CN112941051A

CN112941051A - FENM protein mutant and application thereof and kit containing mutant

Info

Publication number: CN112941051A
Application number: CN202110211331.XA
Authority: CN
Inventors: 舒敏
Original assignee: Zhejiang Younuo Biotechnology Co ltd
Current assignee: Zhejiang Younuo Biotechnology Co ltd
Priority date: 2021-04-14
Filing date: 2021-04-14
Publication date: 2021-06-11

Abstract

The invention belongs to the technical field of biological detection, and improves the detection specificity by the specific combination of FENM or a mutant thereof and a target sequence and simultaneously adopts fusion protein constructed by the FENM mutant and different types of proteins with endonuclease activity, such as FokI or Cas12, etc., and after the system specifically recognizes a target sequence under the double guidance of gDNA and crRNA, the system activates the bypass cutting activity of Cas12a, so that any microorganism or DNA can be detected in mixed specimens of escherichia coli, corynebacterium glutamicum, streptomyces coelicolor, bacillus subtilis, combined mycobacteria, influenza virus DNA fragments, COVID19 gene fragments, SARS virus DNA fragments, etc., with high sensitivity and specificity, and an expensive thermocycler is not needed. The kit provided by the invention is used for detecting microorganisms, has high specificity and accuracy, does not need special instruments and special experimental environments, can efficiently and accurately detect the target sequence in a complex environment sample, and has important significance for clinical detection.

Description

FENM protein mutant and application thereof and kit containing mutant

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a FENM protein mutant, application thereof and a kit containing the mutant.

Background

In basic research in biology, gene therapy and analysis of various microorganisms, it is often necessary to "identify" a target gene or microorganism, such as detection of a mutated gene, characterization of a DNA molecule in an environment, and determination of the presence or absence of a microorganism in the environment. The accuracy of enzymes with endonuclease (REases) activity in cleaving target nucleic acids makes them indispensable tools in these experiments. These limited sequences are not sufficient to meet the various requirements of DNA manipulation. To overcome this limitation, scientists have developed several approaches: the first is mutation of the amino acid sequence in existing restriction endonucleases, such as Not I mutation. The second is the construction of a novel IIS enzyme (also known as a non-orthodox enzyme) by combining the target recognition domain and the DNA cleavage domain, as reported by Tst I and Bmr I. The third involves the formation of new nucleases, such as ZFNs, TALENs and CRISPR-Cas, by fusing various motifs specific to different DNA sequences to the cleavage region of the desired restriction endonuclease.

The CRISPR/Cas system (clustered regularly interspaced short palindromic repeats) is a site in the genome containing multiple short repeats, which plays an adaptive immune role in bacterial and archaeal cells. The CRISPR system relies primarily on crRNA and tracrRNA for sequence-specific degradation of foreign DNA, and despite the high efficiency of the CRISPR/Cas system, this tool still has an "off-target effect".

At present, common methods for identifying microorganisms are smear staining microscopy, separation culture, immunological diagnosis, molecular biological diagnosis and the like. The isolation culture method is a common method at present for part of pathogenic microorganisms, but the culture needs 4-8 weeks, and clinical diagnosis and treatment are delayed. The smear staining microscopy method is simple and rapid to operate, but the method has low sensitivity and poor specificity. The immunological diagnosis is caused by the fact that the existing antigen or antibody is crossed with other microorganisms, so that the specificity is poor, and the false positive rate is high. The molecular biological diagnosis has the advantages of rapidness and sensitivity, and various strains can be distinguished by utilizing specific DNA fragments. In recent years, various isothermal amplification techniques such as LAMP and RPA have appeared and are applicable to in-situ detection, but all of them have problems such as lack of effective means for detecting amplified products. Therefore, it is highly desirable to establish a simple, fast and highly sensitive detection technique that can be applied in the field.

In order to meet the above requirements, various detection systems based on CRISPR/Cas systems, such as detection methods based on CRISPR-Cas9, CRISPR-Cas12 and CRISPR-Cas13, have appeared, which all rely on the recognition of crRNA or sgRNA and target sequences. Recent studies show that non-specific recognition phenomenon caused by base mismatch exists in both CRISPR-Cas9 and CRISPR-Cas12 systems, which brings potential risks to subsequent application of the tools.

More importantly, in the face of accurate identification of complex samples, such as qualitative identification of a specific microorganism in a mixed microorganism sample, identification of nucleic acid molecules in different environments, methods with higher accuracy and specificity are more required. Most of the reported methods in the existing literature and patents are directed at the detection and confirmation of a single sample, and the base mismatch phenomenon of the CRISPR/Cas system increases the risk of uncertain results.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to provide a FENM protein mutant which can be used for detecting complex samples such as nucleic acid, microorganisms and the like and enhances the specificity of target sequence recognition, an application thereof, and a target detection kit based on a CRISPR/Cas system.

Specifically, the invention provides a FENM protein mutant, wherein the FENM protein mutant is obtained by mutating isoleucine sites of flanking endonuclease into alanine.

The invention also provides a FENM protein mutant, wherein the FENM protein mutant is obtained by fusing the FENM protein mutant and a protein with endonuclease activity.

