater containing copper ions, the purposes of saving energy, reducing emission and realizing resource recycling are achieved, and the system has good popularization value and application prospect.

Description

Copper ion induced recombinant protein expression system and induction method and application thereof

Technical Field

The invention relates to the field of gene and protein engineering, in particular to a copper ion induced recombinant protein expression system and an induction method and application thereof.

Background

The preparation and obtaining of recombinant proteins in expression hosts by genetic engineering and protein engineering techniques is a very widely used technique at present. At present, the commercial recombinant protein expression plasmids generally need to be added with inducers to efficiently induce protein expression, such as IPTG, arabinose and the like, and the inducers are relatively expensive, and particularly have higher cost when preparing industrial quantities of recombinant proteins. Although some self-induction methods without addition of inducer have been reported, these methods generally require the use of special self-induction medium (addition of additional compound) and are still complicated to formulate. Furthermore, if it is desired to produce a recombinant protein with a certain metal as a prosthetic group, the induction requires addition of a corresponding metal solution to the culture medium.

During the evolution process of microbes such as bacteria, a set of self-protection mechanisms capable of resisting the toxic action of high-concentration heavy metals in the environment is derived. Coli (e.coli) presents a set of copper-tolerant cop operons in vivo. Coli in a high concentration copper ion environment, the cop system is activated, the expression of CopA and CueO proteins is induced in large quantities, CopA acts to pump cytoplasmic copper ions to the periplasm, and CueO acts to pump Cu in the periplasm⁺Oxidation to Cu^{2 +}And prevents copper ions in the periplasm from entering the cytoplasm, so that the concentration of copper ions in the cytoplasm can be controlled to a low level. If the functional gene sequence of cop system is replaced by recombinant target protein coding sequence, the promoter sequence at copA upstream is reserved, so that copper ions can be used as inducer to perform high-efficiency expression of recombinant protein. Furthermore, when a protein having a copper ion as a prosthetic group is produced, it is simpler and cheaper to add only copper ionsActive protein can be obtained. Because the system has strong anti-interference capability, the copper-containing industrial wastewater containing other impurities can also effectively induce the expression of the recombinant protein.

At present, no relevant report of recombinant protein induction expression by using a heavy metal tolerance mechanism and principle of microorganisms exists. In order to reduce the preparation cost of the recombinant protein and simultaneously realize decontamination and emission reduction, the invention provides a novel recombinant protein induction method by utilizing the advantage of a bacterial heavy metal tolerance mechanism, and has a very important significance for improving the prior art.

Disclosure of Invention

The invention aims to provide a copper ion induced recombinant protein expression system, an induction method and application thereof, which can efficiently induce recombinant protein expression only by adding a copper ion solution or industrial copper-containing wastewater without using other inducers. The method has the characteristics of low cost, environmental protection and wide application prospect.

In order to achieve the purpose, the invention provides the following scheme:

in a first aspect, an expression vector is provided, wherein the expression vector comprises a copA promoter sequence added with an optimized MCS sequence, and the nucleotide sequence of the copA promoter sequence added with the optimized MCS sequence is shown as SEQ ID NO. 1.

In a second aspect, a host escherichia coli containing the expression vector is provided, wherein copA and cueO genes in the host escherichia coli are double-knocked out.

In a third aspect, a copper ion-induced recombinant protein expression system is provided, wherein the expression system comprises the host escherichia coli and the expression vector.

In a fourth aspect, there is provided a method of copper ion induced recombinant protein expression, the method steps comprising:

1) cloning the coding sequence of the target protein into the expression vector;

2) transforming the obtained expression vector into the host escherichia coli for overnight growth;

3) adding the strain growing overnight into a culture medium to culture until logarithmic phase;

4) then adding copper-containing ionic liquid into the strain culture medium for induction.

Preferably, in step 3), the strain culture medium is a fresh LB culture medium or a 2 XLB culture medium.

Preferably, the overnight grown strain of step 3) is added to the medium by allowing the starting bacteria to OD₆₀₀The value was 0.02.

Preferably, the concentration of the copper-containing ionic liquid in the step 4) is 2-2000 mu mol/L.

Preferably, the copper-containing ionic liquid in the step 4) is copper-containing industrial wastewater.

Preferably, the induction conditions described in step 4) are 16 ℃ for 24 h.

Preferably, the target protein is Pfu protein or CueO protein.

The invention discloses the following technical effects:

the invention constructs a general vector PcopA-pUC57K for expressing the recombinant protein induced by copper ions by fusing a promoter sequence of an escherichia coli copA gene with an optimized MCS (multiple cloning site) sequence and cloning a fusion fragment into a pUC57K vector. The target protein is expressed by selecting a proper MCS site according to a histidine tag at the N end or the C end of the fusion of the target protein, cloning a coding sequence of the target protein to PcopA-pUC57K to obtain PcopA-M-pUC57K (M is any target protein coding gene), and transforming the vector into a delta copA delta cueO strain. By adding a copper ion solution with a certain concentration or copper-containing industrial wastewater into a strain culture medium, the target protein with high yield and high activity can be obtained through induced expression. The recombinant protein inducible expression method disclosed by the invention has the characteristics of simplicity, convenience and low cost, can realize the purposes of removing pollution, reducing emission and recycling resources, and has wide popularization value and application prospect in the field of industrial preparation of protein.

Drawings

FIG. 1 is a plasmid map of a general vector PcopA-pUC57K for expression of a copper ion-induced recombinant protein according to the present invention;

FIG. 2 is the result of SDS-PAGE electrophoretic analysis of whole cells expressing Pfu protein of DNA polymerase induced by copper ions according to the present invention;

FIG. 3 is a graph showing the results of protein production by copper ion-induced Pfu protein expression in accordance with the present invention;

FIG. 4 is an SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoretic purity analysis result of Pfu protein obtained by copper ion-induced Pfu expression and purification according to the invention;

FIG. 5 shows the result of analysis of the DNA polymerase activity of Pfu protein obtained by copper ion-induced Pfu expression and purification according to the present invention;

FIG. 6 is the SDS-PAGE electrophoretic analysis result of the anti-interference experiment of Pfu expression induced by copper ions on other metals according to the present invention;

FIG. 7 shows the results of protein production in anti-interference experiments with other metals by Pfu expression induced by copper ions according to the present invention;

FIG. 8 shows the result of analysis of the activity of DNA polymerase in anti-interference experiments with other metals by Pfu expression induced by copper ions according to the present invention;

FIG. 9 shows the SDS-PAGE results of the whole cell expressing the copper ion-induced copper-bound laccase CueO protein according to the present invention;

FIG. 10 shows the results of protein production by copper ion-induced CueO protein expression according to the present invention;

FIG. 11 shows the SDS-PAGE electrophoretic purity analysis result of CueO protein obtained by copper ion-induced CueO protein expression and purification according to the present invention;

FIG. 12 shows the copper binding content results of CueO protein obtained by copper ion-induced CueO protein expression and purification according to the present invention;

