CN112940098A

CN112940098A - MG53 mutant and preparation method and application thereof

Info

Publication number: CN112940098A
Application number: CN202110181974.4A
Authority: CN
Inventors: 慎东
Original assignee: Mudanjiang Youbo Pharmaceutical Co Ltd
Current assignee: Mudanjiang Youbo Pharmaceutical Co Ltd
Priority date: 2016-04-06
Filing date: 2016-04-06
Publication date: 2021-06-11
Also published as: CN107266551A; CN107266551B

Abstract

The invention provides a mutant of MG53 and a preparation method thereof. This mutant is a serine site mutant of the MG53 protein in the bred-coil domain, resulting in inactivation of MG53 phosphorylation. Meanwhile, the MG53 protein mutant can be used for preventing or treating diseases related to cell membrane damage, such as diseases related to myocardial cell damage, diseases related to ulcer, trauma with wounds, particularly wounds which are difficult to heal, intestinal leakage, kidney injury and the like. The disease associated with myocardial cell injury may include one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture. Ulcer-related diseases include one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer. In addition, the application also provides dry powder formulations, spray formulations, gel formulations and emulsions comprising MG53 or a mutant thereof, and methods of making the same.

Description

MG53 mutant and preparation method and application thereof

The application is a divisional application of 'an MG53 mutant and a preparation method and application thereof' in a Chinese patent application with the application date of 2016, 04, 6 and the application number of 201610210731.8.

Technical Field

The invention relates to an MG53 mutant (also called MG53 protein mutant) and application of the MG53 mutant in preventing or treating diseases related to cell membrane damage, such as diseases related to myocardial cell damage, diseases related to ulcer, trauma with wounds, particularly wounds which are difficult to heal, intestinal leakage, kidney injury and the like. The disease associated with myocardial cell injury may include one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture. And the ulcer-related disease comprises one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer. The MG53 mutant can protect heart, treat heart disease caused by cell death, and avoid side effects of insulin resistance, obesity, diabetes and metabolic syndrome caused by MG53 with heart protecting effect, and the MG53 mutant is especially effective in treating ulcer, especially chronic ulcer and peptic ulcer, such as diabetic foot ulcer, diabetic foot gangrene and chronic gastric ulcer.

Background

MG53 is a skeletal muscle specific protein mitsugumin53, abbreviated as MG53 or TRIM 72. MG53 is a muscle-specific triprotitemotiffamine (trim) family protein. The family of proteins often contains three specific motif structures, called RING, B-BOX and Coiled coil domains (woven coil domains). They act together to bind to proteins that are no longer needed by the cell, and these proteins are tagged with ubiquitin for degradation. MG53 is also an important component of a cell membrane repair mechanism.

In medical applications, the efficacy of MG53 in treating heart diseases caused by apoptosis has been accepted and is well known in the leading areas of the industry. The MG53 can protect the heart, namely the heart can be protected by increasing the content of MG 53. However, MG53 has the negative effect of being non-negligible and regarded as a major hazard, and an increase in MG53 content while protecting the heart can cause insulin resistance, obesity, diabetes and metabolic syndrome. That is, MG53 protects the heart and is associated with side effects such as insulin resistance, obesity, and diabetes. This is a concern in the industry and is not expected to be a problem of coexistence of positive and negative effects, and no channel has been solved so far.

Summary of The Invention

The invention provides a mutant of MG53, which is a serine site mutant of MG53 protein in a bred-coil domain. This mutant MG53 protein resulted in inactivation of phosphorylation of MG 53. The MG53 protein mutant can be used for preventing or treating diseases related to cell membrane injury, such as diseases related to myocardial cell injury, diseases related to ulcer, trauma with wound, especially wound with difficult healing, intestinal leakage, kidney injury, etc. The disease associated with myocardial cell injury may include one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture. Ulcer-related diseases include one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.

In particular, the MG53 protein mutant is found to protect the heart and simultaneously avoid the side effects of insulin resistance, obesity, diabetes, metabolic syndrome and the like brought by MG53 with the same heart protection effect. This MG53 mutant is particularly effective in the treatment of ulcers, such as chronic ulcers, peptic ulcers, diabetic foot gangrene, chronic gastric ulcers.

The MG53 can protect the heart, namely the heart can be protected by increasing the content of MG 53. However, it was later found that an increase in MG53 content, while protecting the heart, causes insulin resistance, obesity, diabetes and metabolic syndrome. That is, MG53 protects the heart and is associated with side effects such as insulin resistance, obesity, diabetes and metabolic syndrome. In order to promote the MG53 protein to further degrade and maintain the heart, the application carries out a great deal of scientific research work, and the main purpose is to further mutate the MG53 protein, hopefully, the mutant can keep the heart protection function without causing side effects such as insulin resistance, obesity, diabetes, metabolic syndrome and the like, but the mutant is not accompanied with corresponding side effects.

The present invention provides a mutant of MG53, wherein a serine in the Coiled-coil domain of MG53 protein is mutated to an amino acid other than threonine and tyrosine. In one embodiment, the serine in the coded-coil domain is mutated to a non-polar amino acid.

In most insulin target organs, one has basically recognized the general skeletal structure of the insulin signaling network, i.e., the IR/IRSs-PI3K-Akt pathway; however, research is currently underway for specific molecular mechanisms that affect this signaling pathway. MG53 was able to efficiently ubiquitinate Insulin Receptor (IR) and insulin receptor substrate 1(IRs1), wherein the RING domain of MG53, particularly the cysteine at the fourteenth position in the amino acid sequence, was essential for MG53 to catalyze ubiquitination of IR and IRs1 (CN 103965342A). The effects of the existing medicines for treating ulcer, especially chronic skin ulcer are not ideal. Although in some literature, for example CN103275980A and CN101511181B, it is suggested that compositions comprising MG53 may be used for the treatment of ulcers. However, experimental studies on the treatment of ulcers with MG53 have not been performed in the prior art.

The woven-coil structural domain of MG53 protein is a relatively well-studied structural domain mediating protein-protein interaction at present, presents unique repeating units on the sequence, is very wide in distribution, and participates in many important life processes such as membrane fusion, membrane vesicle transport and the like. Functionally the coiled coil domain provides sufficient space for the head and tail structure of the protein during the process of membrane vesicle transport. In addition, the Coiled coil domain can also serve as a backbone to recruit proteins to form a complex. The MAP kinase module for regulating cell proliferation, differentiation and apoptosis signal and constituting the signal path.

The applicant believes that the conjugated coil domain plays an important role in the involvement of the MG53 protein in vesicle trafficking and signal pathway transduction. Therefore, applicants selected the Coiled coil domain of MG53 protein as the subject. The serine sites in the MG53 conjugated coil domain are the three S150, S189 and S211 sites in MG 53.

Moreover, applicants have found that in the regulation of insulin signaling, the most important is the modification of phosphorylation, which occurs predominantly at two amino acids, one serine (including threonine) and the other tyrosine. These two types of acid-phosphorylated enzymes have different functions, and serine has a hydroxyl group at the terminal of the structure and can be bonded to a phosphate group. The process of phosphorylation is the transfer of phosphate groups. Considering that the MG53 Coiled coil domain is well conserved, applicants extensively conceived that the serine site in the MG53 Coiled coil domain is most likely involved in insulin metabolism and/or lipid metabolism in vivo, and therefore the inventors constructed a serine site mutant in the MG53 Coiled coil domain.

The present application demonstrates that mutation of serine sites in the linked coil domain to amino acids other than threonine and tyrosine can achieve the intended objects and benefits of the present invention.

In one embodiment, the MG53 protein mutant provided by the invention leads to the inactivation of MG53 phosphorylation, and the side effects of insulin resistance, obesity, diabetes, metabolic syndrome and the like caused by MG53 with the same heart protection effect are avoided while protecting the heart. And the MG53 mutant can be used for treating ulcer, such as chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.

In one embodiment, in the MG53 mutant, the nonpolar amino acid is alanine, glycine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, or methionine. Preferably, the non-polar amino acids are alanine, glycine, leucine, proline, valine, and isoleucine. Most preferably, the non-polar amino acid is alanine.

In one embodiment, when the nonpolar amino acid in the MG53 mutant is alanine, the MG53 mutant is selected from any one or more of MG53S150A, MG53S189A, and MG53S 211A.

In one embodiment, the genus species of sequence of the MG53 mutant includes primates, rats, and mice.

In one embodiment, the present application provides a method of making a MG53 mutant, comprising the steps of:

(1) mutating wild MG53 to obtain MG53 mutant, and cloning into plasmid;

(2) expressing the MG53 mutant plasmid in a cell;

(3) the MG53 mutant protein produced is purified using chromatography, such as DEAE column chromatography and CM column chromatography, optionally Source 30Q column chromatography.

In a preferred embodiment, the MG53 mutant plasmid is obtained by site-directed mutagenesis of the full-length sequence of the wild-type MG53 plasmid using a site-directed mutagenesis kit. More preferably, the wild-type MG53 plasmid is codon optimized.

In a preferred embodiment, in the method of preparing the MG53 mutant, in DEAE column chromatography, binding solution a is 20mM Tris, pH8.0, eluent B is 20mM Tris and 1.0M NaCl, pH8.0, optionally eluted with a solution of eluent B at 5% (by volume) in a mixture of a and B and/or eluent B.

In a preferred embodiment, in the method of preparing the MG53 mutant, in CM column chromatography, binding solution a is 20mM PB, pH6.0, eluent B is 20mM PB and 1.0M NaCl, pH6.0, optionally eluted with a solution of eluent B at 10% in the mixture of a and B and/or a gradient of eluent B between 10% and 30% (by volume) in the mixture of a and B and/or eluent B.

In a preferred embodiment, in the method of making the MG53 mutant, in Source 30Q column chromatography, binding solution a is 20mM Tris, pH 8.5, eluent B is 20mM Tris and 1.0M NaCl, pH 8.5, optionally eluted with eluent B.

In one aspect, the present application provides a pharmaceutical composition comprising a MG53 mutant. Preferably, the pharmaceutical composition comprises a pharmaceutically acceptable excipient or carrier.

In another aspect, the MG53 mutants provided herein can be used for the preparation of pharmaceutical compositions for the prevention and/or treatment of diseases associated with cell membrane damage.

In one embodiment, the disease associated with cell membrane damage comprises one or more selected from the group consisting of: diseases associated with myocardial cell injury, diseases associated with ulcers, trauma with wounds, particularly refractory wounds, intestinal leaks, and kidney injury.

In a preferred embodiment, the disease associated with myocardial cell injury comprises one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture.

In a preferred embodiment, the ulcer-related disease comprises one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.

In one aspect, the present application provides dry powder formulations comprising MG53 or the MG53 mutants of the present application and methods of making the same. In one embodiment, the method of making a dry powder formulation comprising MG53 or the MG53 mutant of the present application comprises the steps of:

(1) dissolving adjuvants, mixing with MG53 or MG53 mutant solution of the present application, and adjusting pH to 6.5-8.0 to obtain protein solution containing 0.1-2.0 MG/ml;

(2) dry powder formulations were obtained by filter sterilization and freeze-drying the solution containing 0.5-2MG/ml MG53 or MG53 mutant of the present application under suitable freeze-drying conditions.

In one embodiment, the excipient comprises one or more selected from the group consisting of: polyols, saccharides, surfactants and polymers.

In a preferred embodiment, the polyol comprises one or more selected from the group consisting of: glycerol, mannitol, sorbitol, inositol and polyethylene glycol.

In a preferred embodiment, the saccharide comprises one or more selected from the group consisting of: sucrose, glucose, lactose, trehalose, mannose and maltose.

In a preferred embodiment, the surfactant comprises one or more selected from the group consisting of: tween80, sodium dodecyl sulfate.

In a preferred embodiment, the polymer comprises one or more selected from the group consisting of: polyethylene glycol, polyvinyl pyrrolidone.

In a preferred embodiment, the excipients are mannitol, histidine, sucrose. More preferably, 50mg/ml mannitol, 25mg/ml sucrose and 25mg/ml histidine are included in a solution containing 0.5mg/ml protein. In another preferred embodiment, the excipients are sucrose, mannitol and Tween-80.

In a preferred embodiment, suitable freeze-drying conditions are:

(1) pre-freezing to-45 deg.C, holding for 2 hr, pre-vacuumizing to 12 + -2 Pa,

(2) heating to-6 ℃ for 90 minutes, keeping the temperature for 10 hours,

(3) heating to 15 ℃ for 1 hour, keeping for 5 hours,

(4) and (5) further drying.

In one aspect, the present application provides hydro-acupuncture formulations comprising MG53 or a MG53 mutant of the present application and methods of making the same.

In one embodiment, the method of making a hydro-acupuncture formulation comprising MG53 or a MG53 mutant of the present application comprises the steps of:

(1) dissolving lyophilized MG53 or the MG53 mutant of the present application in a solvent,

(2) adjusting the pH value, filtering,

(3) sealed and sterilized to produce a hydro-acupuncture formulation comprising MG53 or the MG53 mutant of the present application. In one embodiment, the solvent is a solvent commonly used in medicine, preferably water, such as water for injection or physiological saline.

In one aspect, the present application provides a spray formulation comprising MG53 or the MG53 mutant of the present application and a method of making the same. In one embodiment, the method of making a spray formulation comprising MG53 or a MG53 mutant of the present application comprises the steps of:

(1) lyophilized MG53 or a MG53 mutant of the present application,

(2) dissolving the lyophilized MG53 or MG53 mutant of the present application with a solvent to formulate a spray formulation comprising 50ng to 100 μ g/ml MG53 or MG53 mutant of the present application. In one embodiment, the solvent is a solvent commonly used in medicine, preferably water, such as purified water or physiological saline.

In one aspect, the present application provides gel formulations comprising MG53 or the MG53 mutants of the present application and methods of making the same. In one embodiment, the method of making a gel formulation comprising MG53 or the MG53 mutant of the present application comprises the steps of:

(1) lyophilized MG53 or a MG53 mutant of the present application,

(2) the lyophilized MG53 or MG53 mutant of the present application was dissolved in a solvent to formulate a gel solvent.

In one embodiment, the solvent is a polyoxyethylene-polyoxypropylene block copolymer or a mixture of carbomer, glycerin, chitosan and ethylparaben. In a preferred embodiment, the polyoxyethylene-polyoxypropylene block copolymer is a polyoxyethylene-polyoxypropylene block copolymer which is stored at low temperatures, e.g. 4-8 ℃.

In one aspect, the present application provides emulsions comprising MG53 or the MG53 mutants of the present application and methods of making the same. In one embodiment, the method of making an emulsion comprising MG53 or the MG53 mutant of the present application comprises the steps of:

(1) lyophilized MG53 or a MG53 mutant of the present application,

(2) the lyophilized MG53 or MG53 mutant of the present application was dissolved in chitosan solution, and emulsion base and glycerol were added to formulate an emulsion. In a preferred embodiment, the emulsion base comprises stearic acid, glyceryl monostearate, white petrolatum, Tween-80, glycerin, water and the like.

Brief Description of Drawings

FIG. 1 shows the structure of MG53 and the map of the PET-22b vector used. FIG. 1A, MG53 structural diagram.

MG53 is a RING domain having E3 ligase activity (also referred to as "RING domain") from N-terminus to C-terminus

RING finger region), B-BOX domain, linked-coil domain and SPRY domain. Drawing (A)

1B, map of the vector PET-22B used in the construction of MG53 mutant. PET-22b size of

5.5 KB. As can be seen from the map, PET-22b has NdeI and XhoI multiple cloning sites.

FIG. 2 shows agarose gel electrophoresis of the codon-optimized synthetic sequence of MG53 digested with the PET-22b plasmid. In FIG. 2A, the agarose gel electrophoresis of the PET-22b plasmid digested with NotI alone verified that the PET-22b plasmid was of the correct size, 5.5KB, where MK is the 1KB marker (Solarbio). FIG. 2B, agarose gel electrophoresis of a codon-optimized MG53 synthetic sequence (clone YB001-1) double digested with NdeI and XhoI. MK is a 1Kb marker (Solarbio) and the arrow represents the cleaved fragment of MG53 obtained after cleavage of the codon optimised MG53 synthetic sequence, with a size of 1.47 Kb.