Preferably, the femm mutant protein is obtained by mutating isoleucine at position 143 of flanking endonuclease (Flap endonuclease) to alanine.

Preferably, the FENM protein mutant has a nucleotide sequence shown as SEQ ID No. 1.

In a second aspect, the present invention provides an FFC system, which is a fusion protein formed by fusing a femm protein mutant with a protein having endonuclease activity.

Preferably, the endonuclease-active protein is a fokl protein or a Cas12 protein.

Preferably, the fusion protein is a FENM-FokI fusion protein or a FENM-Cas12 fusion protein.

Preferably, the amino acid sequence of the fusion protein is shown as SEQ ID No.2 or SEQ ID No. 3.

Preferably, the FFC system is fusion of FENM protein and protein with endonuclease activity (such as FokI protein or Cas12 protein), and the fusion protein FENM-FokI (FF) or FENM-Cas12(FC) is formed.

In a third aspect, the invention provides a detection kit, wherein the detection kit comprises the FENM protein mutant or the FFC system.

Preferably, the FENM mutant protein is obtained by mutating isoleucine site of flanking endonuclease into alanine.

Preferably, the FENM mutant protein is obtained by mutating isoleucine at position 143 of flanking endonuclease into alanine.

Preferably, the FFC system is a fusion protein formed by fusing the femm protein mutant with a protein having endonuclease activity.

In a specific embodiment, the present invention also provides a CRISPR/Cas system-based targeted detection kit, which mainly comprises: (1) the FENM protein mutant and the protein with endonuclease activity construct the fusion protein; (2) a primer for specifically amplifying a target gene; (4) gRNA and crRNA; (4) fluorescent reporter ssDNA-FQ.

Preferably, the main components and other auxiliary components of the kit, such as PCR reagents for amplification, etc., can be selected by one of ordinary skill in the art based on common knowledge.

Preferably, the kit is a kit for detecting bacteria, viruses or nucleic acids such as influenza virus, tobacco mosaic virus, combined mycobacteria, neocoronavirus E gene and N gene, corynebacterium glutamicum, pseudomonas and environmental DNA.

Preferably, the kit essentially comprises: (1) fusion protein with amino acid sequence shown in SEQ ID No. X; (2) specific amplification primers, gRNA, crRNA and a fluorescent reporter molecule.

In a fourth aspect, the invention provides an application of the FENM protein mutant in preparation of a detection kit for microorganisms.

Preferably, the FENM protein mutant and a protein with endonuclease activity are constructed to obtain a fusion protein, and then the fusion protein is used for preparing the CRISPR/Cas system-based targeted detection kit.

Preferably, the FENM protein mutant is used for detecting bacteria, viruses or nucleic acids such as influenza virus, tobacco mosaic virus, binding mycobacteria, neocoronavirus E gene and N gene, corynebacterium glutamicum, pseudomonas and environmental DNA.

In a fifth aspect, the invention provides an application of the FFC system in preparing a detection kit for microorganisms.

Preferably, the FFC system is used for preparing the CRISPR/Cas system-based targeted detection kit.

Preferably, the FFC system is used for detecting bacteria, viruses or nucleic acids such as influenza virus, tobacco mosaic virus, binding mycobacteria, neocoronavirus E gene and N gene, corynebacterium glutamicum, pseudomonas and environmental DNA.

In a sixth aspect, the invention provides the detection kit for detecting microorganisms.

The detection kit is used for detecting bacteria, viruses or nucleic acids such as influenza virus, tobacco mosaic virus, combined mycobacteria, neocoronavirus E gene and N gene, corynebacterium glutamicum, pseudomonas and environmental DNA.

In a seventh aspect, the present invention provides a method for detecting a microorganism using the detection kit, comprising the steps of: (1) extracting nucleic acid of a sample; (2) performing RT-LAMP amplification; (3) detecting the reaction of the FFC system; (4) and (6) judging the result.

In another embodiment, when the detection kit is used for detecting microorganisms, the method comprises the following steps:

(1) extracting nucleic acid of a sample: taking a sample to be detected, and extracting sample nucleic acid;

(2) RT-LAMP amplification: amplifying the sample nucleic acid to be detected extracted in the step (1) by using a target gene amplification primer through an RT-LAMP method to obtain an amplification product;

RPA reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA upstream amplification primer, 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA downstream amplification primer, 1 multiplied Reaction Buffer, 1 multiplied BasiEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 multiplied Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of genome DNA of a sample to be detected, and the balance of DEPC water for supplementing 12.5 mu L.

And (3) amplification procedure: and reacting for 30-60 min at constant temperature of 37 ℃.

(3) FFC system reaction detection: adding a fluorescent reporter molecule, FF protein or FC protein, gDNA or gRNA and a detection reagent into the reaction tube in the step (2) to perform FFC system reaction;

FFC system reaction: each 20uL of final line contained 1 XBuffer (50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100. mu.g/ml BSA, pH 7.9, 25 ℃), 36nM gRNA or 20nM gDNA, 50nM ssDNA-FQ, 50nM FENM-FokI or FENM-Cas12 a.