FIG. 13 shows laccase activity results of CueO protein obtained by copper ion-induced CueO protein expression and purification according to the present invention;

FIG. 14 shows the result of SDS-PAGE analyzing the whole cell expression of Pfu protein of DNA polymerase induced by copper-containing industrial wastewater according to the present invention;

FIG. 15 shows the result of analysis of the DNA polymerase activity of Pfu protein obtained by the purification of Pfu protein induced by copper-containing industrial wastewater according to the present invention.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

Example 1

1. Knocking out copA and cueO genes of escherichia coli, and constructing copper ion sensitive delta copA delta cueO strain

1.1 design of knockout primers and identifying primers

Aiming at the Knockout of copA gene, two pairs of primers are respectively designed, wherein one pair of primers is Knockout primers copA-Knockout-P1 and copA-Knockout-P2 of which two ends contain homologous sequences of 50bp flanking the copA gene, and the upstream and downstream of the copA gene are respectively sequences at the position of 800bp and serve as a pair of identification primers copA-Check-P1 and copA-Check-P2 at the outer side, and the sequence information is as follows:

copA-Knockout-P1(SEQ ID NO.2)：TGTCACAAACTATCGACCTGACCCTGGACGGCCTGTCCTGCGGTCACTGTGTGTAGGCTGGAGCTGCTTCG；

copA-Knockout-P2(SEQ ID NO.3)：TTATTCCTTCGGTTTAAACCGCAGCAACCGGTTGGCGTTACTCACTACGGCATATGAATATCCTCCTTAGTTCCT；

copA-Check-P1(SEQ ID NO.4)：CTCGCGATGGACGAGCGG；

copA-Check-P2(SEQ ID NO.5)：GAACAAATTACACAAACATACTAAGTCATACAAGAACG；

for the deletion of the cueO gene, the sequences of a deletion primer and an identification primer are as follows:

cueO-Knockout-P1(SEQ ID NO.6)：ATGCTCAACGTTTGATTTTGTTTCGCCTGCTTAAGAATAAGGAAATAACTGTGTAGGCTGGAGCTGCTTC；

cueO-Knockout-P2(SEQ ID NO.7)：ATCAGTTTAATGCCCGGAGAGATCCGGGCATATTTCCGAATACGGTCTTTCATATGAATATCCTCCTTA；

cueO-Check-P1(SEQ ID NO.8)：AAGGAAAAAAGCGGCCGCGCAAGCAGGCTTAAGGAATCG

cueO-Check-P1(SEQ ID NO.9)：CGCACGCATGTCGACCCCGATGCCGGTTCC；

1.2 knockout of the copA Gene of E.coli

1) PCR amplification of chloramphenicol resistance gene with FRT site

The PCR system is a 150-mu-L reaction system and specifically comprises: ddH₂O60. mu.L, pKD3 plasmid (5-10 ng/. mu.L) 5. mu.L, copA-Knockout-P1 and copA-Knockout-P2 (both 10. mu.M), 5. mu.L each, 2 XPhanta Mix 75. mu.L.

The PCR amplification conditions were as follows: 3min at 95 ℃; 40s at 95 ℃; 40s at 55 ℃; 2min at 72 ℃; circulating for 35 times; 10min at 72 ℃.

Taking 2-3 microliter PCR amplification product to carry out 1% agarose gel electrophoresis identification. If a bright band is amplified near 1200bp, the amplification of the target fragment of the chloramphenicol resistance gene is successful, all the remaining amplification products are subjected to gel running recovery and purification by using a precious biological DNA gel recovery kit, 20 mu L of sterile deionized water is added to elute the recovered DNA, and 1-2 mu L of the recovered DNA is subjected to electrophoresis identification again to ensure that the band is correct in size and high in purity and is stored for later use.

2) The pKD46 plasmid was transformed into the wild type MC4100 strain, yielding the pKD46/MC4100 strain.

3) Coli pKD46/MC4100 is prepared as a recombinant competent cell.

(1) The resulting culture was inoculated with-80 ℃ frozen pKD46/MC4100 in 5mL LB liquid medium containing ampicillin and cultured overnight with shaking at 30 ℃.

(2) The fine solution is grown overnightThe bacteria were diluted at a ratio of 1:100 and added to a conical flask containing 50ml of Amp +/LB liquid medium, and cultured with shaking at 30 ℃ to OD₆₀₀Adding arabinose to a final concentration of 0.02% to 0.1, and further culturing with shaking at 30 ℃ to OD₆₀₀Is 0.5.

(3) The inoculum was transferred to a sterilized 50mL plastic centrifuge tube precooled on ice and allowed to stand on ice for 30 min.

(4) Centrifugation was carried out at 4000rpm for 15min at 4 ℃ to remove the supernatant, and the cells were resuspended in 30mL of pre-cooled 10% sterile glycerol.

(5) Centrifuging at 4000rpm for 15min at 4 deg.C, and removing supernatant.

(6) Repeat step 5 once.

(7) Resuspend the cells in 400mL 10% glycerol, carefully mix well, 40 μ L per tube, subpackage, and freeze-store at-80 deg.C or directly use for transformation.

4) Electrotransformation of targeted PCR amplified DNA fragments

(1) The 40 u L pKD46/MC4100 competent cells, adding the purified targeting DNA fragment several microliter, ensuring at least 3-4 u g DNA volume, gently mixing, transferring into electric shock cup, and placing on ice for 5 minutes.

(2) Transformation was performed by electroporation using a Bio-Rad electroscope. Conditions are as follows: 200 Ω, 25mF, voltage 2.3kV, duration 5 ms.

(3) After electric shock, 1mL of liquid LB medium is quickly added, shaking culture is carried out at 37 ℃ for 1-2h, and then a half of the bacterial liquid is sucked and coated on a chloramphenicol plate (the concentration of chloramphenicol is 20mg/mL), and culture is carried out at 37 ℃.

5) And (3) identifying the grown chloramphenicol resistant clone by PCR, and selecting a positive transformant which is successfully knocked out.

Picking colonies growing on the plate by using an autoclaved gun head, coating the colonies on a chloramphenicol plate which is separated, scribed and numbered, culturing overnight at 37 ℃, picking a little of the smeared bacterial plaques by using the gun head the next day, mixing the bacterial plaques in a PCR system which is prepared in advance and has the total volume of 20 mu L, numbering on a PCR tube, and directly amplifying by using a PCR instrument. The amplification system has no special difference from the common system, the outer primer of the copA gene is used as the amplification primer, and a tube of wild type MC4100 bacterial liquid is added as the control of the amplification template.

The PCR amplification conditions were as follows: 3min at 95 ℃; 40s at 95 ℃; 40s at 55 ℃; 2min at 72 ℃; circulating for 35 times; 10min at 72 ℃.

And 3-5 mu L of product is taken for agarose gel electrophoresis identification after PCR is finished. An identification primer designed at the upstream and downstream 800bp of the copA gene is used, a 4102bp band is amplified by taking the wild strain as a template, and a 2749bp band is amplified by taking the to-be-identified knockout strain delta copA as a template, so that the copA gene is successfully knocked out on the basis of the wild MC4100 strain to obtain the delta copA strain.