FIG. 3 codon optimization of MG 53. In the consensus sequence, bases in upper case are the same base, and bases in lower case are different bases. Wild-type MG53 and optimized MG53 nucleotide bases were compared. MG53 was codon-optimized according to the preferred codons of E.coli without changing the amino acid sequence. Codons are optimized and then locally adjusted with reference to the secondary structure of the mRNA, especially where the secondary structure is denser, to maximize the free energy of the mRNA for ease of translation.

FIG. 4 comparison of nucleotide sequences of wild type MG53 and MG53S 189A. The TCC at position 565-567 (corresponding to serine at position 189) of wild type MG53 was mutated to GCC (alanine).

FIG. 5 is an SDS-PAGE pattern of MG53S189A induced expression in LB medium after IPTG induction. Lane 1 total protein before induction; lanes 2-3 show the total protein expression profile after 2h and 4h induction with IPTG, lane 4 shows the MG53 standard (molecular weight 53kd), lane 5 shows the protein marker, lane 6 shows the supernatant protein before induction, lanes 7-8 show the supernatant protein expression profile after 2h and 4h induction with IPTG, lane 9 shows the inclusion bodies before induction, and lane 10 shows the inclusion body protein after 4h induction. From this figure, it can be seen that MG53S189A induced higher expression levels in 5L fermentation volume, with both supernatant and inclusion bodies.

FIG. 6 shows a chromatography pattern of MG53S189A purified by DEAE column chromatography and a polyacrylamide gel electrophoresis (SDS-PAGE) pattern. FIG. 6A, chromatogram of purification of MG53S189A protein by DEAE column chromatography, where Cond denotes conductivity and Conc B denotes the concentration of eluent B in the mixture of A and B. FIG. 6B is an SDS-PAGE pattern of MG53S189A purified by DEAE column chromatography. Wherein lane 1 is the sample after centrifugation, lane 2 is the breakthrough peak, which means the sample that flows out of the column after the target protein has been adsorbed on the column, lane 3 is the sample obtained by eluting the 5% (volume ratio) solution of eluent B in the mixture of A and B, and lane 4 is the protein marker; lane 5 is the MG53 standard, lane 6 is the sample eluted with a 5% (by volume) eluent B in the mixture of A and B, and lane 7 is the sample eluted with eluent B.

FIG. 7 shows a chromatogram and SDS-PAGE pattern of MG53S189A purified by CM column chromatography. FIG. 7A, chromatogram of purification of MG53S189A protein by CM column chromatography, where Cond denotes conductivity and Conc B denotes the concentration of eluent B in the mixture of A and B. The chromatogram was obtained by purifying the peak eluted with a 5% (volume ratio) eluent B from a mixture of A and B at pH8.0 during the purification of MG53S189A by DEAE column chromatography. FIG. 7B is an SDS-PAGE pattern of MG53S189A purified by CM column chromatography. Wherein lane 1 is a sample, lane 2 is a breakthrough peak, i.e., a sample which flows out of the column after the target protein has been adsorbed to the column, lanes 3-4 are elution peaks A, B obtained by eluting a 10% (volume ratio) solution of eluent B in a mixture of a and B, respectively, and lane 5 is a protein marker; lanes 6-8 show the elution peaks A, B and C obtained from a 20% (by volume) eluent B in the mixture of A and B, lane 9 shows the elution peak obtained from a 30% (by volume) eluent B in the mixture of A and B, and lane 10 shows the sample obtained from eluent B.

FIG. 8 shows a chromatogram and SDS-PAGE pattern of MG53S189A purified by Source 30Q column chromatography. FIG. 8A, chromatogram of purified MG53S189A protein by Source 30Q chromatography. In the process of purifying MG53S189A protein by CM column chromatography, elution peaks A, B obtained by eluting with 20% (volume ratio) of eluent B in a mixture of A and B are combined and then purified by Source 30Q column chromatography to obtain a chromatogram, wherein Cond represents the conductivity, and Conc B represents the concentration of eluent B in the mixture of A and B. FIG. 8B is an SDS-PAGE pattern of MG53S189A protein purified by Source 30Q column chromatography. Wherein lane 1 is a sample, lane 2 is a sample which is passed through, and indicates a sample which flows out of the chromatographic column after the target protein has been adsorbed on the column, lanes 3 to 4 are respectively an elution peak A, B obtained by eluting with a 5% (volume ratio) solution of eluent B in a mixture of A and B, lane 5 is a sample obtained by eluting eluent B, lane 6 is an elution peak obtained by eluting NaOH, lane 7 is a protein marker, and lane 8 is a MG53 standard.

FIG. 9: effect of MG53 standard and MG53S189A protein on Lactate Dehydrogenase (LDH) activity of mechanically damaged 293T cells.

FIG. 10: the MG53S189A protein resulted in a decrease in the level of phosphorylation of AKT S473 compared to wild-type MG 53. Each lane is specifically: 3 and 6, wild type MG 53; 2 and 5, MG53S189A protein; 1 and 4, BSA, and, 1-3 represent rats not injected with insulin, and 4-6 represent rats injected with insulin 10min later. In rats not injected with insulin (lanes 1-3), no increase in phosphorylation level of AKT S473 is shown. In rats after insulin injection, MG53S189A protein (lane 5) resulted in a significant reduction in the level of phosphorylation of AKT S473 compared to wild-type MG53 (lane 6) and BSA (lane 4).

FIG. 11: compared with a control group, the MG53S189A protein causes no significant difference in each time point of the blood sugar of SD rats, thereby effectively avoiding side effects such as insulin resistance, obesity, diabetes, metabolic syndrome and the like.

FIG. 12MG 53S189A protein promoted proliferation of diabetic foot ulcer fibroblasts relative to control.

FIG. 13: MG53S189A protein can be used for treating diabetic foot ulcer and gangrene. After the MG53S198A protein gel preparation is used, the foot gangrene of all cases is improved, and the effective rate is 100 percent.

Detailed Description

The invention provides an MG53 mutant, which is a serine site mutant of MG53 protein in a woven-coil structural domain. This mutant MG53 protein resulted in inactivation of phosphorylation of MG 53. The MG53 protein mutant can be used for preventing or treating diseases related to cell membrane injury, such as diseases related to myocardial cell injury, diseases related to ulcer, trauma with wound, especially wound with difficult healing, intestinal leakage, kidney injury, etc. The disease associated with myocardial cell injury may include one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture. Ulcer-related diseases include one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.

MG53

MG53 is a newly found protein in The TRIM family (The family of superfamilies of tertiary motif-containing proteins). Unlike other family members, it is expressed only in skeletal muscle and cardiac muscle. MG53 protein is composed of a RING domain (also called RING finger region), a B-BOX domain, a woven-coil domain and a SPRY domain, which are known to have E3 ligase activity (FIG. 1A). The main function of MG53 is cell membrane repair and theoretically can be used for the treatment of diseases associated with cell membrane damage, such as diseases associated with myocardial cell damage, diseases associated with ulcers, trauma with wounds, particularly difficult to heal wounds, intestinal leakage, kidney damage, and the like. MG53 has been reported in the prior art to be useful for repairing wounds without leaving scars.

MG53 and cardioprotection

Blockage of cardiac blood flow leads to acute myocardial infarction, resulting in two different types of myocardial injury, including ischemic injury due to initial loss of blood flow and reperfusion injury due to restoration of oxygenated blood flow. Although the myocardium can tolerate brief exposure to ischemia (about 20 minutes) by switching metabolism to anaerobic glycolysis and fatty acid utilization and reducing contractility, continued ischemia results in irreversible myocardial damage, resulting in severe muscle cell death and permanent loss of contractility (contractility). Timely reperfusion of the ischemic heart is the only way to maintain cardiac cell viability. Reperfusion may provoke further damage to the myocardium, i.e. ischemia/reperfusion (IR) damage, due to Reactive Oxygen Species (ROS) -induced oxidative stress, induction of mitochondrial permeability transition pathway (MPEP), over-contraction and apoptosis, and necrotic cardiomyocyte death.

Initial studies showed that MG53 can be a structural protein in skeletal and cardiac muscle to promote cell membrane damage repair and also regulate intracellular vesicle transport and skeletal muscle cell regeneration; in addition, in cardiac muscle, MG53 also participates in the ischemia pre-adaptation process, it links two important ischemia pre-adaptation (IPC) molecular pathways, namely PI3K-Akt-GSK3 beta pathway and CaV3 pathway, through promoting the interaction of CaV3 and PI3K-p85, to activate Akt/GSK3 beta pathway, produce the protective action to the ischemia/reperfusion injury of heart, and then play an important protective function in the ischemia pre-treatment of heart (CN 101797375A). Therefore, MG53 has cell membrane repairing function, is involved in protecting cardiac muscle cells and/or tissues from cardiovascular diseases and/or cardiac ischemia/reperfusion injury, and hypoxia injury, and has repairing effect on heart failure.

MG53 and insulin metabolism

Insulin is the major regulatory hormone in the process of energy metabolism of sugars and fats. Insulin first binds to the cell surface insulin receptor (INSR), activating its B subunit Protein Tyrosine Kinase (PTK). Insulin receptor substrate protein (IRS), as an anchoring protein, binds to a signaling molecule containing the domain of sarcoma homology 2domain (SH 2) to activate binding of at least two signaling pathways known: one is the pathway of activation of phosphatidylinositol 3 kinase (PI3K) by IRS, i.e., the IR/IRSs-PI3K-Akt pathway; the other is the Mitogen Activated Protein Kinase (MAPK) pathway activated by Grb2/SOS and RAS proteins. The phosphoinositide 3 kinase (PI3K) family is an important molecule in the process of growth factor superfamily signal transduction, can be activated by various cytokines and physicochemical factors, and is a kinase which specifically catalyzes the phosphorylation of the 3-position hydroxyl of the phosphoinositide to generate inositol lipid substances with the function of a second messenger. Of the two pathways, insulin mediates the regulation of metabolism primarily through the IR/IRSs-PI3K-Akt pathway. AKT is in the central link of the pathway, and the phosphorylation level of Ser of AKT can be used as a key marker for detecting carbohydrate metabolism and insulin resistance.

With the development of scientific technology, it has been recognized that insulin resistance is a major feature and central link of type II diabetes, which means that the body cannot effectively activate the insulin receptor signaling pathway using insulin (1, 2). Normally, once insulin binds to the insulin receptor, it catalyzes dimerization and autophosphorylation of the receptor, as described above, leading to full activation, followed by recruitment and phosphorylation of insulin receptor substrates (irs) (3), which in turn leads to activation of a broad downstream signaling pathway in the cell (4). These signal pathways together regulate biological processes such as cellular vesicle transport, protein synthesis, activation and inactivation of enzymes, and gene expression in a synergistic manner, thereby ultimately controlling the metabolism of the three nutrients, sugar, fat, and protein (4).

In type II diabetes, due to insulin action deficiency, sugar, fat and protein metabolism disorder is caused, and can cause progressive damage to multiple systems such as eyes, kidneys, nerves, heart and blood vessels along with the prolongation of the course of disease, so that functional failure is caused, the life quality of a patient is reduced, the life is shortened, and the fatality rate is increased. In China, the onset of type II diabetes mellitus is gradually becoming younger, which brings heavy burden to the development of society and economy and seriously harms the life health of people. Therefore, active control of the insulin should be realized, and the key point of the control is to improve the insulin resistance.

The MG53 protein expressed by the MG53 gene is known to be expressed only in the heart and skeletal muscle (the largest insulin target organ of the whole body) (5), and it is presumed that the expression of the MG53 gene is likely to be related to the function of insulin. It has been found that there is a correlation between the expression of the MG53 gene and insulin resistance: in the case of insulin resistance, the expression of MG53 was significantly up-regulated; overexpression of MG53 results in the development of insulin resistance; MG53 deficiency significantly inhibited high fat diet-induced various disorders, promoted glucose metabolism and enhanced insulin sensitivity (CN 101912617A). In addition, MG53 was able to efficiently ubiquitinate Insulin Receptor (IR) and insulin receptor substrate 1(IRs 1). The RING domain of MG53, in particular the cysteine at the fourteenth position in the amino acid sequence, is essential for MG53 to catalyze the ubiquitination of IR and IRs1 (CN 103965342A).

The MG53 can protect the heart, namely the heart can be protected by increasing the content of MG 53. However, it was subsequently found that an increase in MG53 content, while protecting the heart, causes insulin resistance, obesity, diabetes and metabolic syndrome. That is, MG53 protects the heart and is associated with side effects such as insulin resistance, obesity, diabetes and metabolic syndrome. It is desirable in the art to retain the function of MG53 protein in protecting the heart, but not cause side effects such as insulin resistance, obesity, diabetes and metabolic syndrome.

MG53 and ulcer

Skin ulcers are localized tissue defects caused by a variety of causes. Chronic skin ulcer is caused when the wound surface is not healed for more than 2 weeks. Chronic skin ulcers usually have a long course of disease, slow progress of treatment, great pain to the body and spirit of the patient, and great impact on the quality of life of the patient. Diabetic patients and patients with vascular disease of the lower extremities are a high-risk group with chronic skin ulcers. Skin ulcers can be classified into wound infection ulcers, pressure ulcers, venous ulcers, diabetic foot and leg ulcers, and the like, according to different pathogenic factors.

The main methods for treating chronic skin ulcer are systemic drug treatment (such as using antibiotics and using traditional Chinese medicines), surgical treatment of wound (such as local debridement and anti-infection medicines) and local wound healing promotion measures. Many methods for promoting the healing of the surface wound are used, such as the use of growth factor medicines, physical therapies such as laser and the like, and topical application of traditional Chinese medicines and the like, but the clinical curative effects of the treatment methods are unsatisfactory.

Peptic ulcer is a chronic ulcer of mucosa, muscularis mucosae and submucosa, generally relates to gastric ulcer and duodenal ulcer, and is a frequently encountered disease and a common disease. At present, drugs for treating peptic ulcer mainly include drugs for lowering gastric acid, drugs for eradicating helicobacter pylori infection, and drugs for enhancing gastric mucosal protective action. However, none of the existing drugs currently used for treating ulcers, especially chronic skin ulcers, have a very satisfactory effect. Although compositions comprising MG53 have been suggested in some literature, e.g. CN103275980A and CN101511181B, for the possible treatment of ulcers, experimental studies of MG53 for the treatment of ulcers have not been performed in the prior art.

Leakage of intestine

Leaky gut is a condition resulting from increased permeability of the gut and is therefore also associated with damage to the intestinal epithelium. In patients with intestinal leakage, the cells used to control the release of nutrients from the intestine are broken down, resulting in a decrease in the efficiency of intestinal penetration. In patients with intestinal leakage, most particles of digested food enter the circulation through the intestinal wall. These particles are considered by humans as infectious pathogens, triggering an immune response of the immune system, manifested by an increase in white blood cells, inflammation, swelling and exhaustion. The triggered immune response may lead to more pathological symptoms such as ulcers, pain, cramps, etc., thereby impairing the health of the body.

Many conditions can lead to intestinal leakage, such as some bowel surgery, aging, certain types of food allergies, gluten allergy, irritable bowel syndrome, and the like. At present, no method is available for completely curing intestinal leakage. It has been found that intestinal leakage is not usually continuous, but rather intermittent and sudden symptoms.

Detailed Description

The woven-coil structural domain of MG53 protein is a relatively well-studied structural domain mediating protein-protein interaction at present, presents unique repeating units on the sequence, is very wide in distribution, and participates in many important life processes such as membrane fusion, membrane vesicle transport and the like. Functionally the coiled coil domain provides sufficient space for the head and tail structure of the protein during the process of membrane vesicle transport. In addition, the Coiled coil domain can also serve as a backbone to recruit proteins to form complexes. Cell proliferation, differentiation and apoptosis signals are transferred into a MAP kinase module to form a signal path.

The applicant believes that the conjugated coil domain plays an important role in the involvement of the MG53 protein in vesicle trafficking and signal pathway transduction. Therefore, applicants selected the Coiled coil domain of MG53 protein as the subject. Moreover, applicants have found that in the regulation of insulin signaling, the most important is the modification of phosphorylation, which occurs predominantly at two amino acids, one serine (including threonine) and the other tyrosine. The two types of acid-phosphorylated enzymes are not identical and function differently. The structural end of serine contains hydroxyl group, which can be combined with phosphate group, and the phosphorylation process is to transfer phosphate group. Serine sites in the Coiled coil domain are the three sites S150, S189 and S211 in MG 53.