(4) And (4) judging a result: placing the reaction solution reacted in the step (3) into a reaction tube, adding sterile water, mixing and placing on a test tube rack, placing the disposable nucleic acid detection test strip into the reaction tube, waiting for the reaction solution to flow through the test strip (Milenia HybriDetect 1, TwistDx), wherein the positive control sample only displays a right detection line, and the negative control sample displays a left detection line.

Preferably, the test strip has hydrophilicity.

Preferably, the test strip is purchased from commercial test strips in the market.

Preferably, the detection steps are all completed under a constant temperature condition, and complex temperature change is not needed, so that the dependence on precision instruments such as a qPCR instrument is eliminated, and the method has a wide application prospect.

The invention improves the detection specificity by the specific combination of FENM or its mutant FENM and the target sequence, and adopts the fusion protein constructed by FENM mutant and different types of proteins with endonuclease activity such as FokI or Cas12, etc., the system can specifically identify the target sequence under the dual guidance of gDNA and crRNA and then activate the bypass cutting activity of Cas12a, and can detect any microorganism or DNA in mixed specimens of escherichia coli, corynebacterium glutamicum, streptomyces coelicolor, bacillus subtilis, combined mycobacteria, influenza virus DNA fragments, COVID19 gene fragments, SARS virus DNA fragments, etc., with high sensitivity and specificity, without expensive thermal cycler. In the FFC system (FF protein), femm binds to the target sequence under the binding of gDNA, the endonuclease fokl cleaves a fluorescent reporter during DNA cleavage; in the FFC system (FC protein), the femm mutant binds to the target sequence under gDNA binding, and the Cas protein initiates "bypass cleavage" activity after recognition of the target sequence under the guidance of grna (guide rna), preceded by crRNA, which is checked against errors. And (3) adding a fluorescent reporter molecule into the system, and realizing the conversion of the sequence information to be detected to a fluorescent signal by using the Cas12a enzyme bypass cleavage activity. By coupling RPA to the FFC system, a two-stage amplification of "sequence amplification" (RPA done) plus "enzymatic cascade" (FFC system done) can be achieved, exceeding the sensitivity of qPCR, a single-stage amplification.

According to the invention, by constructing a fusion protein system FFC (a fusion protein constructed by a nuclease mutant based on a DNA sequence and a protein with endonuclease activity, such as Flap endonuclease, FokI or Cas12 and other different types of proteins with endonuclease activity), a single-stranded DNA with a fluorescent signal label can be cut under the condition that gDNA and crRNA exist simultaneously, and whether a sample to be detected contains target nucleic acid, bacteria or viruses can be known through a lateral flow reagent strip. According to the invention, a 'double insurance' mechanism for identifying the target sequence is formed by designing specific gDNA and crRNA, the fidelity of the detection method is more than 10 times higher than that of a fluorescent quantitative PCR detection method, and the base identification mismatch rate is greatly reduced. The kit provided by the invention is used for detecting microorganisms, has high specificity and accuracy, does not need special instruments and special experimental environments, can efficiently and accurately detect the target sequence in a complex environment sample, and has important significance for clinical detection.

Drawings

In order that the present disclosure may be more readily and clearly understood, the following detailed description of the present disclosure is provided in connection with specific embodiments thereof and the accompanying drawings, in which,

FIG. 1 is a schematic diagram of a process for detecting microorganisms and nucleic acids based on the FFC system;

FIG. 2 shows mutant Flap endonuclease^I143AAffinity of protein to DNA

FIG. 3 SDS-PAGE patterns of the FENM protein and its mutants;

FIG. 4 shows the detection results of COVID19 virus E gene and N gene based on FFC system;

FIG. 5 shows the result of a Mycobacterium tuberculosis assay based on the FFC system;

FIG. 6 shows the results of influenza virus detection based on the FFC system;

FIG. 7 shows the results of detection of specific microorganisms (Corynebacterium glutamicum, Pseudomonas) in environmental samples based on the FFC system;

FIG. 8 shows the results of nucleic acid detection of environmental samples based on the FFC system;

FIG. 9 shows the results of tobacco mosaic virus detection based on the FFC system.

FIG. 10 shows a mutant-based Flap endonuclease^I143AThe detection result of the FFC system of the protein and the FFC system based on the original Flap endonuclease protein on the COVID19 virus E gene.

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: preparation of FENM protein mutant, FENM-FokI fusion protein and FENM-Cas12a fusion protein

The FENM-FokI fusion protein and the mutant thereof, and the FENM-Cas12a fusion protein gene are synthesized from the Pomaceae organism and cloned in pET28a, and then transformed into Escherichia coli BL21(DE3) cells for protein purification.