6) Transformation of the pCP20 plasmid

The pCP20 plasmid was transformed into cold CaCl₂The delta copA competent cells prepared by the method are uniformly coated with bacterial liquid on LB/Amp⁺-Cm⁺On the plate, after the bacterial liquid is fully absorbed, the plate is inverted, and cultured overnight at 30 ℃.

7) Elimination of chloramphenicol resistance gene

Taking a single colony from a pCP 20-delta copA bacterial transformation plate by using an inoculating needle, inoculating the single colony into 3mL LB liquid culture medium, and carrying out shake culture at 42 ℃ and 250rpm for 4 h; one loop was streaked onto LB plate and cultured overnight at 37 ℃. From the overnight-incubated bacteria (at which the chloramphenicol resistance gene was removed and the pCP20 plasmid was lost) plates at 37 ℃ with an inoculating needle, 3 single colonies were picked and spotted on LB/Cm⁺Placing on LB blank plate, culturing at 37 deg.C for 6 h; at LB/Cm⁺Bacteria that did not grow on the plates but on LB plates indicated that the chloramphenicol resistance gene was successfully removed. Further, the complete elimination of the resistance gene was confirmed by PCR identification. The colony is directly added into 100 mu L water to be boiled for 10min, and then is centrifuged to be used as a template, and an identifying primer is used for preparing a PCR system for PCR amplification.

8) Purification of the Δ copA Single knock-out bacterium

Single colonies were picked from the Δ copA zone streaking plates, and a few bacteria were zone streaked to new LB plates with an inoculating loop and cultured overnight at 37 ℃. And (3) selecting the remaining colonies into 100 mu L of sterile water, boiling for 10min, centrifuging, taking the supernatant as a template for PCR identification, and obtaining purified delta copA single-knock-out bacteria after correct identification.

1.3 construction of E.coli. delta. copA. delta. cueO double knockout Strain

And further knocking out the cueO gene on the basis of delta copA single knock-out bacteria to construct a copA and cueO double-knock-out strain, wherein the method is the same as the construction of delta copA single knock-out bacteria. And (3) after the identification primer is used for identification, the construction of the delta copA delta cueO double knockout strain is completed.

2. Construction of copper ion-induced recombinant protein expression general-purpose vector PcopA-pUC57K

The fusion sequence PcopA-MCS was synthesized directly from the Escherichia coli copA promoter sequence PcopA plus an optimized MCS sequence by Nanjing Kingsler Biotech. PCR amplification of PcopA-MCS gene fragment was performed with primers PcopA-MCS-1 and PcopA-MCS-2; the primer sequences are respectively as follows:

PcopA-MCS-1(SEQ ID NO.10)：AATTCCTCACCCCGGTGCCG；

PcopA-MCS-2(SEQ ID NO.11)：AAGTCAGTGGTGGTGGTGGT；

and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min, 40s at 95 ℃, 40s at 50 ℃ and 1min at 72 ℃ for 35 cycles, and final extension at 72 ℃ for 10 min.

PCR amplification of the Linear pUC57K vector with the primers pUC57K-1 and pUC 57K-2; the primer sequences are respectively as follows:

pUC57K-1(SEQ ID NO.12)：ACCACCACCACCACTGACTTGGTGTAATCATGGTCATAGCTG；

pUC57K-2(SEQ ID NO.13)：

CGGCACCGGGGTGAGGAATTGATATCTAGATGTATTCGCGAGGTAC；

and (3) verifying the amplification product through electrophoresis, wherein after the successful amplification is verified, the PcopA-MCS gene fragment and the linear pUC57K vector are respectively subjected to gel recovery, the two fragments are mixed according to the operation of the seamless cloning kit specification for seamless cloning, the ligation product is transformed into competent cells, positive cloning is selected, sequencing verification is carried out, and a copper ion induced recombinant protein expression universal vector PcopA-pUC57K (the map is shown in figure 1, and the DNA sequence is shown in SEQ ID NO: 14) is constructed.

3. Construction of vector PcopA-Pfu-pUC57K for expression of Pfu protein by DNA polymerase induced by copper ion

The Pfu gene encoding the protein was directly synthesized from the amino acid sequence of Pfu protein, a DNA polymerase of thermophilic thermophile Pyrococcus furiosis, according to the codon preference of Escherichia coli by Soviet biosciences, Nanjing Kingsry. Carrying out PCR amplification on the Pfu gene fragment by using primers Pfu-1 and Pfu-2; the primer sequences are respectively as follows:

Pfu-1(SEQ ID NO.15)：GTGCCGCGCGGCAGCGTCGACATGATCCTGGACGTGGACTAC；

Pfu-2(SEQ ID NO.16)：

CTCGAGTGCGGCCGCAAGCTTTTAGCTTTTCTTGATGTTCAGCCAGC；

and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min, at 95 ℃ for 40s, at 50 ℃ for 40s, at 72 ℃ for 3min for 35 cycles, and final extension at 72 ℃ for 10 min.

And (3) verifying an amplification product through electrophoresis, recovering glue from the Pfu gene fragment after verifying that the amplification is successful, performing seamless cloning on the Pfu gene fragment and a PcopA-pUC57K linear vector subjected to double enzyme digestion by Sal I and Hind III according to the operation of a seamless cloning kit specification, transforming a connecting product into a competent cell, selecting a positive clone after double enzyme digestion identification, performing sequencing verification and constructing to obtain a vector PcopA-Pfu-pUC57K (the DNA sequence is shown as SEQ ID NO: 17) expressed by the copper ion-induced DNA polymerase Pfu protein.

4. Construction of vector PcopA-CueO-pUC57K for copper ion induced copper-bound laccase CueO protein expression

According to the amino acid sequence of the copper-combined laccase CueO protein of the escherichia coli, codon sequence optimization is carried out by Nanjing Kingsler Biotech company, and the encoding gene CueO of the protein is directly synthesized. Carrying out PCR amplification on the cueO gene segment by using primers CueO-1 and CueO-2; the primer sequences are respectively as follows:

CueO-1(SEQ ID NO.18)：

GTGCCGCGCGGCAGCGTCGACATGGCTGAAAGGCCTACACTACCC

CueO-2(SEQ ID NO.19)：

CTCGAGTGCGGCCGCAAGCTTTCACACGGTAAAGCCCAGC

and (3) verifying an amplification product through electrophoresis, performing gel recovery on the cueO gene fragment after successful amplification verification, performing seamless cloning on the primer and a PcopA-pUC57K linear vector subjected to double enzyme digestion by Sal I and Hind III according to the operation of a seamless cloning kit specification, converting a connecting product into a competent cell, selecting positive cloning after double enzyme digestion identification, performing sequencing verification and constructing to obtain a vector PcopA-CueO-pUC57K (the DNA sequence is shown as SEQ ID NO: 20) expressed by copper ion induced copper combined laccase CueO protein.