Considering that the MG53 coded coil domain is well conserved, applicants have extensively conceived that the serine site in the MG53 coded coil domain is most likely involved in insulin metabolism and/or lipid metabolism in vivo, and therefore constructed a serine site mutant in the MG53 coded coil domain. These serine site mutations can result in inactivation of phosphorylation of MG 53. As mentioned above, insulin mediates its metabolic regulation primarily through the IR/IRSs-PI3K-Akt pathway. AKT is in the central link of the pathway, and the phosphorylation level of Ser of AKT can be used as a key marker for detecting whether to metabolize sugar and resist insulin.

Applicants have discovered that these MG53 mutations result in decreased levels of Akt Ser phosphorylation in the IR/IRs-PI 3K-Akt pathway. Thus, the present application for the first time found that the serine site in the MG53 tailored coil domain is involved in insulin metabolism and/or lipid metabolism in vivo.

Meanwhile, the serine site mutants protect the heart and avoid the side effects of insulin resistance, obesity, diabetes, metabolic syndrome and the like brought by MG53 with the same heart protection effect. And the MG53 mutant can be used for treating ulcer, especially chronic ulcer, peptic ulcer, such as diabetic foot ulcer, diabetic foot gangrene, chronic gastric ulcer, etc.

Thus, in one aspect, the invention provides a mutant of MG53, wherein the serine is substituted with an amino acid other than threonine and tyrosine in the woven-coil domain of MG53 protein. So long as the mutation results in the inability of serine in the MG53 Coiled coil domain to be phosphorylated. Preferably, serine in the MG53 Coiled coil domain is mutated to a non-polar amino acid. In one embodiment, in the MG53 mutant of the present application, the nonpolar amino acid that is mutated is alanine, glycine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, or methionine. Preferably, the non-polar amino acids are alanine, glycine, leucine, proline, valine, and isoleucine. Most preferably, the non-polar amino acid is alanine.

In a preferred embodiment, when the non-polar amino acid mutated in the MG53 mutant is alanine, the MG53 mutant is selected from any one or more of MG53S150A, MG53S189A, and MG53S 211A.

Expression and purification of MG53 mutant

In another aspect, the present application provides a method of making a MG53 mutant of the present application, comprising the steps of:

(1) mutating wild MG53 to obtain MG53 mutant, and cloning into plasmid;

(2) expressing the MG53 mutant plasmid in a cell;

The MG53 mutant prepared by the method can obtain high purity, and is suitable for directly preparing a pharmaceutical composition.

Construction of MG53 mutant plasmids

Methods for obtaining mutants of known proteins are well known to those skilled in the art.

In a preferred embodiment, the full-length sequence of the wild-type MG53 plasmid is subjected to Site-Directed Mutagenesis using a Site-Directed Mutagenesis Kit, such as QuikChange Site-Directed Mutagenesis Kit Catalog, to yield the MG53 mutant plasmid. More preferably, the wild-type MG53 plasmid is codon optimized.

In one embodiment, suitable primers can be designed to introduce the amino acid sequence of the mutation site in the primers to allow site-directed mutagenesis of the full-length sequence of the wild-type MG53 plasmid in a Polymerase Chain Reaction (PCR) to obtain the MG53 mutant plasmid.

To facilitate expression of the MG53 mutant and to facilitate purification thereof, codons of the full-length sequence of the wild-type MG53 plasmid may be optimized. In a preferred embodiment, MG53 is Codon-optimized according to the preferred codons for E.coli, which are referenced to the Codon Usage Database (http:// www.kazusa.or.jp/Codon /). Synthetic Gene Designer (http:// www.evolvingcode.net/codon/sgd/index. php) was used without changing the amino acid sequence, the codons were optimized and then adjusted locally with reference to the secondary structure of the mRNA, especially where the secondary structure is denser, to make the free energy of the mRNA as high as possible for ease of translation (see FIG. 3 for a comparison of wild type MG53 and optimized MG53 codons).

PCR primers can be designed using a variety of software known in the art, for example using Agilent online primer design software. Preferably, the designed primer satisfies the following conditions:

1) the primer is 25-45bp

2) Tm 81.5+0.41 (% GC) - (675/N) -% mismatch

3) End is C or G

4) Primers cannot be phosphorylated (primers are synthesized by default to be non-phosphorylated, if phosphorylation is required, the 3' end is added with a phosphate group)

5) The primers can be purified by denaturing polyacrylamide gel electrophoresis (PAGE).

Denaturing polyacrylamide gel electrophoresis is a method for classifying DNA based on the size of gel and the conformational principle of DNA, and primers differing by one base can be separated, so that separation between full-length products and failure sequences is realized. Then, the target DNA (primer) is recovered from the gel, and the qualitative analysis is carried out on the DNA by matching with mass spectrum, so as to ensure the correctness of the recovered fragment (primer).

Polymerase chain reaction was performed under appropriate PCR conditions by using the mutation kit to obtain MG53 mutant product. The resulting MG53 mutant product was then loaded into a suitable expression vector. After transformation of the vector containing the gene sequence of interest into competent cells, visible colonies are obtained by culturing under suitable antibiotic resistance conditions. Single colonies were picked and sequenced to give MG53 mutant plasmid. Preferably, the antibiotic resistance is ampicillin resistance.

Preferred expression vectors are known in the art, for example, Okayama-Berg cDNA expression vector pcDV1(Pharmacia), pCDM8, PET-22b, pRc/CMV, pcDNA1, pcDNA3 (Invitrogen) or pSPORT1(GIBCO BRL). In a preferred embodiment, the expression vector PET-22b plasmid is used. The PET-22B plasmid has a size of 5.5KB, and the PET-22B plasmid map is shown in FIG. 1B. As can be seen from the map, PET-22b has NdeI and XhoI multiple cloning sites.

In a preferred embodiment, PCR reactions are carried out using codon-optimized plasmids as templates and high fidelity DNA polymerases, respectively, with the corresponding mutant primers. In one embodiment, the PCR reaction conditions are as follows:

95℃2min，

the following 18 cycles were performed: 95 deg.C for 20 seconds, 60 deg.C for 10 seconds, and 68 deg.C for 3.5min

Finally, 5min at 68 ℃.

Preferably, the resulting PCR product is subjected to restriction enzyme digestion, e.g., with DPNI. The PCR product was then transformed into competent cells.

Methods for transforming the resulting PCR products into competent cells are known in the art, such as heat shock methods.

Expression of MG53 mutant protein

Methods for expressing proteins are well known to those skilled in the art. For expression of the MG53 mutant protein, for example, the MG53 mutant gene can be loaded into a suitable expression vector. Expression is carried out in a suitable host cell by means of an expression vector. The host cell may be eukaryotic or prokaryotic. Preferably the host cell is a prokaryotic cell. More preferably the host cell is e. In a related embodiment, the host cell is a eukaryotic cell. Preferably the eukaryotic cell is selected from the group consisting of a protist cell, an animal cell, a plant cell and a fungal cell. More preferably the host cell is a mammalian cell, including but not limited to, CHO, COS or HEK293-F (HEK293-FreeStyle) cells; or fungal cells such as Saccharomyces cerevisiae; or insect cells such as Sf 9.

Preferred expression vectors are known in the art, for example, Okayama-Berg cDNA expression vector pcDV1(Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (Invitrogen) or pSPORT1(GIBCO BRL). Other examples of typical fusion expression vectors are pGEX (Pharmacia Biotech Inc; Smith, D.B. and Johnson, K.S (1988) Gene67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5(Pharmacia, Piscataway, N.J.), in which glutathione S-transferase (GST), maltose E binding protein and protein A are fused to the recombinant target protein, respectively. Examples of suitable inducible non-fusion E.coli expression vectors are, inter alia, pTrc (Amann 1988, Gene 69: 301-315) and pET 11d (Studier 1999, Methods in Enzymology 185, 60-89). Target gene expression from the pTrc vector is based on transcription of a hybrid trp-lac fusion promoter by host RNA polymerase. Target gene expression from the pET 11d vector is based on transcription from the T7gn 10-lac fusion promoter, which is mediated by co-expressed viral RNA polymerase (T7 gn 1). Viral polymerases from established lambda-prophages carrying the T7gn1 gene under transcriptional control of the lacUV 5 promoter are provided by host strains BL21(DE3) or HMS174(DE 3). Other vectors suitable for prokaryotes are known to the skilled worker, such vectors being, for example, pLG338, pACYC184, the pBR series, such as pBR322, the pUC series, such as pUC18 or pUC19, the M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, lambda gt11 or pBdCI in E.coli, pIJ101, pIJ364, pIJ702 or pIJ361 in Streptomyces, pUB110, pC194 or pBD214 in Bacillus, pSA77 or pAJ667 in Corynebacterium. Examples of vectors for expression in Saccharomyces cerevisiae include pYep Sec1(Baldari 1987, Embo J.6: 229-), pMFa (Kurjan 1982, Cell 30: 933-. Vectors and methods of vector construction suitable for use in other Fungi, such as filamentous Fungi, include those described in detail in van den Hondel, C.A.M.J.J., & Punt, P.J. (1991) "Gene transfer systems and vector details for parameter Fungi, in: Applied Molecular Genetics of Fungi, J.F.Peberdy et al, pp.1-28, Cambridge University Press: Cambridge, or in More Gene management in Fungi (J.W.Bennet & L.L.Lasure, pp.396-428: Academic Press: Sanego). Other suitable yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe 23. In a preferred embodiment, the expression vector PET-22b is used.

In a preferred embodiment, the MG53 mutant protein is expressed in e. More preferably, the expression conditions are aerobic conditions, at 37 ℃ when cultured to an OD of about 6.5, and 0.5mM IPTG is added to induce expression at 28 ℃ for 4 h.

Purification of MG53 mutant proteins

As shown in fig. 5, MG53 mutant protein was expressed to a high degree in both bacterial supernatant and bacterial cells after induction of expression. However, in both the supernatant and the bacterial cells, there were many contaminating proteins in addition to the MG53 mutant protein. Therefore, purification of the expressed MG53 mutant protein is required for subsequent functional studies or for the preparation of pharmaceutical compositions.

Methods of purifying proteins are well known to those skilled in the art and may be used alone or in combination. Such methods are, for example, affinity chromatography using microbially derived proteins (e.g. protein a or protein G affinity chromatography), ion exchange chromatography (e.g. cation exchange (carboxymethyl resin), anion (aminoethyl resin) and mixed mode exchange chromatography), thiophilic adsorption (e.g. with β -mercaptoethanol and other SH ligands), hydrophobic interaction or aromatic adsorption chromatography (e.g. with phenyl-sepharose, aza-arenophilic (aza-arenophilic) resin or m-aminophenylboronic acid (m-aminophenyl boronic acid), metal chelate affinity chromatography (e.g. with ni (ii) -and (cu ii) -affinity substances), size exclusion chromatography, and preformed electrophoretic methods (e.g. gel electrophoresis, capillary electrophoresis) (viyalajakshmi, m.a., biochem. applied. 75(1998) 93-102).

In a preferred embodiment, MG53 mutant protein (see fig. 8) is purified using chromatography such as DEAE column chromatography and CM column chromatography (see fig. 6-7), optionally Source 30Q column chromatography. In the application, the MG53 mutant protein with very high purity can be obtained by adopting the combination of DEAE column chromatography and CM column chromatography, and optionally combining with Source 30Q column chromatography for purification (see figures 6-8), and can be used for carrying out various functional experiments and preparing pharmaceutical compositions, and dry powder preparations, spray preparations or gel preparations thereof.

In one embodiment, the bacterial supernatant containing MG53 mutant protein after induction of expression is primarily purified by DEAE column chromatography to collect MG53 mutant protein. In a preferred embodiment, in DEAE column chromatography, binding solution A is 20mM Tris, pH8.0, eluent B is 20mM Tris and 1.0M NaCl, pH8.0, optionally eluted with a 5% solution of eluent B in a mixture of A and B and/or eluent B. In one embodiment, DEAE column chromatography purification is performed using a GE AKTA PURE 150M fully automated chromatography system.

After DEAE column chromatography purification, the obtained MG53 mutant protein can reach 80% purity.

In order to further increase the purity of MG53 mutant protein, in one embodiment, the main elution peak obtained by DEAE column chromatography purification (elution peak obtained by eluting 5% (volume ratio) of eluent B in a mixture of a and B at ph 8.0) was subjected to CM column chromatography.

In a preferred embodiment, in CM column chromatography, binding solution a is 20mM PB, pH6.0, eluent B is 20mM PB and 1.0M NaCl, pH6.0, optionally eluted with a solution of eluent B at 10% in the mixture of a and B and/or a gradient of eluent B between 10% and 30% in the mixture of a and B and/or eluent B.

After the main elution peak obtained by DEAE column chromatography purification is subjected to CM column chromatography purification, the obtained MG53 mutant protein can reach the purity of more than 85%.

In order to further improve the purity of MG53 mutant protein, in a preferred embodiment, the elution peak obtained by CM column chromatography (elution peak obtained by eluting 20% (volume ratio) of eluent B in a mixture of a and B) is subjected to Source 30Q column chromatography.

In a preferred embodiment, in Source 30Q column chromatography, binding solution a is 20mM Tris, pH 8.5, eluent B is 20mM Tris and 1.0M NaCl, pH 8.5, optionally eluted with eluent B.

In one embodiment, MG53 mutant protein purified by DEAE column chromatography and CM column chromatography can be used to prepare dry powder formulations and/or spray formulations and/or gel formulations. In another embodiment, MG53 mutant protein purified by DEAE column chromatography and CM column chromatography can be used to prepare a pharmaceutical composition for preventing and/or treating diseases caused by cardiac ischemia/reperfusion injury, or a pharmaceutical composition for preventing and/or treating ulcer-related diseases.

The MG53 mutant protein obtained after Source 30Q column chromatography can reach the purity of more than 95%, and the quality standard of the national protein for injection is met through the determination of heat Source substances and biological activity of a detection object. In one embodiment, MG53 mutant protein purified by DEAE column chromatography, CM column chromatography and Source 30Q column chromatography can be used to prepare dry powder formulations and/or spray formulations and/or gel formulations. In another embodiment, the MG53 mutant protein purified by DEAE column chromatography, CM column chromatography and Source 30Q column chromatography can be used for preparing a pharmaceutical composition for preventing and/or treating diseases caused by cardiac ischemia/reperfusion injury, or preventing and/or treating ulcer-related diseases.

Pharmaceutical composition comprising MG53 mutant protein

In one aspect, the present application provides a pharmaceutical composition comprising a MG53 mutant protein of the invention. The pharmaceutical compositions of the present invention are formulated with suitable carriers, excipients, and other agents that provide improved transfer, delivery, tolerance, and the like. A variety of suitable formulations can be found in all prescriptions known to pharmacists: remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa. These preparations include, for example, powders, pastes, ointments, gels, waxes, oils, lipids, vesicles (such as LIPOFECTIN)^TM) Lipid (cationic or anionic), DNA conjugates, anhydrous absorbent pastes, oil-in-water and water-in-oil emulsions, emulsion carbowax (polyethylene glycol of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax. See also Powell et al, Complex of experiments for general purposes PDA (1998) J Pharm Sci Technol 52: 238-311.

The dose of MG53 mutant protein administered to a patient may vary depending on the age and size of the patient, the disease, condition of interest, the route of administration, and the like. The preferred dosage is generally calculated based on body weight or body surface area. Depending on the severity of the condition, the frequency and duration of treatment may be adjusted. Effective dosages and schedules for administering MG53 mutant proteins can be determined empirically; for example, the course of a patient may be monitored by periodic assessment and the dosage adjusted accordingly. In addition, interspecies analogies of dosages can be performed using methods well known in the art (e.g., Mordenti et al, 1991, Pharmaceut. Res.8: 1351).

A variety of delivery systems are known and can be used to administer the pharmaceutical compositions of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing a mutant virus, receptor-mediated endocytosis (see, e.g., Wu et al, 1987, J.biol.chem.262: 4429-4432). Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compositions may be administered by any conventional route, for example by infusion or bolus injection, by epithelial or dermal mucosa (e.g., oral, rectal and intestinal mucosa, etc.), and may be administered with other biologically active agents. Administration may be systemic or local.