The detection specificity is improved by the specific combination of FENM or its mutant FENM and a target sequence, and the fusion protein constructed by FENM mutant and different types of proteins with endonuclease activity such as FokI or Cas12, the system specifically recognizes the target sequence under the dual guidance of gDNA and crRNA and then activates the alternative cleavage activity of Cas12a, so that any microorganism or DNA can be detected in mixed samples such as escherichia coli, corynebacterium glutamicum, streptomyces coelicolor, bacillus subtilis, combined mycobacteria, influenza virus DNA fragments, COVID19 gene fragments, SARS virus DNA fragments and the like in a high-sensitivity and specific manner, and an expensive thermal cycler is not needed. In the FFC system (FF protein), femm binds to the target sequence under the binding of gDNA, the endonuclease fokl cleaves a fluorescent reporter during DNA cleavage; in the FFC system (FC protein), the femm mutant binds to the target sequence under gDNA binding, and the Cas protein initiates "bypass cleavage" activity upon recognition of the target sequence under the direction of grna (guide rna). And (3) adding a fluorescent reporter molecule into the system, and realizing the conversion of the sequence information to be detected to a fluorescent signal by using the Cas12a enzyme bypass cleavage activity. By coupling RPA to the FFC system, a two-stage amplification of "sequence amplification" (RPA complete) plus "enzymatic cascade" (FFC system complete) can be achieved, exceeding the sensitivity of qPCR, a single-stage amplification (as shown in figure 1).

The protein purification process was as follows:

selecting Escherichia coli BL21(DE3)/pET28a-FENM-FokI, Escherichia coli BL21(DE3)/pET28a-FENM^I143A-FokI or BL21(DE3)/pET28a-FENM-Cas12a single colonies into 3ml Kan + LB liquid vials, cultured overnight at 37 ℃. Transferred to 100ml LB liquid medium, cultured at 37 ℃ to OD600 of about 0.4, and induced to express at 30 ℃. The induction time was 5h for 0.4mM IPTG, respectively. After induction, the cells were collected, suspended in 50mM Tris-HCl buffer pH7.5, and disrupted by using JY 92-II ultrasonic cell disrupter. Probe phi 6, working 3s, stopping 5s, ultrasonic 50 times, power<400W. Centrifuging at 13,000rpm for 10min, and collecting the supernatant. After filtration through a 0.20 μm-diameter filter head, the objective protein was purified by His-Bind protein purification kit (Novagen, Madison, Wis.).

Required reagents:

8xCharge buffer：400mM NiSO4

8xBinding buffer: 4M NaCl, 160mM Tris-HCl; 40mM imidazole, pH 7.9

8xWash buffer: 4M NaCl, 160mM Tris-HCl; 480mM imidazole, pH 7.9

4xElute buffer: 1M imidazole, 2M NaCl, 80mM Tris-HCl, pH 7.9

4xStrip buffer：2M NaCl，400mM EDTA，80mM Tris-HCl，pH 7.9

And (3) purification process: (volume of resin is 800. mu.l, 1V)

TABLE 1 Ni column protein purification procedure

SDS-PAGE of the eluted proteins confirmed that the proteins were purified, and the SDS-PAGE results of ultrafiltration concentration (3000g) were shown in FIG. 3, in which the SDS-PAGE results of whole cell disruption at different temperatures and under different induction conditions are shown in FIG. 3, and the SDS-PAGE results of the purified proteins are shown in FIG. 3. When the concentration was about 200. mu.l, 50mM Tris-HCl Buffer pH7.55-10 ml was added to replace the Buffer. Ultrafiltration to the desired volume and transfer of the liquid in the tube to a 1.5ml Eppendorf tube and storage at-20 ℃ or-70 ℃.

The FENM mutant protein is obtained by mutating isoleucine at position 143 of Flap endonuclease into alanine, and the site specificity is enhanced by 10 times after mutation. Mutant Flap endonuclease^I143ACompared with the original protein Flap endonuclease, the affinity of the protein and the specific DNA is improved by 10-15 times (figure 2, the left is the result of the isothermal titration calorimetry of the original protein and the specific DNA, and the right is the result of the isothermal titration calorimetry of the mutant protein).

And constructing the FENM protein mutant and a protein with endonuclease activity to obtain a fusion protein, and then using the fusion protein to prepare a CRISPR/Cas system-based targeted detection kit. The FENM protein is fused with a protein with endonuclease activity (such as FokI protein or Cas12 protein), and the formed fusion protein FENM-FokI (FF) or FENM-Cas12(FC) greatly enhances the specificity of target sequence recognition, increases the reliability of results and reduces the occurrence of false positives. The amino acid sequence of the fusion protein is shown as SEQ ID No.2 or SEQ ID No. 3.

The FFC system refers to the fusion protein FENM-FokI (FF) or FENM-Cas12 (FC).

The gene synthesis method comprises the following steps: the chemical synthesis method of DNA comprises the following steps:

1. deprotection Using trichloroacetic acid the protecting group DMT (dimethoxytrityl) of the nucleotide previously attached to CPG was deprotected to obtain the free 5' -hydroxy terminus for further synthesis.

2. Activation the protonated nucleoside 3' -phosphoramidite monomer was mixed with a tetrazole activator into a synthesis column to form the phosphoramidite tetrazole reactive intermediate (with the 5' end still protected by DMT and the 3' end activated).