5. Obtaining of Strain

The resulting PcopA-Pfu-pUC57K and PcopA-CueO-pUC57K plasmids were transformed into wild-type MC4110 and. DELTA. copA. DELTA. cueO competent cells, respectively, to give PcopA-Pfu-pUC57K/MC4100, PcopA-CueO-pUC57K/MC4100, PcopA-Pfu-pUC 57K/. DELTA. copA. DELTA. cueO, and PcopA-CueO-pUC 57K/. DELTA. copA. DELTA. cueO strains.

6. Analysis of expression of Pfu protein by DNA polymerase induced by copper ions and determination of activity of Pfu protein

PcopA-Pfu-pUC57K/MC4100 and PcopA-Pfu-pUC 57K/. DELTA.copA. DELTA.cueO strains were grown overnight. 10. mu.L of the overnight-grown bacterial suspension was added to 1L of fresh LB liquid medium to make the starting bacterial suspension OD₆₀₀The value is 0.02, kanamycin is added, the culture is carried out at the constant temperature of 37 ℃ and 250r/min by shaking, and the OD is monitored₆₀₀To 0.6, adding CuCl with final concentration of 0, 2, 5, 25, 100, 500, 1000, 2000 mu mol/L into each bacteria liquid₂Inducing in water solution at 16 deg.c for 24 hr. Thereafter, the cells were collected by centrifugation at 8000r/min at 4 ℃ for 10min, resuspended in Tris buffer (20mM Tris-HCl, 500mM NaCl, pH 8.0) and the bacterial density OD was determined₆₀₀ Is 10. And sucking 10 mu L of each bacterial fluid sample to perform SDS-PAGE electrophoresis to identify the protein expression condition.

As shown in FIG. 2, it is a SDS-PAGE electrophoretic analysis of the expression of Pfu protein by DNA polymerase induced by copper ions at different concentrations. The results show that: the PcopA-Pfu-pUC57K plasmid in the MC4100 strain showed significant expression of Pfu protein only when the copper ion concentration was increased to 2000. mu. mol/L. However, in the strain Δ copA Δ cueO, the Pfu protein can be significantly induced to express at a copper ion concentration of 2 μmol/L. This indicates that after the copA and cueO genes are knocked out, Escherichia coli is very sensitive to copper ions, and recombinant protein expression can be induced only by copper ions with very low concentration. Therefore, from the viewpoint of saving cost and improving protein yield, the delta copA delta cueO strain is used as a host for inducing recombinant protein expression by copper ions. From the results of the electrophoretic analysis, it was found that Pfu was expressed in the Δ copA Δ cueO strain, and when the copper ion concentration in the medium was 25 μmol/L, the protein expression level per cell amount was saturated, and further increase in the copper ion concentration did not increase the protein expression level.

The yield of protein produced per volume of bacteria-containing medium was then analyzed. As can be seen from FIG. 3, the protein yield per unit volume first gradually increases with the increase of the copper ion concentration, and when the copper ion concentration is 25. mu. mol/L, the protein yield per unit volume reaches the highest value of 68.23mg/L (68.23 mg of Pfu protein can be obtained per liter of bacterial liquid). Since a high concentration of copper ions inhibits the growth of bacteria, and the yield of protein per unit volume is rather gradually decreased as the concentration of copper ions in the medium continues to increase, 25. mu. mol/L can be considered as the optimum concentration of copper ions for inducing the expression of Pfu protein. The induced cells were disrupted, centrifuged, and the supernatant was purified by a nickel column to obtain Pfu-purified protein having a purity of more than 95% (see FIG. 4).

The purified Pfu protein was then analyzed for DNA polymerase activity. A50 μ L PCR system was as follows: 20ng of plasmid PcopA-CueO-pUC57K as a template, 1. mu.L of each of the upper and lower primers (20. mu.M, SEQ ID21: GGTGATGACGGTGAAAACCTCTGAC and SEQ ID 22: CAATCTATCGCTTGTATGGGAAGCCCG as sequences), 0.5. mu.L of the purified Pfu protein (3. mu.M (lane 3), 1.5. mu.M (lane 4) and 0.75. mu.M (lane 5)), and 50. mu.L of Pfu buffer and water as a whole. The commercial Pfu enzyme (5U/. mu.L) was used as a positive control (lane 1) and no enzyme was added as a negative control (lane 2). And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min, at 95 ℃ for 40s, at 50 ℃ for 40s, at 72 ℃ for 4min for 35 cycles, and final extension at 72 ℃ for 10 min.

As shown in the results of FIG. 5, Pfu protein induced by copper ions had higher DNA polymerase activity and specific activity of 36,122U/mg, similar to that of commercial Pfu.

In addition, the anti-interference capability of the copper ion induced recombinant protein expression system is analyzed. When the PcopA-Pfu-pUC 57K/. DELTA.copA. DELTA.cueO strain was grown to its OD₆₀₀When the concentration is 0.6, subpackaging the bacterial liquid into multiple tubes, and simultaneously adding copper ions with final concentration of 25 mu mol/L and other metal ions with final concentration of 50 mu mol/L, including Mg, into each tube of bacterial liquid²⁺、Ca²⁺、Fe³⁺、Zn^{2 +}、Co²⁺、Ni²⁺、Pb²⁺、As⁵⁺、Cr⁶⁺. Protein expression was identified by SDS-PAGE after 24h induction at 16 ℃ and protein production per volume of medium was analyzed. As shown in FIGS. 6 and 7, the other various excessive metal ions did not affect the expression yield of Pfu protein induced by copper ions. In addition, fig. 8 shows that other metal ions do not affect the DNA polymerase activity of Pfu protein either. This indicates that the expression of Pfu protein can be efficiently induced using a mixed solution containing copper without using a pure copper solution, suggesting that it becomes possible to use copper-containing wastewater as an inducer, which will further reduce costs.

7. Analysis of copper ion induced copper combined laccase CueO protein expression and determination of CueO protein activity

PcopA-CueO-pUC57K/MC4100 and PcopA-CueO-pUC 57K/. DELTA.copA. DELTA.cueO strains were grown overnight. 10. mu.L of the overnight-grown bacterial suspension was added to 1L of fresh LB liquid medium to make the starting bacterial suspension OD₆₀₀The value is 0.02, kanamycin is added, the culture is carried out at the constant temperature of 37 ℃ and 250r/min by shaking, and the OD is monitored₆₀₀To 0.6, adding CuCl with final concentration of 0, 5, 25, 100, 500, 1000, 2000 [ mu ] mol/L to each bacteria liquid₂Inducing in water solution at 16 deg.c for 24 hr. Thereafter, the cells were collected by centrifugation at 8000r/min at 4 ℃ for 10min, resuspended in Tris buffer (20mM Tris-HCl, 500mM NaCl, pH 8.0) and the bacterial density OD was determined₆₀₀ Is 10. And sucking 10 mu L of each bacterial fluid sample to perform SDS-PAGE electrophoresis to identify the protein expression condition.