Application of MG53 protein mutant in preparing pharmaceutical composition for preventing or treating diseases related to cell membrane damage

As described above, MG53 has a cell membrane repairing function and is useful for the prevention or treatment of diseases associated with cell membrane damage, such as diseases associated with myocardial cell damage, diseases associated with ulcers, trauma with wounds, particularly wounds that are difficult to heal, intestinal leakage, kidney damage, and the like. Wherein the disease associated with myocardial cell injury may include one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture. And the ulcer-related disease comprises one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.

Application of MG53 mutant in preparing pharmaceutical composition for preventing and/or treating diseases related to myocardial cell injury

The MG53 mutant has obvious effect of protecting myocardial ischemia reperfusion injury

In particular, the MG53 protein mutant is found to protect the heart and simultaneously avoid the side effects of insulin resistance, obesity, diabetes, metabolic syndrome and the like brought by MG53 with the same heart protection effect.

MG53 protein is involved in protecting cardiomyocytes and/or tissues from cardiovascular disease and/or cardiac ischemia/reperfusion injury, hypoxic injury, with a reparative effect in heart failure. Applicants found that the MG53 mutant provided herein has comparable repair effect on cell membrane of mechanically damaged 293T cells as MG53 (see example 8, fig. 9).

Since many documents report that the MG53 has a protective effect on cardiac ischemia/reperfusion injury, the effect of the MG53 mutant in the application on cardiac ischemia/reperfusion injury is researched. The results show that, similar to MG53, the MG53 mutant of the present application can reduce the area of myocardial ischemia infarct area, and has a significant effect of protecting myocardial ischemia reperfusion injury when applied before myocardial ischemia or reperfusion (see example 9).

Therefore, in another aspect, the MG53 mutant provided herein can be used for preparing a medicament for preventing and/or treating a disease associated with myocardial cell injury. In a preferred embodiment, the disease associated with myocardial cell injury comprises one or more selected from the group consisting of: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture.

The MG53 mutant does not cause side effects such as insulin resistance

As mentioned above, MG53 can exert protective effect on heart, that is, cardiac injury can be protected by increasing MG53 content. However, it was later found that an increase in MG53 content, while protecting the heart, causes insulin resistance, obesity, diabetes and metabolic syndrome. Therefore, MG53 protects the heart and is associated with side effects such as insulin resistance, obesity, diabetes and metabolic syndrome. It is desirable in the art to retain the function of MG53 protein in protecting the heart, but not cause side effects such as insulin resistance, obesity, diabetes and metabolic syndrome.

The applicant speculates that the serine site in the MG53 Coiled coil domain (three sites S150, S189 and S211 in MG53) is likely to be involved in insulin metabolism and/or lipid metabolism in vivo, and constructs the serine site mutant in the MG53 Coiled coil domain of the present application. These serine site mutations can result in inactivation of phosphorylation of MG 53. In addition, the applicant also researches the influence of the MG53 mutant on side effects of MG53 such as insulin resistance, obesity, diabetes and metabolic syndrome.

Insulin mediates its metabolic regulation primarily through the IR/IRSs-PI3K-Akt pathway. AKT is in the central link of the pathway, and the phosphorylation level of Ser on AKT can be used as a key marker for detecting whether to metabolize sugar and detect insulin resistance. Applicants found that the MG53 mutant of the present application resulted in a significant reduction in Ser phosphorylation level at position 473 of AKT compared to wild-type MG53 (see example 10, figure 10), thereby significantly reducing the insulin resistance effect of MG 53. Meanwhile, the MG53 mutant of the present application did not cause an increase in blood glucose (see example 11, fig. 11).

It is thus understood that the MG53 mutant of the present invention exerts a cardioprotective function without causing side effects such as insulin resistance, obesity, diabetes, and metabolic syndrome.

Use of MG53 mutant for the preparation of a pharmaceutical composition for the prevention and/or treatment of ulcer-related diseases

As mentioned above, skin ulcers are local tissue defects caused by various causes. Chronic skin ulcer is caused when the wound surface is not healed for more than 2 weeks. Chronic skin ulcers usually have a long course of disease and slow treatment progress, bring great pain to the organism and spirit of patients and greatly affect the life quality of patients. Diabetic patients and patients with vascular disease of the lower extremities are a high-risk group with chronic skin ulcers. Skin ulcers can be classified into wound infection ulcers, pressure ulcers, venous ulcers, diabetic foot and leg ulcers, and the like, according to different pathogenic factors.

The main methods for treating chronic skin ulcer are systemic drug treatment (such as using antibiotics and using traditional Chinese medicines), surgical treatment of wound (such as local debridement and anti-infection medicines) and local wound healing promotion measures. Many methods for promoting the healing of the surface wound are used, such as the use of growth factor medicines, physical therapies such as laser and the like, and topical application of traditional Chinese medicines and the like, but the clinical curative effect of the existing treatment method is not satisfactory.

The etiology of diabetic foot gangrene is complex, which can be caused by malnutrition, atherosclerosis, and trauma. Although diabetic vasculopathy is extensive, the pathological development is slow, the formulation of the diabetic vasculopathy is beneficial to collateral circulation, and if the diabetic vasculopathy can be actively treated in the early stage of the formation of the gangrene, the regeneration of blood vessels and epidermal cells is promoted, and the gangrene can be effectively relieved or cured. The currently used local medicines, such as gentamicin, can inhibit local bacterial growth, but can not well promote wound healing, and the traditional Chinese medicine has long granulation promoting effect and poor effect. Although the epidermal growth factor has certain effect, the clinical expression of the epidermal growth factor is still ineffective when the epidermal growth factor is used by a plurality of patients.

The effects of the existing medicines for treating ulcer, especially chronic skin ulcer are not ideal. Although compositions comprising MG53 have been suggested in some literature, e.g. CN103275980A and CN101511181B, for the possible treatment of ulcers, experimental studies of MG53 for the treatment of ulcers have not been performed in the prior art.

The applicant found that the MG53 mutant provided herein has a very good therapeutic effect on ulcers, particularly chronic ulcers and peptic ulcers. For example, MG53 mutants have the following effects:

1) can effectively promote the proliferation of fibroblasts at the diabetic foot ulcer part, and is beneficial to the healing of diabetic foot ulcer and leg ulcer;

2) promoting the healing of chronic gastric ulcer wound;

3) the traditional Chinese medicine composition is safe, quick in effect taking and convenient to use, and is the best choice for treating the diabetic foot ulcer and gangrene at present.

Therefore, the MG53 mutant provided by the application can be used for preparing a medicament for preventing and/or treating diseases related to ulcer. In a preferred embodiment, the ulcer-related disease is chronic ulcer and peptic ulcer. In a preferred embodiment, the chronic ulcer and peptic ulcer comprise one or more selected from the group consisting of: diabetic foot ulcer, diabetic foot gangrene, chronic gastric ulcer.

In addition, the MG53 mutant provided herein can be used for preparing a pharmaceutical composition for preventing and/or treating diseases associated with cell membrane damage, such as trauma with wounds, particularly wounds that are difficult to heal, intestinal leakage, kidney damage, and the like.

Preparation of dry powder, spray, coacervate and emulsion of MG53 mutant

Also provided herein are dry powder formulations, spray formulations, coacervate formulations, and emulsions of MG53 or the MG53 mutant of the present application. Also provided are methods for preparing such formulations. These protein formulation forms can be more conveniently transported and stored.

Commonly used excipients for stabilizing protein solutions are known in the art. The following categories are specific:

1. polyhydroxy compounds

The action mechanism is as follows: a layer of water film is formed on the surface of the protein to protect the protein from being invaded by external hydrophobic groups, thereby achieving the purpose of protecting the protein in the solution.

The specific auxiliary materials are as follows: glycerol, mannitol, sorbitol, inositol and polyethylene glycol.

2. Saccharides and their use as anti-inflammatory agents

The action mechanism is as follows: prevent the change of the secondary structure of the protein and protect the extension and aggregation of polypeptide chains.

The specific auxiliary materials are as follows: sucrose, glucose, lactose, trehalose, mannose, maltose, and the like.

3. Surface active agent

The action mechanism is as follows: ionic surfactants (e.g., sodium lauryl sulfate) can affect protein denaturation; however, non-ionic surfactants (e.g., Tween 80) prevent protein adsorption to the surface, thereby inhibiting protein aggregation and precipitation.

The specific auxiliary materials are as follows: tween80, sodium dodecyl sulfate.

4. Polymer and method of making same

The action mechanism is as follows: prevent protein or other adjuvants from crystallizing out, and limit molecular diffusion

Specific auxiliary materials: polyethylene glycol, polyvinyl pyrrolidone.

Thus, these common adjuvants can be used as adjuvants for the preparation of dry powder formulations comprising MG53 or the MG53 mutants of the present application.

In a preferred embodiment, suitable freeze-drying conditions are:

(1) pre-freezing to-45 deg.C, holding for 2 hr, pre-vacuumizing to 12 + -2 Pa,

(2) heating to-6 ℃ for 90 minutes, keeping the temperature for 10 hours,

(3) heating to 15 ℃ for 1 hour, keeping for 5 hours,

(4) and (5) further drying.

Hydro-acupuncture preparation refers to an injection solution in which a drug has been dissolved. It is one type of injection, and is generally contained in a container such as an ampoule bottle, and when used, the container is knocked open for intravenous or intramuscular injection.

(2) adjusting the pH value, filtering,

(1) lyophilized MG53 or a MG53 mutant of the present application,

Examples

The following examples are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It is to be understood that modifications can be made to the presented methods without departing from the spirit of the invention.

Example 1: construction of MG53 mutant plasmid MG53S189A

MG53 gene optimization, synthesis and subcloning of MG53S189A and plasmid preparation:

the following are reagents and sources used in the construction of the MG53S189A plasmid:

reagent: t4 DNA ligase sources: NEB lot number: 00309971,

PET-22b plasmid, origin: the company Novagen, Inc. has a number of,

source of competent cells: tiangen Biochemical technology (Beijing) Ltd. (CB105-02),

sources of experimental water: ddH2O batch number: 10/13/2015,

sources of endonuclease NdeI: stock number NEB: r is the number of the R0111S,

sources of endonuclease XhoI: stock number NEB: R5146S.

In addition, the equipment used in the construction of MG53S189A plasmid and its source are listed in Table 1

TABLE 1 Equipment used in construction of MG53S189A plasmid

Name of instrument	Model number	Manufacturer of the product
			Centrifugal machine	MEGAFUGE 8R	Thermo
Electrophoresis apparatus	DYY-8C type electrophoresis apparatus	Beijing Junyi Orient
			Gel imaging system	JY04S-3C type	Beijing Junyi Orient
Electrophoresis tank	DYCP-31DN TYPE ELECTROPHORESIS BATH
			Electric heating constant temperature incubator	DHP-9082 Shanghai Hengke
Super clean bench	DL-CJ-2ND	East Unihaar;
			single-channel precision pipettor	0.5-10ul/20-200ul/100-1000ul	Eppendorf
PCR instrument	Berle	T100
			TS-1 shaking table	TS-1	Her linbel

1.1 construction of codon-optimized wild-type MG53 plasmid

1.11 codon optimization of wild type MG53 plasmid

MG53 was Codon-optimized according to E.coli preferred codons, which were used at a frequency according to Codon Usage Database (C.coli)http:// www.kazusa.or.jp/codon /). On the basis of no change in amino acid sequence Synthetic used above Gene Designer(http://www.evolvingcode.net/codon/sgPhp), the codons are optimized codons, and then local adjustment is performed by referring to the secondary structure of the mRNA, particularly in places with dense secondary structures, so that the free energy of the mRNA is as high as possible, and translation is easy.

Detailed cloning protocols and optimized gene sequences are as follows:

NdeI- - -codon optimized sequence-XhoI

MG53 native codon sequence:

ATGTCGGCTGCGCCCGGCCTCCTGCACCAGGAGCTGTCCTGCCCGCTGTGCCTGCAGCTGTTCGACGCGCCCGTGACAGCCGAGTGCGGCCACAGTTTCTGCCGCGCCTGCCTAGGCCGCGTGGCCGGGGAGCCGGCGGCGGATGGCACCGTTCTCTGCCCCTGCTGCCAGGCCCCCACGCGGCCGCAGGCACTCAGCACCAACCTGCAGCTGGCGCGCCTGGTGGAGGGGCTGGCCCAGGTGCCGCAGGGCCACTGCGAGGAGCACCTGGACCCGCTGAGCATCTACTGCGAGCAGGACCGCGCGCTGGTGTGCGGAGTGTGCGCCTCACTCGGCTCGCACCGCGGTCATCGCCTCCTGCCTGCCGCCGAGGCCCACGCACGCCTCAAGACACAGCTGCCACAGCAGAAACTGCAGCTGCAGGAGGCATGCATGCGCAAGGAGAAGAGTGTGGCTGTGCTGGAGCATCAGCTGGTGGAGGTGGAGGAGACAGTGCGTCAGTTCCGGGGGGCCGTGGGGGAGCAGCTGGGCAAGATGCGGGTGTTCCTGGCTGCACTGGAGGGCTCCTTGGACCGCGAGGCAGAGCGTGTACGGGGTGAGGCAGGGGTCGCCTTGCGCCGGGAGCTGGGGAGCCTGAACTCTTACCTGGAGCAGCTGCGGCAGATGGAGAAGGTCCTGGAGGAGGTGGCGGACAAGCCGCAGACTGAGTTCCTCATGAAATACTGCCTGGTGACCAGCAGGCTGCAGAAGATCCTGGCAGAGTCTCCCCCACCCGCCCGTCTGGACATCCAGCTGCCAATTATCTCAGATGACTTCAAATTCCAGGTGTGGAGGAAGATGTTCCGGGCTCTGATGCCAGCGCTGGAGGAGCTGACCTTTGACCCGAGCTCTGCGCACCCGAGCCTGGTGGTGTCTTCCTCTGGCCGCCGCGTGGAGTGCTCGGAGCAGAAGGCGCCGCCGGCCGGGGAGGACCCGCGCCAGTTCGACAAGGCGGTGGCGGTGGTGGCGCACCAGCAGCTCTCCGAGGGCGAGCACTACTGGGAGGTGGATGTTGGCGACAAGCCGCGCTGGGCGCTGGGCGTGATCGCGGCCGAGGCCCCCCGCCGCGGGCGCCTGCACGCGGTGCCCTCGCAGGGCCTGTGGCTGCTGGGGCTGCGCGAGGGCAAGATCCTGGAGGCACACGTGGAGGCCAAGGAGCCGCGCGCTCTGCGCAGCCCCGAGAGGCGGCCCACGCGCATTGGCCTTTACCTGAGCTTCGGCGACGGCGTCCTCTCCTTCTACGATGCCAGCGACGCCGACGCGCTCGTGCCGCTTTTTGCCTTCCACGAGCGCCTGCCCAGGCCCGTGTACCCCTTCTTCGACGTGTGCTGGCACGACAAGGGCAAGAATGCCCAGCCGCTGCTGCTCGTGGGTCCCGAAGGCGCCGAGGCCTGA

codon-optimized sequence for MG 53:

ATGAGCGCAGCACCGGGTCTGCTGCATCAAGAACTGAGCTGTCCGCTGTGTCTGCAGCTGTTTGATGCACCGGTTACCGCAGAATGTGGTCATAGCTTTTGTCGTGCATGTCTGGGTCGTGTTGCCGGTGAACCGGCAGCAGATGGCACCGTTCTGTGTCCGTGTTGTCAGGCACCGACCCGTCCGCAGGCACTGAGCACCAATCTGCAGCTGGCACGTCTGGTTGAAGGTCTGGCACAGGTTCCGCAGGGTCATTGTGAAGAACATCTGGACCCGCTGAGCATTTATTGTGAACAGGATCGTGCACTGGTTTGTGGTGTTTGTGCAAGCCTGGGTAGCCATCGTGGTCATCGTCTGCTGCCTGCAGCCGAAGCACATGCACGTCTGAAAACCCAGCTGCCGCAGCAGAAACTGCAGCTGCAAGAAGCATGTATGCGTAAAGAAAAAAGCGTTGCAGTTCTGGAACATCAGCTGGTTGAAGTTGAAGAAACCGTTCGTCAGTTTCGTGGTGCAGTTGGTGAACAGCTGGGTAAAATGCGTGTTTTTCTGGCAGCACTGGAAGGTAGCCTGGATCGTGAAGCAGAACGTGTTCGTGGTGAAGCCGGTGTTGCACTGCGTCGTGAACTGGGTAGCCTGAATAGCTATCTGGAACAGCTGCGTCAGATGGAAAAAGTTCTGGAAGAAGTTGCAGATAAACCGCAGACCGAATTTCTGATGAAATATTGTCTGGTTACCAGCCGTCTGCAGAAAATTCTGGCAGAAAGTCCGCCTCCGGCACGTCTGGATATTCAGCTGCCGATTATTAGTGATGATTTTAAATTTCAGGTGTGGCGCAAAATGTTTCGTGCACTGATGCCTGCACTGGAAGAACTGACCTTTGATCCGAGCAGCGCACATCCGAGCCTGGTTGTTAGCTCTAGCGGTCGTCGTGTTGAATGTAGCGAACAGAAAGCACCTCCGGCAGGCGAAGATCCGCGTCAGTTTGATAAAGCAGTTGCAGTTGTTGCCCATCAGCAGCTGAGCGAAGGTGAACATTATTGGGAAGTTGATGTTGGTGATAAACCGCGTTGGGCACTGGGTGTTATTGCAGCGGAAGCACCGCGTCGTGGTCGTCTGCATGCAGTTCCGAGCCAGGGTCTGTGGCTGCTGGGTCTGCGTGAAGGTAAAATTCTGGAAGCCCATGTTGAAGCAAAAGAACCGCGTGCACTGCGTAGTCCGGAACGTCGTCCGACCCGTATTGGTCTGTATCTGAGCTTTGGTGATGGTGTTCTGAGCTTTTATGATGCAAGTGATGCAGATGCATTAGTACCGCTGTTTGCATTTCATGAACGTCTGCCTCGTCCGGTTTATCCGTTTTTTGATGTTTGCTGGCATGATAAAGGCAAAAATGCACAGCCGCTGCTGCTGGTTGGTCCGGAAGGTGCAGAAGCATAA

according to the codon optimized sequence of MG53, Nanjing Kinshire organism company is entrusted to complete synthesis of MG53 sequence after codon optimization. A comparison of wild type MG53 and optimized MG53 codons can be seen in fig. 3.