3. The intermediate obtained by activation in the step 2 is connected to encounter the nucleotide of which the protecting group is removed in one step, and the nucleotide undergoes nucleophilic reaction with the 5' -hydroxyl of the nucleotide, is condensed and is removed with tetrazole, and the synthesized oligosaccharide nucleotide chain is extended forward by one base.

4. During the oxidative condensation reaction, the nucleotide monomer is connected with the oligosaccharide nucleoside connected on the CPG through a phosphite ester bond, the phosphite ester bond is unstable and is easy to be hydrolyzed by acid and alkali, and then the phosphite amide is converted into the phosphate triester by using a tetrahydrofuran solution of iodine, so that the stable oligosaccharide nucleotide is obtained. After the above steps, a deoxynucleotide is ligated to the nucleotide of CPG, and a DNA fragment sample is obtained by the same steps. Finally, cleavage and deprotection are carried out (generally, A, C bases are protected by benzoyl; G bases are protected by isobutyryl; T bases are not necessarily protected; and phosphorous acid is protected by nitrile ethyl). Specifically, the 5' -OH protecting agent DMT is removed by thiophenol, and the DNA fragment is separated from the solid phase resin by concentrated ammonium hydroxide, so that the DNA is eluted. Removing the protecting agent on the basic group with concentrated ammonium hydroxide under heating, removing ammonium hydroxide, and vacuum drying.

Example 2: FFC system for detecting COVID19 virus E gene and N gene

The kit comprises the following components:

(1) the protein amino acid sequence refers to SEQ ID No.1, SEQ ID No.2 and SEQ ID No. 3;

(2) specific amplification primers:

an upstream primer:

N-RPA-F TGCAATCGTGCTACAACTTCCTCAAGGAACAACAT

E-RPA-F CGGAAGAGACAGGTACGTTAATAGTTAATAGC

a downstream primer:

N-RPA-R CAAGCAGCAGCAAAGCAAGAGCAGCATCAC

E-RPA-R AGACCAGAAGATCAGGAACTCTAGAAGAAT

(3) gDNA and gRNA, the sequences are as follows:

N-gene gRNA#1

UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC

N-gene gRNA#2

UAAUUUCUACUAAGUGUAGAUGCAAUGUUGUUCCUUGAGGA

E-gene gRNA#1

UAAUUUCUACUAAGUGUAGAUUUGCUUUCGUGGUAUUCUUG

E-gene gRNA#2

UAAUUUCUACUAAGUGUAGAUGUGGUAUUCUUGCUAGUUAC

N-gene gDNA

TAATTTCTACTAAGTGTAGATCCCCCAGCGCTTCAGCGTTC

E-gene gDNA

TAATTTCTACTAAGTGTAGATTTGCTTTCGTGGTATTCTTG

crRNA, sequence as follows:

N-crRNA1 TTTCTTGAACTGTTGCGACTACGTGAT

N-crRNA2 TTTGCTGCTGCTTGACAGATTGAACCA

E-crRNA1 TTTTCTTGCTTTCGTGGTATTCTTGCT

E-crRNA2 TTTCGTGGTATTCTTGCTAGTTACACT

(4) the fluorescent reporter ssDNA-FQ has the following sequence:

/56-FAM/TTATTATT/3BHQ_1/

(5) the detection method comprises the following steps:

amplifying and extracting the obtained nucleic acid of the sample to be detected by an RT-LAMP method amplification step to obtain an amplification product;

RT-LAMP reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RT-LAMP upstream amplification primers, 0.125-0.625 mu L (with the concentration of 10 mu M) of RT-LAMP downstream amplification primers, 1 × Reaction Buffer, 1 × BasiciEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 × Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of sample DNA to be detected, and the balance of DEPC water for supplementing 12.5 mu L. And (3) amplification procedure: and reacting for 30-60 min at constant temperature of 37 ℃.

(6) FFC system reaction detection: adding a fluorescent reporter molecule, FF protein or FC protein, gDNA or gRNA and a detection reagent into the reaction tube in the step (5) to perform FFC system reaction;

FFC system reaction: each 20uL of final system contained 1 XBuffer (50mM NaCl, 10mM Tris-HCl, 10mM MgCl)₂100 μ g/ml BSA, pH 7.9, 25 ℃), 36nM gRNA or 20nM gDNA, 50nM ssDNA-FQ, 50nM FENM-FokI or FENM-Cas12 a.

(7) And (4) judging a result: placing the reaction solution reacted in the step (6) into a reaction tube, adding sterile water, mixing and placing on a test tube rack, placing the disposable nucleic acid detection test strip into the reaction tube, waiting for the reaction solution to flow through the test strip (Milenia HybriDetect 1, TwistDx), wherein the positive control sample only displays the right detection line, and the negative control sample displays the left detection line.

The detection results of the COVID19 virus E gene and the N gene based on the FFC system are shown in FIG. 4, and FIG. 4A, B, C, D is the detection results of the COVID19 virus E gene and the N gene of different samples respectively.