As shown in FIG. 9, it is a SDS-PAGE electrophoretic analysis chart of the copper ion-induced expression of the CueO protein of the copper-bound laccase in different concentrations. The results show that: the PcopA-CueO-pUC57K plasmid failed to induce CueO protein expression in the MC4100 strain even when the copper ion concentration was increased to 2000. mu. mol/L. Whereas in the Δ copA Δ cueO strain, the expression of cueO protein increases stepwise with the increase in copper ion concentration. Therefore, the Δ copA Δ cueO strain was used as a host for copper ion-induced cueO protein expression. From the results of the electrophoretic analysis, it was found that Pfu was expressed in the Δ copA Δ cueO strain, and the amount of protein expressed per cell amount reached the maximum value when the concentration of copper ions in the medium was 500 μmol/L. As can be seen from FIG. 10, the protein yield per unit volume first gradually increases with the increase of the copper ion concentration, and when the copper ion concentration is 500. mu. mol/L, the protein yield per unit volume reaches the highest value of 47.94mg/L (47.94 mg of CueO protein can be obtained per liter of bacterial liquid). High concentrations of copper ions inhibit bacterial growth, so that the protein production per volume decreases as the concentration of copper ions in the medium continues to increase. The induced bacteria were disrupted, centrifuged, and the supernatant was purified by nickel column to obtain CueO purified protein with a purity of more than 95% (see FIG. 11).

CueO protein is copper-bound laccase, so the copper-binding content of CueO protein is measured by ICP-MS instrument. As shown in FIG. 12, the copper-binding content of CueO protein increased with the increase of the concentration of copper ions in the medium, and the CueO-bound copper content substantially reached the highest (3.80 copper ions bound per molecule of protein) when 1000. mu. mol/L copper ions were added to the medium.

The laccase activity of CueO was also analyzed using ABTS as a substrate. The 150uL activity assay system was as follows: CueO protein 15. mu.L, ABTS 50. mu.L at a final concentration of 1mM, and citrate buffer (pH 3.0) 85. mu.L. Incubating in water bath at 50 deg.C for 20min, substituting protein with the same volume of protein buffer solution as negative control, and determining absorbance OD value at 420 nm. Calculation of product formation (. mu.M) — (OD)₄₂₀/36). times.1000. The enzyme activity unit is defined as the amount of enzyme required to oxidize 1. mu. mol of substrate as one enzyme activity unit U. As shown in FIG. 13, the laccase activity of the copper ion-induced CueO protein was low at 100. mu. mol/L and 500. mu. mol/L in the medium, while the copper ion-induced CueO protein at 1000. mu. mol/L had high laccase activity. The laccase activity result is consistent with the copper ion content result, and the laccase activity of the CueO protein is shown to depend on the combination of copper ions. Considering both protein yield and laccase activity of CueO, 1000. mu. mol/L can be considered as the optimal concentration of copper ions to induce CueO protein expression.

8. Inducing recombinant protein expression and activity analysis by using copper-containing industrial wastewater

The industry relates to the industries of electroplating processing, material casting and the like, and a large amount of copper-containing waste water is generated in daily production and needs to be subjected to decontamination treatment so as to be discharged into the environment. Because the copper ion induced recombinant protein expression system described by the invention has stronger anti-interference capability, the induced expression of the recombinant protein is attempted by directly using the copper-containing industrial wastewater.

36 parts of water sample are randomly collected from an electroplating industrial park, copper ions in the water sample are measured by ICP-MS, and 5 parts of water sample with overproof copper ion content (>1.5mg/L and the highest allowable copper emission concentration according to WHO) and 1 part of water sample with lower copper ion content (negative control) are randomly selected from the water sample. Then, the pH value (pH) and the total dissolved solid content (TDS) of 6 water samples were respectively detected, and the results are shown in Table 1:

table 16 physicochemical properties of water samples

Water sample numbering	1	2	3	4	5	6
							Cu2+(mg/L)	2.94	4.16	1.54	2.43	5.31	0.004
pH	5.2	4.1	5.8	6.1	3.5	7.8
							TDS(g/L)	1.06	3.03	1.85	2.84	4.47	0.82

The PcopA-Pfu-pUC 57K/. DELTA.copA. DELTA.cueO strain was grown overnight. 10. mu.L of the overnight-grown bacterial suspension was aspirated and added to 250mL of 2 × LB liquid medium (each component content is 2 times of the conventional amount, antibiotic concentration is not changed) in 7 flasks, respectively, so that OD of the starting bacterial suspension was adjusted₆₀₀The value is 0.02, the culture is carried out under shaking at a constant temperature of 250r/min at 37 ℃, and the OD is monitored₆₀₀And when the temperature reaches 0.6, 250mL of deionized water and the water samples with the numbers of 1-6 are added into each bottle respectively, and induction is carried out for 24h under the condition of 16 ℃. Then, the cells were collected at 8000r/min by centrifugation at 4 ℃ for 10min, resuspended in Tris buffer (20mM Tris-HCl, 500mM NaCl, pH 8.0), and a small amount of each cell suspension was taken up for SDS-PAGE to identify protein expression. And crushing and centrifuging the residual bacteria liquid, and purifying the supernatant by using a nickel column. Then, the purified Pfu protein was subjected to DNA polymerase activity assay.

As shown in FIG. 14, it is an SDS-PAGE electrophoretic analysis chart of Pfu protein expression induced by different industrial wastewater samples. NC is a negative control of deionized water, and Pfu expression is not seen. Because the No. 1-5 water sample contains copper ions with higher concentration, the expression of Pfu protein can be obviously induced, and the No. 6 water sample has low content of copper ions and cannot induce and express Pfu. FIG. 15 shows that Pfu protein induced by water samples Nos. 1 to 5 has higher enzyme activity.

It is worth emphasizing that, as shown in the above table, the water samples No. 1-5 present different degrees of acidity and all contain high content of soluble solid impurities, and this result shows that the copper ion induced recombinant protein expression system of the present invention has good anti-interference capability, can directly use copper-containing industrial wastewater to induce and express recombinant protein, and has good application prospects.