1.12 construction of codon-optimized wild-type MG53 plasmid

Codon-optimized MG53 forward primer FP1 and reverse primer FP2 were designed, codon-optimized fragments were amplified from the synthetic codon-optimized MG53 sequence using PCR, and NdeI and XhoI cleavage sites were introduced. The PCR reaction conditions are as follows: 5min at 94 ℃; at 94 ℃ for 40 seconds, at 54 ℃ for 40 seconds, at 72 ℃ for 5min, for 30 cycles; extension at 72 ℃ for 10 min.

Forward primer FP1(5 '-3') for amplification of codon-optimized MG 53:

GGAGATCATATGATGAGCGCAGCACCGGGTCT

reverse primer FP2(5 '-3') used to amplify codon-optimized MG 53:

TGGTGGTGCTCGAGTTATTATGCTTCTGCAC

construction of codon optimized wild type MG53 and mutant plasmid MG53S189A was performed using the PET-22b plasmid as the vector. The PET-22B plasmid has a size of 5.5KB, and the PET-22B plasmid map is shown in FIG. 1B. As can be seen from the map, PET-22b has NdeI and XhoI multiple cloning sites.

The PET-22b plasmid was purchased from Novagen, transformed into BL-21 competent cells after purchase, plated (ampicillin resistant), and single colonies were selected and plasmids were extracted according to the protocol of the Tiangen plasmid extraction protocol. The PET-22b plasmid was digested with NotI alone and then subjected to 0.8% agarose gel to confirm that the size of the PET-22b plasmid was 5.5KB (FIG. 2A).

Simultaneously, the PET-22B plasmid and the synthesized optimized MG53 sequence are subjected to NdeI and XhoI double digestion, and then the digested MG53 sequence and the PET-22B plasmid are recovered by referring to the specification of Shanghai crude gel recovery kit (the code is SK 8131100 BP-10KB) (figure 2B). The glue recovery steps are as follows:

1) the fragments of interest of about 5.5kb and 1.47kb were excised from agarose gel and weighed about 0.2 g;

2) adding 3 times of Buffer B2, and carrying out water bath at 50 ℃ for 5min to obtain sol; .

3) Transferring the sol solution into an adsorption column, centrifuging at 8,000 Xg for 30 s, and pouring out the liquid in the collection tube;

4) adding 500ul wash solution 9,000 Xg, centrifuging for 30 s, and pouring out liquid in the collecting pipe;

5) centrifuging the column at 9,000 Xg for 1 min;

6) the adsorption column was placed in a sterilized 1.5ml centrifuge tube, 50ul of Elution buffer was added, and the mixture was allowed to stand at room temperature for 1min and stored for further use.

And (3) connecting the enzyme-digested optimized MG53 and PET-22b by using T4 ligase, transforming the connection product, screening colonies, performing double enzyme digestion and sequencing analysis on the screened colonies, and determining whether the optimized MG53 sequence exists.

The constructed plasmid is sent to Beijing Sanbo Polygala tenuifolia biological company for sequencing, and the result proves that the obtained plasmid is the optimized MG53 plasmid. To this end, the optimization, synthesis, subcloning and plasmid preparation of the wild type MG53 plasmid were completed.

Construction of the MG53S189A plasmid

Primers for constructing MG53S189A plasmid were designed, and MG53S189A plasmid was obtained by PCR using a mutation kit.

1.21 obtaining MG53S189A mutant by PCR

Designing a primer:

the method comprises the following steps of utilizing Agilent online primer design software:

the principle of the primers is as follows:

1) the primer is 25-45bp

2) Tm 81.5+0.41 (% GC) - (675/N) -% mismatch

3) End is C or G

4) Primers cannot be phosphorylated (primers are synthesized by default to be non-phosphorylated, if phosphorylation is required, a phosphate group is added at the 3' end)

The designed primers are as follows:

forward primer (5 '-3') for amplification of MG53S 189A:

Ctggcagcactggaaggtgccctggatcgtg

reverse primer (5 '-3') for amplification of MG53S 189A:

Cacgatccagggcaccttccagtgctgccag

the primers were synthesized by Beijing Liuhe Hua Dagen science and technology Co., Ltd. MG53 plasmid optimized by codon is mutated by using QuikChange Site-Directed Mutagenesis Kit Catalog #2 and 200519(10 reactions) mutation Kit to obtain MG53 mutant with 189 th serine mutated into alanine.

The method comprises the following specific steps:

1) primer dilution: the primers were centrifuged at 4000rpm for 5min, and the 10D dry powder was about 33ug, so that 33ul of sterile water was added per OD to make a concentration of 100 ng/ul. 50ul was taken for experiments and the remainder was stored at-20 ℃.

2) PCR was performed using 250ng of codon-optimized MG53 plasmid constructed as described above as a template, and using high fidelity DNA polymerase, the forward and reverse primers for amplification of MG53S 189A.

The reaction system is 25ul

The PCR reaction conditions are as follows:

95℃ 2min，

Finally, 5min at 68 ℃.

1.22 transformation and characterization of MG53S189A plasmid

The obtained PCR product is subjected to DPNI enzyme digestion to eliminate a template (MG53 plasmid optimized by codon) added in the PCR process, so that positive clones are ensured to be transformed, and the success rate is improved. DpnI is able to recognize and cleave methylation sites. The codon optimized MG53 plasmid was a double-stranded supercoiled plasmid extracted from E.coli and was methylated, whereas none of the PCR products were methylated. The DpnI enzyme was therefore able to specifically cleave the template (codon-optimized MG53 plasmid) without affecting the PCR product, thereby removing the template (codon-optimized MG53 plasmid) while retaining the PCR product (MG 53S 189A).

The DPNI cut was transformed into competent cells. Specifically, 1ul of DPNI enzyme is added into each PCR reaction system, and after the mixture is gently and uniformly mixed, the mixture is incubated at 37 ℃ for 5min, so that the DPNI digestion of the PCR product is carried out.

Then, the PCR product after enzyme digestion is transformed into competent cells XL10-Gold by a heat shock method. The specific steps are as followsThe following: dissolving competent cells XL10-Gold on ice, subpackaging in 4 15ml polypropylene tubes (precooled in advance), adding 2ul beta-ME into each Tube, uniformly mixing, incubating on ice for 2min, adding 4ul of sample subjected to DPNI enzyme digestion, uniformly mixing, incubating on ice for 30min, thermally shocking at 42 ℃ for 30 sec, standing on ice for 2min, adding 500ul of preheated NZY⁺The medium was incubated at 37 ℃ and 220rpm for 1h and plated on ampicillin-resistant LB plates. The culture was carried out overnight at 37 ℃.

Finally, the constructed MG53S189A plasmid was identified by sequencing. Specifically, after coating the MG53S189A plasmid on ampicillin-resistant LB plates, single colonies were picked the next day, shaken, and the extracted plasmid was sent to Beijing Sanbo Polygala Tenuifolia Bio Inc. for sequencing. Sequencing the correct MG53S189A plasmid sequence:

MG53S189A sequence:

ATGAGCGCAGCACCGGGTCTGCTGCATCAAGAACTGAGCTGTCCGCTGTGTCTGCAGCTGTTTGATGCACCGGTTACCGCAGAATGTGGTCATAGCTTTTGTCGTGCATGTCTGGGTCGTGTTGCCGGTGAACCGGCAGCAGATGGCACCGTTCTGTGTCCGTGTTGTCAGGCACCGACCCGTCCGCAGGCACTGAGCACCAATCTGCAGCTGGCACGTCTGGTTGAAGGTCTGGCACAGGTTCCGCAGGGTCATTGTGAAGAACATCTGGACCCGCTGAGCATTTATTGTGAACAGGATCGTGCACTGGTTTGTGGTGTTTGTGCAAGCCTGGGTAGCCATCGTGGTCATCGTCTGCTGCCTGCAGCCGAAGCACATGCACGTCTGAAAACCCAGCTGCCGCAGCAGAAACTGCAGCTGCAAGAAGCATGTATGCGTAAAGAAAAAAGCGTTGCAGTTCTGGAACATCAGCTGGTTGAAGTTGAAGAAACCGTTCGTCAGTTTCGTGGTGCAGTTGGTGAACAGCTGGGTAAAATGCGTGTTTTTCTGGCAGCACTGGAAGGTGCCCTGGATCGTGAAGCAGAACGTGTTCGTGGTGAAGCCGGTGTTGCACTGCGTCGTGAACTGGGTAGCCTGAATAGCTATCTGGAACAGCTGCGTCAGATGGAAAAAGTTCTGGAAGAAGTTGCAGATAAACCGCAGACCGAATTTCTGATGAAATATTGTCTGGTTACCAGCCGTCTGCAGAAAATTCTGGCAGAAAGTCCGCCTCCGGCACGTCTGGATATTCAGCTGCCGATTATTAGTGATGATTTTAAATTTCAGGTGTGGCGCAAAATGTTTCGTGCACTGATGCCTGCACTGGAAGAACTGACCTTTGATCCGAGCAGCGCACATCCGAGCCTGGTTGTTAGCTCTAGCGGTCGTCGTGTTGAATGTAGCGAACAGAAAGCACCTCCGGCAGGCGAAGATCCGCGTCAGTTTGATAAAGCAGTTGCAGTTGTTGCCCATCAGCAGCTGAGCGAAGGTGAACATTATTGGGAAGTTGATGTTGGTGATAAACCGCGTTGGGCACTGGGTGTTATTGCAGCGGAAGCACCGCGTCGTGGTCGTCTGCATGCAGTTCCGAGCCAGGGTCTGTGGCTGCTGGGTCTGCGTGAAGGTAAAATTCTGGAAGCCCATGTTGAAGCAAAAGAACCGCGTGCACTGCGTAGTCCGGAACGTCGTCCGACCCGTATTGGTCTGTATCTGAGCTTTGGTGATGGTGTTCTGAGCTTTTATGATGCAAGTGATGCAGATGCATTAGTACCGCTGTTTGCATTTCATGAACGTCTGCCTCGTCCGGTTTATCCGTTTTTTGATGTTTGCTGGCATGATAAAGGCAAAAATGCACAGCCGCTGCTGCTGGTTGGTCCGGAAGGTGCAGAAGCATAA

in addition, the results of comparing the nucleotide sequences of wild-type MG53 and MG53S189A are shown in fig. 4.

Example 2: expression and purification of MG53 mutant plasmid MG53S189A

2.1 expression of the MG53 mutant plasmid MG53S189A

The media used in the expression were as follows:

1) shaker medium (400 ml): LB medium (tryptone 2%, yeast powder 1%, sodium chloride 2%, 100. mu.g/ml Amp 1%);

2) fermentation medium (5L): (tryptone 12%, yeast powder 24%, glycerol 4 ml/L; dipotassium hydrogen phosphate 16.4%, potassium dihydrogen phosphate 2.32%, 100. mu.g/ml Amp 1%).

3) A supplemented medium: 50% of glycerol. The supplementary culture medium is used for supplementing carbon sources and energy sources required by the thalli in the later fermentation period.

And in the middle and later stages of the fermentation process, after the carbon source and the energy in the fermentation culture medium are consumed, the supplementing culture medium is used for supplementing the carbon source and the energy required by the thalli.

MG53S189A was expressed according to the following steps:

1) activated MG53S189A bacterial

MG53S189A plasmid was inoculated at 0.2% inoculum size to a shaker medium and incubated overnight at 160rpm at 36 ℃ to an OD of about 0.6. Then, the obtained bacterial liquid is inoculated to a fermentation tank.

2) Expression of MG53S189A

The bacterial solution MG53S189A was cultured in a fermenter under the following conditions: the rotation speed is 300rpm, the culture temperature is 37 ℃, the initial air flow is 2L/min, the Dissolved Oxygen (DO) is maintained above 20 percent, and the pH value is about 7.0. When the OD value of the bacterial liquid reaches about 6.5, cooling to 28 ℃; induction was carried out for 4h with the addition of 0.5mM IPTG.

3) Detection of expression of MG53S189A protein Using SDS Polyacrylamide gel (SDS PAGE) electrophoresis

Preparation of SDS-PAGE loaded samples:

and taking the bacterial liquid before induction, taking the

bacterial liquid

2h and 4h after induction, and performing centrifugal separation to obtain bacterial precipitates. Resuspending the cells in 20-40. mu.l PBS (pH 8.0), adding an equal volume of 2 XSDS loading buffer, boiling and heating for 5 min;

performing SDS polyacrylamide gel (SDS-PAGE) electrophoresis separation;

the results were visualized by destaining after 3 hours of staining with Coomassie Brilliant blue. The results are shown in FIG. 5. SDS-PAGE showed that the MG53S189A protein was expressed at a high level in 5L fermentation volume, and was expressed to a high degree in both the bacterial supernatant and bacterial cells (inclusion bodies) after expression induction.

2.2 purification of MG53 mutant MG53S189A protein

From the above, MG53 mutant protein was expressed to a high degree in both bacterial supernatant and bacterial cells after induction of expression. However, in both the supernatant and the bacterial cells, there were many contaminating proteins in addition to the MG53 mutant protein. Therefore, purification of the expressed MG53 mutant protein is required for subsequent functional studies.

2.21 purification of MG53S189A protein by DEAE column chromatography

The supernatant of the bacteria containing MG53S189A protein after induction of expression was first purified by DEAE column chromatography. The crude purification was performed by DEAE column chromatography using GE AKTA PURE 150M full-automatic chromatography system to collect MG53S189A protein.