Example 3: detection of Mycobacterium tuberculosis by FFC system

(1) The amino acid sequence is shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3

(2) Specific amplification primers:

an upstream primer: CCAAGCTGCGCCAGGGCAGCTATTTCCCGGAC

A downstream primer: CGAAACGCCTCTACGGCTTCGTCGAGCTC

(3) gDNA, sequence as follows:

TAATTTCTACTAAGTGTAGATGTCAACCCAGCACCTGCCAG

crRNA, sequence as follows: TTTACAAGACTCACGTTAACAATATTG

(4) The fluorescent reporter ssDNA-FQ has the following sequence:

5’-FAM-TTTTT-BHQ1-3’

(5) the detection method comprises the following steps:

and amplifying and extracting the DNA of the sample to be detected by an RT-LAMP method. RT-LAMP reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA upstream amplification primer, 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA downstream amplification primer, 1 multiplied Reaction Buffer, 1 multiplied BasiEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 multiplied Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of sample DNA to be detected, and the balance of DEPC water for supplementing 12.5 mu L.

(5) FFC system reaction detection: adding a fluorescent reporter molecule, FF protein or FC protein, gDNA or gRNA and a detection reagent into the reaction tube in the step (4) to perform FFC system reaction;

(6) And (4) judging a result: placing the reaction solution reacted in the step (5) into a reaction tube, adding sterile water, mixing and placing on a test tube rack, placing the disposable nucleic acid detection test strip into the reaction tube, waiting for the reaction solution to flow through the test strip (Milenia HybriDetect 1, TwistDx), wherein the positive control sample only displays a right detection line, and the negative control sample displays a left detection line.

The results of the FFC system-based detection of Mycobacterium tuberculosis are shown in FIG. 5, and FIG. 5 shows the results of the detection of the 16S rDNA gene of Mycobacterium tuberculosis.

Example 4: detection of influenza virus by FFC System

(2) Specific amplification primers:

an upstream primer 1: GGCTAYCATGCBAACAATTC

A downstream primer 1: TGGGTTGCCMAGGATCCA

An upstream primer 2: GAAATGGGAAAAGCTCAATAATGA

A downstream primer 2: ATTTCTCATYCCTGTTGCCAA

(3) gDNA, sequence as follows:

AGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTTG

crRNA, sequence as follows: TTTACAAGACTCACGTTAACAATATTG

The fluorescent reporter ssDNA-FQ has the following sequence: /56-FAM/TTATTATT/3 BHQ-1-

(4) The detection method comprises the following steps:

and amplifying and extracting the DNA of the sample to be detected by an RT-LAMP method. RT-LAMP reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA upstream amplification primer, 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA downstream amplification primer, 1 multiplied Reaction Buffer, 1 multiplied BasiEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 multiplied Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of sample DNA to be detected, and the balance of DEPC water for supplementing 12.5 mu L. And (3) amplification procedure: and reacting for 30-60 min at constant temperature of 37 ℃.

(6) And (4) judging a result: placing the reaction solution reacted in the step (3) into a reaction tube, adding sterile water, mixing and placing on a test tube rack, placing the disposable nucleic acid detection test strip into the reaction tube, waiting for the reaction solution to flow through the test strip (Milenia HybriDetect 1, TwistDx), wherein the positive control sample only displays a right detection line, and the negative control sample displays a left detection line.

The results of influenza virus assays based on the FFC system are shown in fig. 6, and fig. 6 is a side flow reagent strip assay for influenza virus.

Example 5: FFC System for detecting specific microorganisms (Corynebacterium glutamicum, Pseudomonas) in environmental samples

(1) Kit composition reference example 3:

the amino acid sequence is shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3

(2) Specific amplification primers:

corynebacterium glutamicum 16S rDNA gene upstream primer: 5-AGAGTTTGATCCTGGCTCAG-3

Corynebacterium glutamicum 16S rDNA gene downstream primer: 5' -GGTTACCTTGTTACGACTT-3

Pseudomonas 16S rDNA gene upstream primer: 5-AGAGTTTGATCCTGGCTCAG-3

Pseudomonas 16S rDNA gene downstream primer: 5' -GGTTACCTTGTTACGACTT-3

(3) The gDNA sequence is as follows:

AGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTTG

the crRNA sequence is as follows: TTTACAAGACTCACGTTAACAATATTG

The fluorescent reporter ssDNA-FQ has the following sequence:

/56-FAM/TTATTATT/3BHQ-1/

(4) the detection method comprises the following steps:

amplifying the DNA of the sample to be detected extracted in the step (1) by using an RT-LAMP method to obtain an amplification product;

RT-LAMP reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA upstream amplification primer, 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA downstream amplification primer, 1 multiplied Reaction Buffer, 1 multiplied BasiEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 multiplied Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of sample DNA to be detected, and the balance of DEPC water for supplementing 12.5 mu L. And (3) amplification procedure: and reacting for 30-60 min at constant temperature of 37 ℃.

(6) And (4) judging a result: and (3) putting the reaction solution reacted in the step (5) into a reaction tube, adding sterile water, mixing and placing on a test tube rack, putting the disposable nucleic acid detection test strip into the reaction tube, waiting for the reaction solution to flow through the test strip (twist Dx company), wherein the positive control sample only displays a right detection line, and the negative control sample displays a left detection line.