Pfu, a high fidelity DNA polymerase commonly used in biomedical research, is a commercially available Pfu enzyme that is more expensive than other common DNA polymerases. Laccase is a polyphenol oxidase taking copper ions as prosthetic groups, and is widely applied to the fields of food, paper making, textile industry, environmental protection, biomedicine and the like. Since the two recombinant proteins are widely used and are in great demand, the two recombinant proteins are generally fermented on an industrial scale in large quantities to induce protein expression. Generally, the induction of protein expression requires expensive inducer, and the cost is high in large-scale preparation. In addition, for inducing the recombinant protein taking copper ions as prosthetic groups, a conventional inducer is required to be used during induction, and a copper ion solution is required to be additionally added, so that the process is complicated. The invention describes a recombinant protein expression method using copper ions as an inducer and application thereof. Mainly constructs a general expression vector of the copper ion induced recombinant protein, namely PcopA-pUC57K, clones the coding gene sequence of the target protein to the MCS proper site of PcopA-pUC57K, and transforms the coding gene sequence to a delta copA delta cueO strain sensitive to copper ions. Only a copper ion solution with a certain concentration or wastewater containing copper ions needs to be added, and the recombinant protein with activity can be efficiently induced and expressed. The method is simple, convenient, cheap, green and environment-friendly, can save energy, reduce emission and recycle waste copper ions, and has strong popularization value and application prospect in the aspect of large-scale preparation of recombinant protein.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Wenzhou university of medical science

<120> copper ion induced recombinant protein expression system and induction method and application thereof

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 392

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aattcctcac cccggtgccg attttcaggc atcctgattt aacttagcac ccgcaactta 60

actacaggaa aacaaagaga taaatgtcta atcctgatgc aaatcgagcc gattttttaa 120

tctttacgga cttttacccg cctggtttat taatttcttg accttcccct tgctggaagg 180

tttaaccttt atcacagcca gtcaaaactg tcttaaagga gtgttttatg gctagcagcc 240

atcatcatca tcatcacagc agcggcctgg tgccgcgcgg cagcgtcgac gctaccatga 300

ctggtggaca gcaaatgggt cgggatccga attcgagctc cgtcatcaag cttgcggccg 360

cactcgagca ccaccaccac caccactgac tt 392

<210> 2

<211> 71

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgtcacaaac tatcgacctg accctggacg gcctgtcctg cggtcactgt gtgtaggctg 60

gagctgcttc g 71

<210> 3

<211> 75

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttattccttc ggtttaaacc gcagcaaccg gttggcgtta ctcactacgg catatgaata 60

tcctccttag ttcct 75

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctcgcgatgg acgagcgg 18

<210> 5

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaacaaatta cacaaacata ctaagtcata caagaacg 38

<210> 6

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgctcaacg tttgattttg tttcgcctgc ttaagaataa ggaaataact gtgtaggctg 60

gagctgcttc 70

<210> 7

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atcagtttaa tgcccggaga gatccgggca tatttccgaa tacggtcttt catatgaata 60

tcctcctta 69

<210> 8

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaggaaaaaa gcggccgcgc aagcaggctt aaggaatcg 39

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cgcacgcatg tcgaccccga tgccggttcc 30

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aattcctcac cccggtgccg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aagtcagtgg tggtggtggt 20

<210> 12

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

accaccacca ccactgactt ggtgtaatca tggtcatagc tg 42

<210> 13

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cggcaccggg gtgaggaatt gatatctaga tgtattcgcg aggtac 46

<210> 14

<211> 2929

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagagaatt cgagctcggt acctcgcgaa 420

tacatctaga tatcaattcc tcaccccggt gccgattttc aggcatcctg atttaactta 480

gcacccgcaa cttaactaca ggaaaacaaa gagataaatg tctaatcctg atgcaaatcg 540

agccgatttt ttaatcttta cggactttta cccgcctggt ttattaattt cttgaccttc 600

cccttgctgg aaggtttaac ctttatcaca gccagtcaaa actgtcttaa aggagtgttt 660

tatggctagc agccatcatc atcatcatca cagcagcggc ctggtgccgc gcggcagcgt 720

cgacgctacc atgactggtg gacagcaaat gggtcgggat ccgaattcga gctccgtcat 780

caagcttgcg gccgcactcg agcaccacca ccaccaccac tgacttggtg taatcatggt 840

catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg 900

gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt 960

tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg 1020

gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg 1080

actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa 1140

tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc 1200

aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 1260

ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 1320

aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 1380

cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct 1440

cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 1500

aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 1560

cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 1620

ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 1680

gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 1740

gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 1800

agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 1860

acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga 1920

tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaagccca atctgaataa 1980

tgttacaacc aattaaccaa ttctgattag aaaaactcat cgagcatcaa atgaaactgc 2040

aatttattca tatcaggatt atcaatacca tatttttgaa aaagccgttt ctgtaatgaa 2100

ggagaaaact caccgaggca gttccatagg atggcaagat cctggtatcg gtctgcgatt 2160

ccgactcgtc caacatcaat acaacctatt aatttcccct cgtcaaaaat aaggttatca 2220

agtgagaaat caccatgagt gacgactgaa tccggtgaga atggcaaaag tttatgcatt 2280

tctttccaga cttgttcaac aggccagcca ttacgctcgt catcaaaatc actcgcatca 2340

accaaaccgt tattcattcg tgattgcgcc tgagcgagac gaaatacgcg atcgctgtta 2400

aaaggacaat tacaaacagg aatcgaatgc aaccggcgca ggaacactgc cagcgcatca 2460

acaatatttt cacctgaatc aggatattct tctaatacct ggaatgctgt ttttccgggg 2520

atcgcagtgg tgagtaacca tgcatcatca ggagtacgga taaaatgctt gatggtcgga 2580

agaggcataa attccgtcag ccagtttagt ctgaccatct catctgtaac atcattggca 2640

acgctacctt tgccatgttt cagaaacaac tctggcgcat cgggcttccc atacaagcga 2700

tagattgtcg cacctgattg cccgacatta tcgcgagccc atttataccc atataaatca 2760

gcatccatgt tggaatttaa tcgcggcctc gacgtttccc gttgaatatg gctcataaca 2820

ccccttgtat tactgtttat gtaagcagac agttttattg ttcatgatga tatattttta 2880

tcttgtgcaa tgtaacatca gagattttga gacacgggcc agagctgca 2929

<210> 15

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtgccgcgcg gcagcgtcga catgatcctg gacgtggact ac 42

<210> 16

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ctcgagtgcg gccgcaagct tttagctttt cttgatgttc agccagc 47

<210> 17

<211> 5200

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagagaatt cgagctcggt acctcgcgaa 420