Reagents and apparatus used in DEAE column chromatography:

a chromatographic column: volume 50ml (Pre-filled column 26X 20cm)

Chromatography buffer:

binding liquid A: 20mM Tris, pH8.0

Eluent B: 20mM Tris +1.0M NaCl, pH8.0

The DEAE column chromatography purification was performed by the following steps:

preparing a sample:

M53S 189A cells 189g after the above-mentioned induction expression was taken out and mixed in 1900ml of the binding solution A. Adding the binding solution A370ml into each cup, centrifuging at 8 deg.C and 10000rpm for 15min, centrifuging for 5 times, and collecting supernatant to prepare sample;

DEAE column chromatography:

the sample is filtered by a 0.45um filter membrane and then loaded, and the loading flow rate is 2 ml/min. Eluting with 5% (volume ratio) solution of eluent B in mixture of A and B and eluent B to obtain 380ml and 190ml of solution pH8.0 with 5% (volume ratio) eluent B in mixture of A and B;

SDS-PAGE

the elution peak obtained by DEAE column chromatography was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) as described above to identify the purity of M53S 189A protein after DEAE column chromatography.

As shown in FIG. 6, most of the impurity proteins were removed by DEAE column chromatography, and the obtained MG53S189A protein was 80% pure.

2.22 purification of MG53S189A protein by CM column chromatography

To further increase the purity of MG53 mutant protein, the main elution peak obtained by DEAE column chromatography purification (elution peak obtained by eluting 5% (volume ratio) of eluent B in a mixture of a and B, ph 8.0) was subjected to CM column chromatography.

Reagents and apparatus used in CM column chromatography:

a chromatographic column: volume 25ml (Pre-filled column 26X 20cm)

Chromatography buffer:

binding liquid A: 20mM PB, pH6.0

Eluent B: 20mM PB +1.0M NaCl, pH6.0

CM column chromatography purification was performed by:

CM column chromatography:

the elution peaks of a 5% (volume ratio) solution containing eluent B in a mixture of A and B and pH8.0 obtained in DEAE column chromatography purification were combined and then subjected to loading and/or elution at a flow rate of 8 ml/min. Washing with 10% eluent B in the mixture of A and B, eluting with 10% -30% gradient eluent B in the mixture of A and B for a total of 300ml for 6 column volumes (6CV), and eluting with eluent B. The volumes of the elution peak A, B obtained by eluting with a 20% (volume by volume) solution of eluent B in a mixture of A and B were 42ml and 51ml, respectively.

SDS-PAGE

The eluted peak obtained by CM column chromatography was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) as described above to identify the purity of M53S 189A protein after CM column chromatography.

As shown in fig. 7, the purity of MG53S189A protein was further improved by further purification through CM column chromatography, which could reach 85% purity. The MG53S189A protein purified by DEAE column chromatography and CM column chromatography can be used for preparing dry powder preparation and/or spray preparation and/or gel preparation, and can also be used for preparing pharmaceutical composition for preventing and/or treating diseases caused by cardiac ischemia/reperfusion injury, or pharmaceutical composition for preventing and/or treating ulcer related diseases.

2.23 purification of MG53S189A protein by SOURCE 30Q column

In order to further improve the purity of the MG53 mutant protein, the elution peak obtained by CM column chromatography (the elution peak obtained by eluting a solution with 20% (volume ratio) of eluent B in a mixture of A and B) is subjected to Source 30Q column chromatography purification.

Reagents and apparatus used in SOURCE 30Q column:

a chromatographic column: volume 5ml

Chromatography buffer:

binding liquid A: 20mM Tris, pH 8.5

Eluent B: 20mM Tris +1.0M NaCl, pH 8.5

SOURCE 30Q column chromatography purification was performed by the following steps:

SOURCE 30Q column:

the volumes of the elution peak A, B obtained in the CM column chromatography purification by eluting with a solution containing 20% (by volume) of the eluent B in the mixture of A and B were combined and then subjected to loading and/or elution at a flow rate of 4 ml/min. And (4) rinsing with the solution B. The volumes of the elution peak A, B obtained by elution with eluent B were 42ml and 47ml, respectively.

SDS-PAGE

The eluted peak obtained from the SOURCE 30Q column was subjected to SDS polyacrylamide gel (SDS-PAGE) electrophoresis as described above to identify the purity of the M53S 189A protein obtained after SOURCE 30Q column chromatography.

As shown in fig. 8, the purity of MG53S189A protein was further improved by further purification using SOURCE 30Q column, and the purity was more than 95%. The MG53S189A protein purified by DEAE column chromatography, CM column chromatography and SOURCE 30Q column can be used for preparing dry powder preparation and/or spray preparation and/or gel preparation, and can also be used for preparing pharmaceutical composition for preventing and/or treating diseases caused by cardiac ischemia/reperfusion injury, or pharmaceutical composition for preventing and/or treating ulcer related diseases.

2.24 sequencing validation of the amino acid sequence of the purified MG53S189A protein

By the purification method, MG53S189A protein with a purity of 95% or higher can be obtained. We verified by sequencing whether the amino acid sequence of the purified MG53S189A protein was correct.

The N-terminal sequence of the MG53S189A protein was determined by Edman method and was as follows:

MSAAPGLLHQELSCPLCLQLFDAPVTAECGHSFCRACLGRVAGEPAADGTVLCPCCQAPTRPQALSTNLQLARLVEGLAQVPQGHCEEHLDPLSIYCEQDRALVCGVCASLGSHRGHRLLPAAEAHARLKTQLPQQKLQLQEACMRKEKSVAVLEHQLVEVEETVRQFRGAVGEQLGKMRVFLAALEGALDREAERVRGEAGVALRRELGSLNSYLEQLRQMEKVLEEVADKPQTEFLMKYCLVTSRLQKILAESPPPARLDIQLPIISDDFKFQVWRKMFRALMPALEELTFDPSSAHPSLVVSSSGRRVECSEQKAPPAGEDPRQFDKAVAVVAHQQLSEGEHYWEVDVGDKPRWALGVIAAEAPRRGRLHAVPSQGLWLLGLREGKILEAHVEAKEPRALRSPERRPTRIGLYLSFGDGVLSFYDASDADALVPLFAFHERLPRPVYPFFDVCWHDKGKNAQPLLLVGPEGAEA*

the sequencing result proves that the obtained protein is recombinant MG53S189A protein.

The MG53S189A protein is proved to meet the national quality standard of protein for injection by detecting a heat source substance and measuring the biological activity.

Example 3 preparation of Dry powder formulation of MG53S189A protein

3.1 preparation of dry powder formulation excipients for MG53S189A protein using mannitol, histidine, sucrose, etc.: mannitol, histidine, sucrose, and the like.

The preparation method comprises the following steps:

dissolving adjuvants, mixing the dissolved adjuvants with corresponding MG53S189A protein stock solution, and adjusting pH to 6.5 to obtain solution containing 0.5MG/ml MG53S189A protein, 50MG/ml mannitol, 25MG/ml sucrose, and 25MG/ml histidine. Filtering the obtained solution for sterilization, and freeze-drying under the following freeze-drying conditions to obtain a freeze-dried preparation, wherein the split charging specification is determined according to the requirement.

Freeze-drying conditions:

1) pre-freezing to-45 deg.C, holding for 2 hr, pre-vacuumizing to 12 + -2 Pa,

2) heating to-6 ℃ for 90 minutes, keeping the temperature for 10 hours,

3) heating to 15 ℃ for 1 hour, keeping for 5 hours,

4) further drying to obtain the freeze-dried product.

3.2 preparation of Dry powder formulation of MG53S189A protein Using mannitol, sucrose, Tween-80, etc

In addition, other auxiliary materials such as mannitol, sucrose, Tween-80 and the like are used to obtain a dry powder preparation of MG53S189A protein with better stability.

Auxiliary materials: mannitol, sucrose, Tween-80, and the like.

The preparation method comprises the following steps:

2g of sucrose, 6g of mannitol and 10MG of Tween-80 are added into 200ml of 2MG/ml MG53S189A protein stock solution, and after thorough mixing, the pH value is adjusted to 7.4. Filtering for sterilization, and freeze-drying under the following freeze-drying conditions to obtain a freeze-dried preparation, and determining the packaging specification according to the requirement.

And (3) freeze drying conditions:

1. pre-freezing to-45 deg.C, holding for 2 hr, pre-vacuumizing to 12 + -2 Pa,

2. heating to-6 ℃ for 90 minutes, keeping the temperature for 10 hours,

3. heating to 15 ℃ for 1 hour, keeping for 5 hours,

4. further drying to obtain the freeze-dried product.

3.3 comparison of stability of different adjuvant formulations

To compare the effect of different adjuvant formulations on the resolubility of the resulting MG53S189A protein dry powder formulation, we performed the following experiments. The instrument equipment comprises: freeze-drying tester, 10ml bottle, stopper, lid, balance test procedure: samples were prepared at 4 ml/bottle, 8 adjuvant formulations, 8 bottles.

The MG53S189A protein was lyophilized according to the method of 3.2 using the following respective adjuvant formulations.

Formula 1: contains only sucrose 0.5% and 20mg

And (2) formula: contains only sucrose 1% and 40mg

And (3) formula: contains mannitol 0.5% and 20mg

And (4) formula: contains only mannitol 1% and 40mg

And (5) formula: contains only mannitol 0.25% and 10mg

And (6) formula: contains Tween-800.005% 0.2mg, sucrose 1% 40mg, and mannitol 3% 120mg

And (3) formula 7: only containing 1% of sucrose and 40mg of sucrose, but no sample is added

And (4) formula 8: only contains 1 percent of mannitol and 40mg, but does not load sample

Thereafter, the obtained lyophilized preparation was dissolved by adding physiological saline. After filtration and shaking, flocculent and needle-like substances are separated out in formulas 1-5, and a clear solution is obtained in formula 6. This experiment demonstrates that lyophilized formulation of MG53S189A protein prepared using adjuvant formulation 6 has optimal reconstitution and stability.

Example 4 preparation of a spray formulation for MG53S189A protein

Dissolving dry powder preparation of MG53S189A protein with physiological saline or solvent commonly used in medicine. The concentration of the dissolved MG53S189A protein is 50ng-100 ug/ml, and the dissolved MG53S189 protein can be filled into a sprayer meeting the requirement and can be sprayed for use.

Example 5 preparation of gel formulation of MG53S189A protein

5.1 preparation of gel preparation of MG53S189A protein Using polyoxyethylene-polyoxypropylene Block copolymer

The gel chaperone of dry powder preparation of MG53S189A protein is prepared by utilizing the characteristics of polyoxyethylene-polyoxypropylene block copolymer (Pluronic) which is in liquid state at low temperature and is condensed into gel at body temperature.

A gel formulation of MG53S189A protein was prepared by the following steps:

1. preparing MG53S189A protein into dry powder preparation

2. Dissolving the dry powder preparation of MG53S189A protein with polyoxyethylene-polyoxypropylene block copolymer stored at low temperature, preferably 4-8 deg.C, and making into gel solvent of MG53S189A protein.

When in use, the gel solvent is sucked out by the syringe and is applied to the affected part, the gel is formed to cover the affected part under the action of body temperature, and MG53S189A is released to generate a therapeutic effect.

The preparation method of the gel chaperone and MG53S189A protein dry powder preparation is the same as the preparation method of the dry powder preparation dissolved in physiological saline in the spray preparation.

5.2 gel solvent for preparing MG53S189A protein Using carbomer, Glycerol and Chitosan solution

Then, the formula of the gel solvent is optimized to obtain a gel preparation of MG53S189A protein with better performance.

The preparation method comprises the following steps:

1. adding 50g water swelling 0.5g carbomer 934, adjusting pH to 7.0 with 10% NaOH,

2. adding 10g of glycerol, and uniformly mixing to obtain a gel matrix;

3. dissolving 1.83g (equivalent to 60MG of MG53S189A protein) of the lyophilized preparation of MG53S189A protein and 0.12g of ethylparaben in 5ml of 2% chitosan solution under stirring, adding into the gel matrix, and mixing to obtain the gel preparation of MG53S189A protein.

Example 6 preparation of hydro-acupuncture formulation of MG53S189A protein

We also prepared a hydro-acupuncture formulation of MG53S189A protein.

The reagents used in the preparation were as follows:

MG53S189A protein 1g

2000ml of water for injection

Make 1000 pieces

The preparation method comprises the following steps:

1. under clean conditions, 1g of MG53S189A protein is dissolved completely by using a proper amount of water for injection,

2. treating with small amount of active carbon, filtering, adding water for injection to 2000ml, adjusting pH,

3. fine filtering, filling, sealing and sterilizing to prepare the powder with the specification of 2 ml: 2MG of MG53S189A small volume hydro-acupuncture formulation.

Example 7 preparation of MG53S189A protein emulsion

We also prepared MG53S189A protein emulsion.

The preparation method comprises the following steps:

1. heating 15g of stearic acid, 8.5g of glyceryl monostearate and 10g of white vaseline to 80 ℃ in a water bath, and uniformly mixing to obtain an oil phase;

2. heating 3g of Tween-80, 7.5g of glycerol and 90g of water to 80 ℃ respectively to obtain an aqueous phase;

3. slowly adding the oil phase into the water phase while stirring, and condensing to obtain emulsion matrix (pH 6.9);

4. 1.125g of lyophilized powder (equivalent to 36MG of MG53S189A protein) was dissolved in 5ml of 2% chitosan solution, and 30g of emulsion base and 5g of glycerol were added and mixed uniformly to obtain MG53S189A protein emulsion.

Example 8 repair of cell membranes of mechanically damaged 293T cells by MG53S189A protein

The experimental principle is as follows: a proper amount of glass beads are added into cells cultured in vitro, and the glass beads can cause physical damage to cell membranes of the cells and release intracellular Lactate Dehydrogenase (LDH) when the glass beads are shaken on a shaking table. MG53 can repair cell membranes. Therefore, the cell membrane repair function of the MG53 mutant MG53S189A protein can be judged according to the LDH release level.

Experimental materials: glass beads (400 mesh); 293T cells; LDH kit (TaKaRa-MK 401); a DPBS; DMEM medium; pancreatin; a 96-well plate; a plate centrifuge; pipette gun (100. mu.L, 1000. mu.L); gun discharge (100. mu.l); an enzyme-labeling instrument; shaking table.

Experimental methods

1)293T cells were cultured for 30 h.

2) Laying 96 pore plate

a. The experimental groups were loaded with 30. mu.l glass bead-containing DPBS and 20. mu.l serial dilution gradient of MG53 or MG53S189A protein solutions per well, with the concentration of the protein serial dilution gradient being 200ug/ml, 100ug/ml, 50ug/ml, 25ug/ml, 12.5ug/ml, 6.75 ug/ml;

b. background groups 30. mu.l of DPBS and 20. mu.l of serial dilution gradients of 200ug/ml, 100ug/ml, 50ug/ml, 25ug/ml, 12.5ug/ml, 6.75ug/ml of MG53 or MG53S189A protein solution were added per well.

c. 293T cells were digested and counted (density 1.2-1.5 x 10)⁶Cells/ml) 50. mu.l of cell suspension was added per well.

3) The 96-well plate was placed on a shaker at 120rpm for 15 minutes at room temperature.

4) Centrifugation was carried out at 4400rpm for 5 minutes immediately after shaking.

5) After centrifugation, 50. mu.l of the supernatant was transferred to a new 96-well plate;

6) LDH reagents were configured according to LDH kit instructions, with 50 μ l LDH reagent added per well.

7) Centrifuge at 4400rpm for 1 minute at room temperature (debubble to avoid affecting the readings).

8) The reaction was carried out for 15min in the absence of light, and the OD value was measured using a microplate reader at 490 nm.

The results are shown in FIG. 9. These results demonstrate that the LDH activity of the MG53 standard and MG53S189A is not significantly different when different concentrations of the standard and MG53S189A protein are added to 293T cells in the logarithmic growth phase. Therefore, MG53S189A has a cell membrane repair effect on mechanical damage of 293T cells comparable to MG 53.

Example 9 protective Effect of MG53S189A protein on myocardial ischemia reperfusion injury in rats

1. Medicine preparation: MG53S189A, 2 MG/bottle, lyophilized powder, stored in refrigerator at 4 deg.C.

2. Grouping and administration

Animals were divided into sham-operated group (NS 1 ml/animal) and model group. Animals administered intravenously at different times with MG53S189A were divided into 3 subgroups, i.e., MG53S189A protein 1 group (pre-ischemia 30min administration group), MG53S189A protein 2 group (pre-reperfusion 30min administration group), MG53S189A protein 3 group (post-reperfusion 1 hr administration group), and 6 animals per group.

Animals used were: SD rats, Sprague Dawley) outcrossing group rats. SD rats were albino closed group rats bred by crossing heterozygous male rats and Wistar female rats from r.w. Dawley farm in the united states.