The detection results of specific microorganisms (corynebacterium glutamicum and pseudomonas) in environmental samples based on the FFC system are shown in FIG. 7, the detection results of lateral flow reagent strips for the 16S rDNA gene of corynebacterium glutamicum are shown in FIG. 7, and the detection results of lateral flow reagent strips for the 16S rDNA gene of pseudomonas are shown in the lower part.

Example 6: FFC system for detecting specific DNA in environmental sample, taking new coronavirus E gene and N gene as examples

Kit composition reference example 3:

(2) An upstream primer:

N-RPA-F TGCAATCGTGCTACAACTTCCTCAAGGAACAACAT

E-RPA-F CGGAAGAGACAGGTACGTTAATAGTTAATAGC

a downstream primer:

N-RPA-R CAAGCAGCAGCAAAGCAAGAGCAGCATCAC

E-RPA-R AGACCAGAAGATCAGGAACTCTAGAAGAAT

(3) gDNA, sequence as follows:

N-gene gRNA#1

UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC

N-gene gRNA#2

UAAUUUCUACUAAGUGUAGAUGCAAUGUUGUUCCUUGAGGA

E-gene gRNA#1

UAAUUUCUACUAAGUGUAGAUUUGCUUUCGUGGUAUUCUUG

E-gene gRNA#2

UAAUUUCUACUAAGUGUAGAUGUGGUAUUCUUGCUAGUUAC

crRNA, sequence as follows:

N-crRNA1 TTTCTTGAACTGTTGCGACTACGTGAT

N-crRNA2 TTTGCTGCTGCTTGACAGATTGAACCA

E-crRNA1 TTTTCTTGCTTTCGTGGTATTCTTGCT

E-crRNA2 TTTCGTGGTATTCTTGCTAGTTACACT

(4) the fluorescent reporter ssDNA-FQ has the following sequence:

/56-FAM/TTATTATT/3BHQ_1/

(5) the detection method comprises the following steps:

amplifying a sample containing the E gene or the N gene by an RT-LAMP method to obtain an amplification product; RT-LAMP reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA upstream amplification primer, 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA downstream amplification primer, 1 multiplied Reaction Buffer, 1 multiplied BasiEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 multiplied Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of sample DNA to be detected, and the balance of DEPC water for supplementing 12.5 mu L. And (3) amplification procedure: and reacting for 30-60 min at constant temperature of 37 ℃.

FFC systemReaction: each 20uL of final system contained 1 XBuffer (50mM NaCl, 10mM Tris-HCl, 10mM MgCl)₂100 μ g/ml BSA, pH 7.9, 25 ℃), 36nM gRNA or 20nM gDNA, 50nM ssDNA-FQ, 50nM FENM-FokI or FENM-Cas12 a.

The results of the nucleic acid detection of the environmental sample based on the FFC system are shown in FIG. 8, the results of the lateral flow reagent strip for the 16S rDNA gene of Corynebacterium glutamicum are shown in FIG. 8, and the results of the lateral flow reagent strip for the 16S rDNA gene of Pseudomonas are shown in FIG. 8.

Example 7: detection of tobacco mosaic virus by FFC system

Kit composition reference example 3:

(2) An upstream primer:

5'-TCTACCGTGTGGGTGACA-3’

a downstream primer:

5'-GGTCTAATACTGCGTTGTACC-3

(3) gDNA, sequence as follows:

gRNA#1

UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC

gRNA#2

UAAUUUCUACUAAGUGUAGAUGCAAUGUUGUUCCUUGAGGA

crRNA, sequence as follows:

N-crRNA1 TTTCTTGAACTGTTGCGACTACGTGAT

E-crRNA1 TTTTCTTGCTTTCGTGGTATTCTTGCT

(4) the fluorescent reporter ssDNA-FQ has the following sequence:

/56-FAM/TTATTATT/3BHQ_1/

(5) the detection method comprises the following steps:

extracting a tobacco mosaic virus nucleic acid sample, and obtaining an amplification product by amplification through an RT-LAMP method; RT-LAMP reaction system: the total volume was 12.5 μ L: the kit comprises 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA upstream amplification primer, 0.125-0.625 mu L (with the concentration of 10 mu M) of RPA downstream amplification primer, 1 multiplied Reaction Buffer, 1 multiplied BasiEmix, 1.2-2.4 mM dNTP, 0.625 mu L of 20 multiplied Core Reaction Mix, 14-28 mM MgOAc, 1 mu L of sample DNA to be detected, and the balance of DEPC water for supplementing 12.5 mu L. And (3) amplification procedure: and reacting for 30-60 min at constant temperature of 37 ℃.

(6) FFC system reaction detection: adding a fluorescent reporter molecule, FF protein or FC protein, gDNA or gRNA and a detection reagent into the reaction tube in the step (12) to perform FFC system reaction;

(7) And (4) judging a result: placing the reaction solution reacted in the step (13) into a reaction tube, adding sterile water, mixing and placing on a test tube rack, placing the disposable nucleic acid detection test strip into the reaction tube, waiting for the reaction solution to flow through the test strip (Milenia HybriDetect 1, TwistDx), wherein the positive control sample only displays the right detection line, and the negative control sample displays the left detection line.