tacatctaga tatcaattcc tcaccccggt gccgattttc aggcatcctg atttaactta 480

gcacccgcaa cttaactaca ggaaaacaaa gagataaatg tctaatcctg atgcaaatcg 540

agccgatttt ttaatcttta cggactttta cccgcctggt ttattaattt cttgaccttc 600

cccttgctgg aaggtttaac ctttatcaca gccagtcaaa actgtcttaa aggagtgttt 660

tatggctagc agccatcatc atcatcatca cagcagcggc ctggtgccgc gcggcagcgt 720

cgacatgatc ctggacgtgg actacattac cgaagagggc aagccggtta tccgcctgtt 780

caagaaagag aatggcaagt tcaaaatcga gcacgaccgt accttccgtc cgtacatcta 840

tgcgctgctg cgtgacgata gcaaaattga ggaagtgaag aaaatcaccg gcgagcgtca 900

cggcaagatt gtgcgtatcg tggacgttga aaaagttgag aagaaatttc tgggtaaacc 960

gattaccgtt tggaagctgt acctggaaca cccgcaggat gttccgacca tccgtgagaa 1020

agtgcgtgaa cacccggcgg tggttgacat tttcgagtac gatatcccgt ttgcgaaacg 1080

ttatctgatt gacaagggtc tgatcccgat ggaaggcgag gaagagctga aaattctggc 1140

gttcgatatc gaaaccctgt atcacgaagg cgaagagttt ggcaagggcc cgatcattat 1200

gattagctac gcggacgaga acgaagcgaa agtgattacc tggaagaaca tcgatctgcc 1260

gtacgttgag gtggttagca gcgagcgtga aatgatcaag cgtttcctgc gtatcattcg 1320

tgaaaaagac ccggatatca ttgtgaccta caacggtgac agcttcgatt ttccgtatct 1380

ggcgaagcgt gcggagaaac tgggcattaa gctgaccatc ggtcgtgacg gcagcgagcc 1440

gaagatgcag cgtattggtg atatgaccgc ggtggaagtt aaaggccgta tccacttcga 1500

cctgtatcac gtgattaccc gtaccatcaa cctgccgacc tacaccctgg aggcggtgta 1560

tgaagcgatt tttggtaaac cgaaggagaa agtttacgcg gacgaaatcg cgaaagcgtg 1620

ggaaagcggc gagaacctgg aacgtgttgc gaaatacagc atggaggatg cgaaggcgac 1680

ctatgagctg ggtaaagaat tcctgccgat ggaaatccag ctgagccgtc tggttggtca 1740

accgctgtgg gatgtgagcc gtagcagcac cggcaacctg gtggagtggt ttctgctgcg 1800

taaggcgtac gagcgtaacg aagttgcgcc gaacaaaccg agcgaagagg aataccaacg 1860

tcgtctgcgt gagagctata ccggtggctt cgtgaaagag ccggaaaagg gtctgtggga 1920

aaacatcgtt tacctggact ttcgtgcgct gtatccgagc atcattatca cccacaacgt 1980

gagcccggac accctgaacc tggaaggttg caaaaactat gatatcgcgc cgcaggttgg 2040

ccacaagttc tgcaaagata ttccgggttt tattccgagc ctgctgggtc acctgctgga 2100

ggaacgtcag aagattaaaa ccaagatgaa agaaacccaa gacccgattg aaaagatcct 2160

gctggattac cgtcaaaagg cgatcaaact gctggcgaac agcttctacg gttactatgg 2220

ctatgcgaaa gcgcgttggt attgcaaaga atgcgcggaa agcgtgaccg cgtggggtcg 2280

taagtacatt gagctggttt ggaaagaact ggaggaaaaa ttcggtttta aggtgctgta 2340

catcgacacc gatggcctgt atgcgaccat tccgggtggc gagagcgagg aaatcaagaa 2400

aaaggcgctg gaattcgtta aatatattaa cagcaagctg ccgggcctgc tggagctgga 2460

atacgagggt ttttataaac gtggcttctt tgttaccaaa aagcgttacg cggtgatcga 2520

cgaggaaggt aaagtgatta cccgtggcct ggagatcgtg cgtcgtgatt ggagcgagat 2580

tgcgaaggaa acccaggcgc gtgtgctgga aaccatcctg aaacacggtg acgttgagga 2640

agcggtgcgt attgttaaag aagtgatcca gaagctggcg aactacgaga tcccgccgga 2700

aaagctggcg atttatgagc aaatcacccg tccgctgcac gaatacaaag cgattggtcc 2760

gcacgtggcg gttgcgaaaa agctggcggc gaagggcgtt aagatcaaac cgggtatggt 2820

tattggctat atcgtgctgc gtggtgacgg cccgattagc aaccgtgcga tcctggcgga 2880

ggaatacgac ccgaaaaagc acaaatatga tgcggagtac tatattgaaa accaagttct 2940

gccggcggtg ctgcgtatcc tggagggttt tggctaccgt aaggaagatc tgcgttatca 3000

aaagacccgt caagttggcc tgaccagctg gctgaacatc aagaaaagct aaaagcttgc 3060

ggccgcactc gagcaccacc accaccacca ctgacttggt gtaatcatgg tcatagctgt 3120

ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 3180

agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 3240

tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 3300

cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 3360

gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 3420

ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 3480

ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 3540

atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 3600

aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 3660

gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 3720

ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 3780

ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 3840

acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 3900

gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat 3960

ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 4020

ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 4080

gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 4140

ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 4200

agatcctttt aaattaaaaa tgaagtttta aatcaagccc aatctgaata atgttacaac 4260

caattaacca attctgatta gaaaaactca tcgagcatca aatgaaactg caatttattc 4320

atatcaggat tatcaatacc atatttttga aaaagccgtt tctgtaatga aggagaaaac 4380

tcaccgaggc agttccatag gatggcaaga tcctggtatc ggtctgcgat tccgactcgt 4440

ccaacatcaa tacaacctat taatttcccc tcgtcaaaaa taaggttatc aagtgagaaa 4500

tcaccatgag tgacgactga atccggtgag aatggcaaaa gtttatgcat ttctttccag 4560

acttgttcaa caggccagcc attacgctcg tcatcaaaat cactcgcatc aaccaaaccg 4620

ttattcattc gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt aaaaggacaa 4680

ttacaaacag gaatcgaatg caaccggcgc aggaacactg ccagcgcatc aacaatattt 4740

tcacctgaat caggatattc ttctaatacc tggaatgctg tttttccggg gatcgcagtg 4800

gtgagtaacc atgcatcatc aggagtacgg ataaaatgct tgatggtcgg aagaggcata 4860

aattccgtca gccagtttag tctgaccatc tcatctgtaa catcattggc aacgctacct 4920

ttgccatgtt tcagaaacaa ctctggcgca tcgggcttcc catacaagcg atagattgtc 4980

gcacctgatt gcccgacatt atcgcgagcc catttatacc catataaatc agcatccatg 5040

ttggaattta atcgcggcct cgacgtttcc cgttgaatat ggctcataac accccttgta 5100

ttactgttta tgtaagcaga cagttttatt gttcatgatg atatattttt atcttgtgca 5160

atgtaacatc agagattttg agacacgggc cagagctgca 5200

<210> 18

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gtgccgcgcg gcagcgtcga catggctgaa aggcctacac taccc 45

<210> 19

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ctcgagtgcg gccgcaagct ttcacacggt aaagcccagc 40