3. Experimental methods

Acute myocardial injury models were prepared by ligating the left anterior descending coronary artery (LAD) from male SD rats (220-260g), each rat being anesthetized by intraperitoneal injection of chloral hydrate. The body temperature was monitored rectally and maintained at 37 ℃ in rats using heat-regulated paw pads. Following thoracotomy, the left coronary artery was ligated with 6-0 silk thread for 45 minutes to cause myocardial ischemia, and then opened for reperfusion. The thorax was closed and the rats were allowed to regain consciousness. After 24 hours, the chest was opened again along the previous incision, the left coronary artery was ligated again at the same site, the heart was cut off, the aorta was cannulated, 3ml of 1% Evans blue solution was slowly injected into the aorta, the right atrium and right ventricle were removed, and the left ventricle was cut into 5 slices each 2mm thick from the apical coronary section. The evans blue stained area was considered to be a non-ischemic area, and the area not stained with evans blue was considered to be a risk area (AAR). The myocardium was photographed on both sides after evans blue staining with a digital camera. After photographing, the heart is placed in 1.5% TTC solution, incubated at 37 ℃ for 8-10 min, and the area of the viable cardiomyocytes in the AAR is stained (after TTC staining, the area of infarction is grey white, while the viable myocardium is red). Both sides of each myocardial section were photographed again with a digital camera and analyzed using the Motic images advanced 3.2Image software. The protective effect of MG53S189A protein on myocardial ischemia/reperfusion injury in rats administered 30 minutes before ischemia, 15 minutes before reperfusion, and 1 hour after reperfusion was evaluated by calculating infarct area, AAR, percent non-ischemic left ventricle.

Before ischemia, serum was collected 6h and 24h after reperfusion, and the level of Lactate Dehydrogenase (LDH) in serum was measured.

4. Results of the experiment

As shown in table 2 below, the infarct area (%) of the model group was substantially similar to the area (%) of the risk zone, while the infarct area (%) of the MG53S189A B30min, L45min, and R60min groups was significantly smaller than the area (%) of the risk zone of the corresponding group, wherein the infarct area (%) of the B30min and L45min groups was significantly lower than that of the model control group (p <0.01, p < 0.05).

TABLE 2 Effect of MG53S189A on myocardial ischemia-reperfusion injury

Note: b30min represents administration 30min before ischemia

L45min represents 45min administration prior to perfusion

R60min represents 60min post-reperfusion administration

The experimental data show that similar to the MG53, the MG53S189A protein can reduce the area of myocardial ischemia infarct area, and has obvious effect of protecting myocardial ischemia reperfusion injury when being applied before myocardial ischemia or reperfusion.

Example 10MG 53S189A protein reduces the phosphorylation level of AKT

Previous studies found that MG53 protects the heart and is associated with side effects such as insulin resistance, obesity, diabetes and metabolic syndrome. Insulin is mainly involved in sugar and fat metabolism through a phosphoinositide 3 kinase (PI3K) pathway, and AKT is in a central link of a PI3K pathway, so that the Ser phosphorylation level of the AKT can be used as a key marker for detecting whether to metabolize sugar and resist insulin. To examine whether MG53S189A will also be similar to MG53, and while protecting heart, will also cause side effects such as insulin resistance, obesity, diabetes, and metabolic syndrome, we examined the effect of MG53S189A on Ser phosphorylation levels of AKT by western blotting.

Each animal in 30 jugular vein cannulated SD rats was given a random number using Excel software using random grouping, and the animals were divided into 6 groups in order of random number from small to large. The first three groups are groups without insulin injection, and the last three groups are groups with insulin injected in the abdominal cavity 10min after the last administration. The first and last groups were divided into control group (BSA), MG53S189A (S189A) protein group, and MG53 wild type group (WT), respectively. The concentration of the administered protein was 0.01mg/mL, the dose was 0.037mg/kg, and the volume was 3.7 mL/kg. After the experiment, animal heart tissues were subjected to western blotting to detect the level of P-AKT S473 phosphorylation (P-AKT S473). The p-Akt antibody is from Cell Signaling technology.

The results of the experiment are shown in fig. 10. These results show that in rats not injected with insulin (lanes 1-3), no increase in the phosphorylation level of AKT S473 is shown. MG53S189A (lane 5) resulted in a significant reduction in the level of phosphorylation of AKT S473 after insulin injection compared to wild-type MG53 (lane 6) and BSA (lane 4), demonstrating that MG53S189A significantly reduced the side effects of insulin resistance while protecting the heart compared to MG 53.

Example 11 MG53S189A protein did not cause blood glucose elevation in rats

Previous researches show that MG53 has side effects of insulin resistance, obesity, diabetes and metabolic syndrome while protecting heart. Meanwhile, we also performed a blood glucose exploration experiment in which MG53S189A protein was intravenously injected into SD rats to evaluate whether the blood glucose elevation level caused by MG53S189A protein reached the pathological standard.

And (3) testing the sample:

name: MG53S189A protein

Batch number: 2014-5-16

Packaging: penicillin bottle

Specification: 2.0 mg/bottle

The characteristics are as follows: white freeze-dried powder

Storage conditions are as follows: and drying at the temperature of 2-8 ℃.

Reference substance

Name: bovine serum albumin

Batch number: 201421

Specification: 20.5 mg/bottle

The characteristics are as follows: white freeze-dried powder

Storage conditions are as follows: -20 ℃ C

Solvent 1

Name: sodium chloride injection (physiological saline)

Production unit: shandonghua pharmaceutical Co Ltd

Batch number: d13102301

Concentration: 0.9 percent

Specification: 100mL, 0.9g, 100 mL/bottle

The characteristics are as follows: colorless clear liquid, slightly salty taste.

Storage conditions are as follows: sealed preservation

Solvent 2

Name: hydrochloric acid

Production unit: beijing chemical plant

Batch number: 20140311

Concentration: 36 to 38 percent

Specification: 100mL, 0.9g, 100 mL/bottle

The characteristics are as follows: colorless clear liquid

Storage conditions are as follows: sealed preservation at room temperature

Bovine insulin

Name: bovine insulin

Batch number: i5500

Production unit: SIGMA

Specification: 25 mg/bottle

The characteristics are as follows: white or beige powder

Storage conditions are as follows: -20 ℃ C

Solution preparation and analysis

MG53S189A protein solution: the dry powder of MG53S189A protein is put to room temperature, 2.0mL of physiological saline is sucked by a syringe and directly injected into a penicillin bottle (without opening a bottle stopper), and the mixture is gently swirled to be completely dissolved. Finally, a 1MG/mL MG53S189A protein solution was prepared, and after the preparation, the solution was filtered through a 0.22 μm filter.

Bovine serum albumin solution control: taking out the bovine serum albumin dry powder, placing the bovine serum albumin dry powder to room temperature, sucking a proper amount of sodium chloride injection by using a disposable syringe, and directly injecting the sodium chloride injection into a penicillin bottle (without opening a bottle stopper). Mix gently by vortexing so that the bovine serum albumin is completely dissolved in the sodium chloride injection. After dissolution, the solution was diluted with sodium chloride injection to a bovine serum albumin solution with a concentration of 1mg/mL, and after preparation, the solution was filtered through a 0.22 μm filter.

Insulin: firstly, diluting hydrochloric acid with ultrapure water to pH 2-3, and filtering with a 0.22 μm filter membrane. And then diluting the insulin dry powder which is placed at room temperature to 2mg/mL by using sterile dilute hydrochloric acid with the pH value of 2-3. A portion of 2mg/mL insulin solution was diluted to 0.01mg/mL (sterile prepared) with sodium chloride injection. The remaining 2mg/mL insulin solution was stored at-20 ℃ until use.

Preparing a solution for preservation and disposal: MG53S189A protein solution and bovine serum albumin solution control were stored and transported at 2-8 deg.C or in ice box before administration. The MG53S189A protein solution, control and insulin remaining after the end of administration were disposed of as medical waste.

An experimental system:

laboratory animal

Species & strain: jugular vein intubation SD rat and normal SD rat

Grade: SPF stage

The experimental animal source is as follows: beijing Wittiulihua laboratory animal technology Co Ltd

Planned administration start week age: 6-8 weeks old

Number and sex of animals: it is expected that 17, males are purchased from the order of jugular vein cannulated SD rats and 15, males are used in the trial. Normal SD rats were expected to be ordered as 17, males and 15, males were used in the trial.

And (3) treating redundant animals: purchased unused animals were transferred to veterinary unified treatment within 2 days after administration.

Reason for selection

Reasons for experimental animal selection: there are no other known alternatives to live animal experiments for this assay; the SD rat selected for the test is a standard animal model which is currently recognized as a drug used or to be used for human for toxicological research tests, has a large amount of background data, and is found to be a suitable animal model when the same or similar test samples are researched.

Reasons for animal number selection: on the premise of meeting the requirements of research purposes, scientific standards and regulations, as few animals as possible are used.

The main indications are: acute myocardial infarction

The administration route is as follows: intravenous injection

The clinical planned course of treatment: single administration

Animal grouping and dosing

A random grouping method is adopted, Excel software is used for distributing a random number to each animal in 15 jugular vein intubation SD rats, the animals are sorted from small to large according to the sequence of the random numbers, and the animals are divided into 2 groups (1-2 groups), and each group comprises 5 animals. In the same way, 15 normal SD rats were randomly divided into 3 groups (4-6 groups) of 5 animals each.

TABLE 3 animal number after dose and group administration for each group of animals

Note: indicates that the first administration dosage of 1-2 groups is 12mg/kg, and the second administration dosage is 6mg/kg after about 24 hours of the first administration.

^#The first application volume of the 1-2 groups was 12mL/kg, and the second application volume was 6mL/kg about 24 hours after the first application.

Administration of

The administration route is as follows: and (4) tail vein injection, and bolus injection at a speed of about 2-3 ml/min.

Dose and volume administered: according to the information of the table

The application method comprises the following steps: the amount administered is determined based on the animal's body weight prior to administration. Using a disposable sterile syringe with proper specification to suck the test substance or the reference substance, and injecting the test substance or the reference substance with corresponding dose into the tail vein of the animal.

Frequency and period of application: applying 1-3 components for 2 times at an interval of about 24 hours; 4-6 groups were administered in a single dose.

Insulin injection: after 10min after the last administration of all animals in 1-3 groups and 10min after the administration of all animals in 4-6 groups, insulin is injected into the abdominal cavity, the administration concentration is 0.01mg/mL, the administration dose is 0.037mg/kg, and the administration volume is 3.7 mL/kg.

Reasons for route of administration: according to the information provided by the entrusted unit and the related guiding principle, the tail vein injection is selected to be applied, and the application is close to the clinical planned application path.

Body weight

And (3) detecting animals: 1-6 groups of all animals

Detection time: after animals received, body weights were determined before grouping, before first administration. Animals were weighed before administration for calculation of the amount administered.

Fasting

All animals in 1-3 groups were fasted overnight before the first and last administration, and 1-3 groups were fasted within 2h after the first administration. Animals in groups 4-6 were fasted overnight before administration and before collection of hearts.

Blood glucose detection

And (3) detecting animals: 1-3 groups of all animals

Detection time: 0min (before first application), 15min, 30min, 1h, 2h, 8h and 24h after first application.

The determination method comprises the following steps: the test strip is inserted into the measuring port to ensure that the three contact strips face the operator and the test strip is pushed to the bottom, taking care that it cannot bend. At which time the instrument automatically turns on. Pressing a button A or T X to change the code displayed by the glucometer to match the code on the test paper bottle. Blood was taken through a jugular vein cannula. When the blood drop symbol flickers on the display screen, the test paper is aligned with the blood drop, so that the narrow channel at the top of the test paper almost touches the edge of the blood drop. After the channel lightly touches the edge of the blood drop, the blood will be sucked into the narrow channel. When the confirmation window becomes full and the blood glucose meter reading changes from 5 to 1, the blood glucose measurement will be displayed on the screen. The unit of blood glucose measurement, the date and time of measurement will also be displayed on the screen.

A detection instrument: the glucometer is an ONETOUCH Ultra Easy type glucometer produced by the Proteus corporation of America.

Blood glucose data for the animals tested are shown in Table 4

TABLE 4 blood glucose data of animals examined

Meanwhile, the obtained blood glucose data of the animals were analyzed, and the results are shown in fig. 11. Table 4 and fig. 11 show that there was no significant difference in blood glucose at each time point in the MG53S189A protein-injected animals relative to the bovine serum albumin control group. These data indicate that the MG53S189A protein effectively avoids side effects of MG53 such as insulin resistance, obesity, diabetes and metabolic syndrome while protecting the heart.

Example 12: MG53S189A protein promotes fibroblast proliferation at diabetic foot ulcer, and is beneficial to healing diabetic foot ulcer and leg ulcer

We investigated the role of MG53 mutant MG53S189A protein in ulcers, particularly chronic and peptic ulcers.

First, we investigated the role of MG53S189A protein in the treatment of diabetic ulcers using a fibroblast model at diabetic foot ulcers.

Materials and methods: single-layer diabetic foot ulcer fibroblasts in logarithmic growth phase were prepared into single-cell suspension in RPMI1640 medium containing 10% newborn calf serum. Then 2 x 10 per hole⁵Each cell was seeded in 96-well plates at 200ul per well volume. The experiment was divided into 5 groups, wherein the first group of blank control, the second group of negative control, and the 3 rd to 5 th groups were 0.1, 10, 100. mu.g/ml MG53S189A protein, respectively, and the substances in each group were added to the fibroblasts. Culturing for 7 days, setting two repeat holes in each group, measuring the light absorption value of each hole at 490nm, and taking the average value; and drawing a growth curve.

The test results are shown in fig. 12. From these results, the fibroblast cells added with MG53S189A protein showed the highest growth curve, and the growth was significantly enhanced as compared with the control and negative control. Therefore, the MG53S189A protein promotes the proliferation of fibroblasts of the diabetic foot ulcer, and is beneficial to the healing of the diabetic foot ulcer and the diabetic leg ulcer.

Example 13: MG53S189A protein promotes wound healing of diabetic foot ulcer of rat

We investigated the role of MG53S189A protein in the treatment of diabetic foot ulcers using the rat diabetic ulcer model.

Construction of diabetic ulcer model in rat

A rat diabetic ulcer model is constructed by a magnetic sheet cyclic compression method. Rats were first anesthetized with 2% sodium pentobarbital at 30mg/kg abdominal cavity, then were depilated, and the depilated area was sterilized with iodine and alcohol. Each rat was treated prophylactically by intramuscular injection of 8-10IU of penicillin prior to surgery, and then an incision was made at the anterior orthodox line of the rat back to the fascia, and a magnetic strip was placed under the skin of the rat's left or right forelimb, with the second incision being located at the midline of the posterior end of the back. The rats after magnetic sheet implantation were randomly divided into 5 groups, a blank control group, a sham model group, and a low-dose group, a medium-dose group and a high-dose group of MG53S189A protein. Transplanting the magnetic sheets in the endosome through the external magnetic sheet to attract each other to form pressure to cause ischemia on the skin surface area, taking down the external magnetic sheet after 2 hours of ischemia each time to recover the local blood flow for 30min, and performing a circulation. Each rat was subjected to 3 consecutive cycles daily for 4 consecutive days. The standard for judging ulcer is that the skin becomes black and hard, and the needle pricks do not bleed.

Administration of MG53S189A protein

The MG53S189A protein was administered as a dry powder of MG53S189A protein with a gel partner formulation. The low dose group (0.1MG/ml MG53S189A protein), the medium dose group (0.5MG/ml MG53S189A protein) and the high dose group (5MG/ml MG53S189A protein) are mixed uniformly by a syringe and applied to the ulcer parts. The medicine is applied once a day, the treatment course is 1 month, and the curative effect is evaluated after one month. Taking ulcer skin and control skin, fixing with 10% formaldehyde, embedding in paraffin, HE staining, and observing under optical microscope.

The results prove that the use of different dosages of MG53S189A protein can lead to the recovery of diabetic ulcer rats, and the effective rate is 100%. In all cases, the ulcers improved significantly within 1 week, and in 10 days to 1 month of administration, the ulcers healed substantially. These experiments demonstrate that MG53S189A protein promotes wound healing in diabetic foot ulcers.