The results of tobacco mosaic virus detection based on the FFC system are shown in fig. 9, and fig. 9 is the results of the lateral flow reagent strip detection for tobacco mosaic virus.

Example 10: mutant-based Flap endonuclease^I143ADetection of COVID19 virus E gene by FFC system of protein and FFC system based on original Flap endonuclease protein

Kit composition reference example 3:

(1) the amino acid sequence is referred to SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3,

the sequence of the virus E gene of COVID19 is shown as follows,

10 sequences in which bases at positions 52, 74, 94, 103, 113, 121, 136, 143, 169 and 193 of the E gene were mutated were synthesized, respectively (the mutation positions are shown in bold). For testing mutant-based Flap endonuclease^I143AThe FFC system of the protein is specific to the FFC system based on the original Flap endonuclease protein.

(2) An upstream primer:

E-RPA-F CGGAAGAGACAGGTACGTTAATAGTTAATAGC

a downstream primer:

E-RPA-R AGACCAGAAGATCAGGAACTCTAGAAGAAT

(3) gDNA, sequence as follows:

E-gene gRNA#1 AGCAAGAAUACCACGAAAGCAAGAAAA

E-gene gRNA#2 AGUGUAACUAGCAAGAAUACCACGAAA

E-gene gRNA#3 AAAAAGAAGUACGCUAUUAA

E-gene gRNA#4 AUCGAAGCGCAGUAAGGAUGGCU

E-gene gRNA#5 CGAGUAGACGUAAACC

E-gene gRNA#6 UCAGAUUUUUAACACG

crRNA, sequence as follows:

E-crRNA1 TTTTCTTGCTTTCGTGGTATTCTTGCT(58-84)

E-crRNA2 TTTCGTGGTATTCTTGCTAGTTACACT(66-92)

E-crRNA3 ttaatagcgtacttcttttt(41-60)

E-crRNA4 agccatccttactgcgcttcgat(93-115)

E-crRNA5 ggtttacgtctactcg(164-180)

E-crRNA6 cgtgttaaaaatctga(181-196)

(4) the fluorescent reporter ssDNA-FQ has the following sequence:

/56-FAM/TTATTATT/3BHQ_1/

(5) the detection method comprises the following steps:

Utilizing mutant-based Flap endonuclease^I143AThe FFC system of the protein and the FFC system based on the original Flap endonuclease protein detect 11 nucleic acid samples including the COVID19 virus E gene and the point mutation thereof, and the detection results are shown in FIG. 10. The result shows that the mutant Flap endonuclease is based on when the E gene is detected^I143AThe results of the FFC system of the protein and the FFC system based on the original Flap endonuclease protein are positive; however, the detection results of point mutation of 10E genes show that based on the mutant Flap endonuclease^I143AThe FFC system detection results of the proteins are negative (all negative results should be shown because of the existence of non-complementary bases), 9 samples in the FFC system detection results based on the original Flap endinecrase protein are negative, and 1 sample is positive. The above results show that the mutant-based Flap endonuclease^I143AThe FFC system of the protein can effectively distinguish sequence differences on a single base, has higher sequence recognition specificity, and can effectively distinguish different sequences with high similarity. The above features are for highly similar sequencesThe identification of (2) is of special significance. Such as rapid evolution towards different viruses, different virus strains can be distinguished by primer design. In the aspect of microbial molecule identification based on 16S rDNA, 16S rDNA of partial microorganisms is highly similar, and only individual base differences exist, and the mutation based on Flap endonuclease^I143AThe FFC system of the protein can effectively distinguish the difference, and then different strains of the microorganism can be accurately identified.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.

Claims

1. A FENM protein mutant, wherein the FENM mutant protein (1) is obtained by fusing a FENM protein mutant with a protein having endonuclease activity;

or (2) obtained by mutating isoleucine sites of flanking endonucleases to alanine.

2. The femm protein mutant according to claim 1, wherein the femm mutant protein is obtained by mutation of isoleucine at position 143 of the flanking endonuclease to alanine.

3. A FENM protein mutant according to claim 1, wherein the FENM protein mutant has a nucleotide sequence as shown in SEQ ID No. 1.

4. An FFC system, wherein the FFC system is a fusion protein formed by fusing the FENM protein mutant of any one of claims 1 to 3 with a protein having endonuclease activity.

5. The FFC system of claim 4 wherein the endonuclease active protein is a FokI protein or a Cas12 protein.

6. A test kit comprising the femm protein mutant according to any one of claims 1 to 3 or the FFC system according to claim 3.

7. Use of a femm protein mutant according to any one of claims 1 to 3 for the preparation of a detection kit for a microorganism.

8. Use of the FFC system of claim 4 or 5 in the preparation of a detection kit for a microorganism.

9. The test kit according to claim 6 for detecting microorganisms.

10. The method for detecting microorganisms using the detection kit according to claim 6, comprising the steps of:

(1) extracting nucleic acid of a sample;

(2) performing RT-LAMP amplification;

(3) detecting the reaction of the FFC system;

(4) and (6) judging the result.