<210> 20

<211> 4342

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagagaatt cgagctcggt acctcgcgaa 420

tacatctaga tatcaattcc tcaccccggt gccgattttc aggcatcctg atttaactta 480

gcacccgcaa cttaactaca ggaaaacaaa gagataaatg tctaatcctg atgcaaatcg 540

agccgatttt ttaatcttta cggactttta cccgcctggt ttattaattt cttgaccttc 600

cccttgctgg aaggtttaac ctttatcaca gccagtcaaa actgtcttaa aggagtgttt 660

tatggctagc agccatcatc atcatcatca cagcagcggc ctggtgccgc gcggcagcgt 720

cgacatggct gaaaggccta cactacccat accagattta ctgaccacgg atgcacgcaa 780

ccgcatccaa ttgaccattg gtgcgggcca aagcaccttt ggtggtaaga ccgcaaccac 840

ctggggctac aacggcaacc tgctgggtcc ggcggttaag ctgcaacgtg gtaaggctgt 900

gacggtggat atttataacc agctgaccga ggaaaccacg ctgcattggc atggcctcga 960

ggtaccgggt gaagtggacg gcggtccgca aggtatcatc ccgccgggtg gtaagcgcag 1020

cgttaccctt aacgttgacc aaccggcggc tacctgttgg ttccacccgc atcagcacgg 1080

caaaaccggc cgtcaggttg caatgggtct ggcaggtctg gtcgtgattg aagacgatga 1140

gattttgaaa ttgatgttgc cgaaacagtg gggtatcgac gacgtcccgg tcatagtgca 1200

ggacaaaaaa ttcagcgcgg atggccaaat tgactaccaa ttggatgtta tgaccgcagc 1260

ggtgggctgg ttcggtgaca cattgttaac gaacggcgcg atctacccgc agcatgctgc 1320

tccgcgtggc tggctgcgtc tgcgcctgtt gaacgggtgc aatgcaagaa gcttgaactt 1380

cgccaccagc gacaaccgtc cgctgtatgt tatcgcctcc gatggtggcc tgttgcctga 1440

accggtgaag gtgagcgagc tgccggtgct gatgggtgag cgctttgaag tgctggtgga 1500

agtaaatgat aataagccgt tcgacctggt taccctgcca gtatcgcaaa tgggcatggc 1560

gatcgcgcca tttgacaaac cgcatccggt tatgcgtatc cagccgatcg ccatctcggc 1620

gtcaggcgcg ctgccggata ccctgagcag cctgccggcg ctgccctctc ttgagggtct 1680

gactgttcgt aaacttcagc tgtctatgga tccgatgctg gacatgatgg gtatgcagat 1740

gctgatggaa aaatacggcg accaggcaat ggccggtatg gaccacagcc agatgatggg 1800

ccacatgggt catgggaata tgaaccacat gaatcacggc ggaaagttcg acttccacca 1860

cgctaataag atcaatggcc aagcgtttga catgaacaag ccgatgttcg ctgcggcgaa 1920

aggtcaatat gaacgttggg ttatttccgg tgttggtgat atgatgctgc acccgtttca 1980

tattcatgga acccagtttc gtattctgtc cgagaacggt aagccgccag ccgcgcatcg 2040

tgctggctgg aaagatactg tgaaggtcga gggcaatgtt tctgaggtct tggttaagtt 2100

caaccacgat gcccctaaag aacacgcgta tatggcgcac tgccatctct tggagcacga 2160

agatactggt atgatgctgg gctttaccgt gtgaaagctt gcggccgcac tcgagcacca 2220

ccaccaccac cactgacttg gtgtaatcat ggtcatagct gtttcctgtg tgaaattgtt 2280

atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg 2340

cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg 2400

gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 2460

gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 2520

ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 2580

acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 2640

cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 2700

caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 2760

gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 2820

tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt 2880

aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 2940

ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 3000

cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 3060

tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc 3120

tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 3180

ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 3240

aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 3300

aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 3360

aatgaagttt taaatcaagc ccaatctgaa taatgttaca accaattaac caattctgat 3420

tagaaaaact catcgagcat caaatgaaac tgcaatttat tcatatcagg attatcaata 3480

ccatattttt gaaaaagccg tttctgtaat gaaggagaaa actcaccgag gcagttccat 3540

aggatggcaa gatcctggta tcggtctgcg attccgactc gtccaacatc aatacaacct 3600

attaatttcc cctcgtcaaa aataaggtta tcaagtgaga aatcaccatg agtgacgact 3660

gaatccggtg agaatggcaa aagtttatgc atttctttcc agacttgttc aacaggccag 3720

ccattacgct cgtcatcaaa atcactcgca tcaaccaaac cgttattcat tcgtgattgc 3780

gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac aattacaaac aggaatcgaa 3840

tgcaaccggc gcaggaacac tgccagcgca tcaacaatat tttcacctga atcaggatat 3900

tcttctaata cctggaatgc tgtttttccg gggatcgcag tggtgagtaa ccatgcatca 3960

tcaggagtac ggataaaatg cttgatggtc ggaagaggca taaattccgt cagccagttt 4020

agtctgacca tctcatctgt aacatcattg gcaacgctac ctttgccatg tttcagaaac 4080

aactctggcg catcgggctt cccatacaag cgatagattg tcgcacctga ttgcccgaca 4140

ttatcgcgag cccatttata cccatataaa tcagcatcca tgttggaatt taatcgcggc 4200

ctcgacgttt cccgttgaat atggctcata acaccccttg tattactgtt tatgtaagca 4260

gacagtttta ttgttcatga tgatatattt ttatcttgtg caatgtaaca tcagagattt 4320

tgagacacgg gccagagctg ca 4342

<210> 21

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ggtgatgacg gtgaaaacct ctgac 25

<210> 22

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caatctatcg cttgtatggg aagcccg 27

Claims (10)

1. An expression vector, which is characterized by comprising a copA promoter sequence added with an optimized MCS sequence, wherein the nucleotide sequence of the copA promoter sequence added with the optimized MCS sequence is shown as SEQ ID NO. 1.

2. A host Escherichia coli comprising the expression vector of claim 1, wherein the copA and cueO genes are double-knocked out in the host Escherichia coli.

3. A copper ion-induced recombinant protein expression system, which comprises the host Escherichia coli of claim 1 and the expression vector of claim 2.

4. A method of inducing expression of a recombinant protein by copper ions, the method comprising the steps of:

1) cloning a coding sequence of a protein of interest into the expression vector of claim 1;

2) transforming the obtained expression vector into the host Escherichia coli of claim 2 for overnight growth;

3) adding the strain growing overnight into a culture medium to culture until logarithmic phase;

4) then adding copper-containing ionic liquid into the strain culture medium for induction.

5. The method for inducing recombinant protein expression by copper ions according to claim 4, wherein the culture medium of the strain in step 3) is fresh LB culture medium or 2 XLB culture medium.

6. The method of claim 4, wherein the overnight grown strain of step 3) is added to the culture medium to obtain a starting bacterial night OD₆₀₀The value was 0.02.

7. The method for inducing recombinant protein expression by copper ions according to claim 4, wherein the concentration of the copper-containing ionic liquid in step 4) is 2-2000 μmol/L.

8. The method for inducing expression of recombinant protein by copper ions according to claim 4, wherein the copper-containing ionic liquid in step 4) is copper-containing industrial wastewater.

9. The method for inducing expression of recombinant protein by copper ions according to claim 4, wherein the inducing condition in step 4) is 16 ℃ for 24 h.

10. The method for inducing expression of a recombinant protein by copper ions according to any one of claims 4 to 9, wherein the target protein is Pfu protein or CueO protein.

Images