Example 14: MG53S189A protein promotes wound healing of chronic gastric ulcer of rat

To investigate the role of MG53S189A protein in the treatment of other types of chronic ulcers, we investigated the role of MG53S189A protein in the treatment of chronic ulcers using the rat chronic ulcer model.

Construction of model of chronic gastric ulcer in rat

0.05ml of 20% acetic acid solution was aspirated by a micro-syringe, and the gastric mucosa was injected through the muscular layer through the anterior wall of the antrum. 3-4 days after injection, well-defined ulcers can form. The ulcer reaches the muscular layer, and is similar to human peptic ulcer, so that a rat chronic gastric ulcer model is constructed. The chronic gastric ulcer model rats are randomly divided into 5 groups, a blank control group, a pseudomodel group, a MG53S189A protein low dose group, a medium dose group and a high dose group.

Administration of MG53S189A protein

The chronic gastric ulcer model rats are randomly divided into 5 groups, namely a blank control group, a pseudomodel group, a low-dose group, a medium-dose group and a high-dose group of MG53S189A protein. Low (0.1MG/ml), medium (0.5MG/ml) and high (5MG/ml) doses of MG53S189A protein were infused into the corresponding groups of rat stomachs using a syringe. Gavage was performed 1 time per day for 2 months. The efficacy was evaluated after 2 months. The gastric mucosa of each group of rats was fixed with 10% formaldehyde, embedded in paraffin, HE stained, and observed under an optical microscope.

The results prove that the use of different doses of MG53S189A protein can lead to the recovery of rats with chronic gastric ulcer, and the effective rate is 100%. In all cases, ulcers were significantly better within 1 month, and in 45 days to 2 months after MG53S189A administration, chronic gastric ulcers substantially healed. These experiments demonstrate that MG53S189A protein promotes wound healing in chronic gastric ulcers.

Example 15: MG53S189A protein promotes wound healing of diabetic foot ulcer and gangrene of human

We investigated the role of MG53S189A protein in the treatment of human chronic ulcers, such as diabetic foot and leg ulcers.

Diagnostic criteria for diabetic foot

The diagnostic criteria for diabetic foot were classified as 0-V in total according to the international wagner classification and the classification criteria established by the first national academy of diabetic foot of the Chinese medical society in 1995. Level 0: inadequate blood supply to the extremities; stage I: the skin has open lesions; II stage: the infected lesion has invaded deep muscle tissue; grade III: destruction of tendon ligaments; stage IV: bone defect; and V stage: most or all-foot gangrene, and even the accumulation of ankle joints and lower legs.

Patient condition

10 patients were all those who were ineffectual by the conventional dressing change method and were ineffectual or allergic by the use of epidermal growth factor. 5 cases for men and 5 cases for women; age 75 years maximum, 40 years minimum; the longest history of diabetes is 30 years, and the shortest history of diabetes is 5 years, which are type 2 diabetes. Diagnosis of graded cases: stage I3, stage II 5 and stage III 2.

Administration of MG53S189A protein

For local treatment, patients with infection focus and ulcerated gangrene are debrided by surgery to remove ulcerated gangrene, then 1MG/ml MG53S189A gel preparation is evenly smeared on the wound surface, or freeze-dried preparation can be used according to the same dosage, then sterile gauze is covered, and the gel preparation is applied once a day, one month is a treatment course, and the curative effect is evaluated in one month.

Criteria for therapeutic effect

The effect is shown: the fester wound is improved and healed in 7-15 days;

the method has the following advantages: the wound is improved and healed in 10-20 days;

and (4) invalidation: the disease condition is not improved within 30 days of treatment, but continuously aggravates and worsens or the local wound is not changed for more than 15 days.

The results are shown in fig. 13. These experiments show that foot gangrene of all cases is improved after the MG53S198A protein gel preparation is used, the effective rate is 100%, and the obvious effective rate is 95%. Grade III, case 2, in which multiple treatments were not effective, the wound healed more than 90% 1 month after administration of MG53S189A protein. In all cases, the small wound surface heals obviously within 1 week, the large wound surface improves, and after the application for about 14 days, the seepage and ulceration of the large wound surface disappear, and fresh granuloma is formed gradually. And after the MG53S189A protein gel preparation is used, the patient has no obvious adverse reaction and has good tolerance.

From the above, it is known that the MG53S189A protein can effectively treat diabetic foot ulcer and gangrene without any side effect.

The etiology of diabetic foot gangrene is complex and can be caused by malnutrition, atherosclerosis and trauma. Although diabetic vasculopathy is extensive, the pathological development is slow, the formulation of the diabetic vasculopathy is beneficial to collateral circulation, and if the diabetic vasculopathy can be actively treated in the early stage of the formation of the gangrene, the regeneration of blood vessels and epidermal cells is promoted, and the gangrene can be effectively relieved or cured. The existing local medicines, such as gentamicin, can inhibit local bacterial growth, but can not promote wound healing well, and the traditional Chinese medicine has long granulation promoting period and poor effect. Although the epidermal growth factor has certain effect, the clinical expression of the epidermal growth factor is still ineffective when the epidermal growth factor is used by a plurality of patients.

The MG53S189A protein is a self-secreted protein in a human body, specifically exists in skeletal muscle and cardiac muscle, has a strong cell repair function, can ensure sterility, is used for local application, is safe, takes effect quickly, is convenient to use, and is the best choice for treating diabetic foot ulcer and gangrene at present.

Reference documents:

1.S.Matthaei，M.Stumvoll，M.Kellerer，H.U.Haring，Endocr Rev 21，585(Dec，2000).

2.C.M.Taniguchi，B.Emanuelli，C.R.Kahn，Nat Rev Mol Cell Biol 7，85(Feb，2006).

3.X.J.Sun et al.，Nature 352，73(Jul 4，1991).

4.A.R.Saltiel，C.R.Kahn，Nature 414，799(Dec 13，2001).

5.C.X.Cai et al.，Nature Cell Biology 11，56(Jan，2009).

specifically, the present invention relates to the following aspects:

a mitsugumin53 (MG53) mutant, characterized in that the serine site in the ceiling-coil domain of MG53 is mutated to an amino acid other than threonine and tyrosine.

2. The MG53 mutant of item 1, wherein the serine is mutated to a non-polar amino acid.

3. The MG53 mutant of item 2, wherein the nonpolar amino acid is alanine, glycine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, or methionine.

4. The MG53 mutant of item 3, wherein the nonpolar amino acid is alanine and the MG53 mutant is any one or more selected from MG53S150A, MG53S189A and MG53S 211A.

5. A method of making a MG53 mutant of one of items 1-4, comprising the steps of:

(1) mutating wild MG53 to obtain MG53 mutant, and cloning into plasmid;

(2) expressing the MG53 mutant plasmid in a cell;

6. The method of item 5, wherein the mutating is site-directed mutagenesis of the full-length sequence of wild-type MG53 plasmid using a site-directed mutagenesis kit to give the MG53 mutant plasmid.

7. The method of clause 6, wherein the wild-type MG53 is codon optimized.

8. The method of item 6, wherein in the DEAE column chromatography, the binding solution A is 20mM Tris, pH8.0, the eluent B is 20mM Tris and 1.0M NaCl, pH8.0, optionally eluted with a 5% (volume ratio) solution of eluent B in a mixture of A and B and/or eluent B.

9. The method of item 6, wherein in the CM column chromatography, binding solution a is 20mM PB, pH6.0, eluent B is 20mM PB and 1.0M NaCl, pH6.0, optionally eluting with a solution of eluent B at 10% (volume ratio) in a mixture of a and B and/or a gradient of eluent B between 10% and 30% (volume ratio) in a mixture of a and B and/or eluent B.

10. The method of item 6, wherein in the Source 30Q column chromatography, binding solution A is 20mM Tris, pH 8.5, eluent B is 20mM Tris and 1.0M NaCl, pH 8.5, optionally eluting with eluent B.

11. A pharmaceutical composition comprising a MG53 mutant of one of items 1-4.

12. The pharmaceutical composition of item 11, further comprising a pharmaceutically acceptable excipient or carrier.

13. Use of a MG53 mutant according to one of items 1 to 4 for the preparation of a pharmaceutical composition for the prevention and/or treatment of a disease associated with cell membrane damage.

14. The use of item 13, wherein the disease associated with cell membrane damage comprises one or more selected from the group consisting of: diseases associated with myocardial cell injury, diseases associated with ulcers, trauma with wounds, particularly refractory wounds, intestinal leaks, and kidney injury.

15. The use of item 14, wherein the disease associated with myocardial cell injury comprises one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture.

16. The use of item 14, wherein the ulcer-related disease comprises one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.

17. A dry powder formulation comprising MG53 or an MG53 mutant of one of items 1-4.

18. A method of making a dry powder formulation comprising MG53 or an MG53 mutant of one of items 1-4, comprising the steps of:

(1) dissolving adjuvants, mixing with MG53 or MG53 mutant solution of one of items 1-4, and adjusting pH to 6.5-8.0 to obtain protein solution containing 0.1-2.0 MG/ml;

(2) a dry powder formulation was obtained by filter sterilization and freeze drying the MG53 or MG53 mutant solution comprising 0.5-2MG/ml of one of items 1-4 under suitable freeze drying conditions.

19. The method according to item 18, wherein the excipient comprises one or more selected from the group consisting of: polyols, saccharides, surfactants and polymers.

20. The method according to item 19, wherein the polyol comprises one or more selected from the group consisting of: glycerol, mannitol, sorbitol, inositol and polyethylene glycol, the saccharide comprising one or more selected from the group consisting of: sucrose, glucose, lactose, trehalose, mannose and maltose, the surfactant comprising one or more selected from the group consisting of: tween80, sodium lauryl sulfate, and/or the polymer comprises one or more selected from the group consisting of: polyethylene glycol, polyvinyl pyrrolidone.

21. The method of item 20, wherein the adjuvant is sucrose, mannitol, and histidine.

22. The method of item 20, wherein the excipient is sucrose, mannitol, and Tween-80.

23. The method according to item 18, wherein the suitable freeze-drying conditions are:

(1) pre-freezing to-45 deg.C, holding for 2 hr, pre-vacuumizing to 12 + -2 Pa,

(2) heating to-6 ℃ for 90 minutes, keeping the temperature for 10 hours,

(3) heating to 15 ℃ for 1 hour, holding for 5 hours, and

(4) and (5) further drying.

24. A hydro-acupuncture formulation comprising MG53 or an MG53 mutant of one of items 1-4.

25. A method of making a hydro-acupuncture formulation comprising MG53 or a MG53 mutant of one of items 1-4, comprising the steps of:

(1) dissolving lyophilized MG53 or an MG53 mutant of one of items 1-4 in a solvent,

(2) adjusting the pH value, filtering,

(3) sealing and sterilizing to produce a hydro-acupuncture formulation comprising MG53 or an MG53 mutant of one of items 1-4.

26. The method of item 25, wherein the solvent is a solvent commonly used in medicine, preferably water or physiological saline.

27. A spray formulation comprising MG53 or an MG53 mutant of one of items 1-4.

28. A method of making a spray formulation comprising MG53 or a MG53 mutant of one of items 1-4, comprising the steps of:

(1) lyophilized MG53 or an MG53 mutant of one of items 1-4,

(2) dissolving the lyophilized MG53 or the MG53 mutant of one of items 1-4 with a solvent to formulate a spray formulation comprising 50ng-100 μ g/ml MG53 or the MG53 mutant of one of items 1-4.

29. The method of item 28, wherein the solvent is a solvent commonly used in medicine, preferably water or physiological saline.

30. A gel formulation comprising MG53 or an MG53 mutant of one of items 1-4.

31. A method of preparing a gel formulation comprising MG53 or a MG53 mutant of one of items 1-4, comprising the steps of:

(1) lyophilized MG53 or an MG53 mutant of one of items 1-4,

(2) dissolving the lyophilized MG53 or MG53 mutant of one of items 1-4 in a solvent to formulate a gel solvent.

32. The method of item 31, wherein the solvent is a polyoxyethylene-polyoxypropylene block copolymer or a mixture of carbomer, glycerol, chitosan.

33. The method of item 32, wherein the polyoxyethylene-polyoxypropylene block copolymer is a polyoxyethylene-polyoxypropylene block copolymer stored at low temperatures, e.g., 4-8 ℃.

34. An emulsion comprising MG53 or a MG53 mutant of one of items 1-4.

35. A method of preparing an emulsion comprising MG53 or a MG53 mutant of one of items 1-4, comprising the steps of:

(1) lyophilized MG53 or an MG53 mutant of one of items 1-4,

(2) dissolving the lyophilized MG53 or the MG53 mutant of one of items 1-4 in chitosan solution, adding emulsion matrix and glycerol, and making into emulsion.

36. The method of item 35, wherein the emulsion base comprises stearic acid, glyceryl monostearate, white petrolatum, Tween-80, glycerin, and water.

Sequence listing

<110> Padan Jiang friend Bing pharmaceutical finite responsibility company

<120> MG53 mutant and preparation method and application thereof

<130> C16P8616D1

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 1434

<212> DNA

<213> race (wisdom)

<220>

<223> MG53 Natural codon sequence

<400> 1

atgtcggctg cgcccggcct cctgcaccag gagctgtcct gcccgctgtg cctgcagctg 60

ttcgacgcgc ccgtgacagc cgagtgcggc cacagtttct gccgcgcctg cctaggccgc 120

gtggccgggg agccggcggc ggatggcacc gttctctgcc cctgctgcca ggcccccacg 180

cggccgcagg cactcagcac caacctgcag ctggcgcgcc tggtggaggg gctggcccag 240

gtgccgcagg gccactgcga ggagcacctg gacccgctga gcatctactg cgagcaggac 300

cgcgcgctgg tgtgcggagt gtgcgcctca ctcggctcgc accgcggtca tcgcctcctg 360

cctgccgccg aggcccacgc acgcctcaag acacagctgc cacagcagaa actgcagctg 420

caggaggcat gcatgcgcaa ggagaagagt gtggctgtgc tggagcatca gctggtggag 480

gtggaggaga cagtgcgtca gttccggggg gccgtggggg agcagctggg caagatgcgg 540

gtgttcctgg ctgcactgga gggctccttg gaccgcgagg cagagcgtgt acggggtgag 600

gcaggggtcg ccttgcgccg ggagctgggg agcctgaact cttacctgga gcagctgcgg 660

cagatggaga aggtcctgga ggaggtggcg gacaagccgc agactgagtt cctcatgaaa 720

tactgcctgg tgaccagcag gctgcagaag atcctggcag agtctccccc acccgcccgt 780

ctggacatcc agctgccaat tatctcagat gacttcaaat tccaggtgtg gaggaagatg 840

ttccgggctc tgatgccagc gctggaggag ctgacctttg acccgagctc tgcgcacccg 900

agcctggtgg tgtcttcctc tggccgccgc gtggagtgct cggagcagaa ggcgccgccg 960

gccggggagg acccgcgcca gttcgacaag gcggtggcgg tggtggcgca ccagcagctc 1020

tccgagggcg agcactactg ggaggtggat gttggcgaca agccgcgctg ggcgctgggc 1080

gtgatcgcgg ccgaggcccc ccgccgcggg cgcctgcacg cggtgccctc gcagggcctg 1140

tggctgctgg ggctgcgcga gggcaagatc ctggaggcac acgtggaggc caaggagccg 1200

cgcgctctgc gcagccccga gaggcggccc acgcgcattg gcctttacct gagcttcggc 1260

gacggcgtcc tctccttcta cgatgccagc gacgccgacg cgctcgtgcc gctttttgcc 1320

ttccacgagc gcctgcccag gcccgtgtac cccttcttcg acgtgtgctg gcacgacaag 1380

ggcaagaatg cccagccgct gctgctcgtg ggtcccgaag gcgccgaggc ctga 1434

<210> 2

<211> 1434

<212> DNA

<213> Artificial sequence

<220>

<223> MG53 codon-optimized sequence

<400> 2

atgagcgcag caccgggtct gctgcatcaa gaactgagct gtccgctgtg tctgcagctg 60

tttgatgcac cggttaccgc agaatgtggt catagctttt gtcgtgcatg tctgggtcgt 120

gttgccggtg aaccggcagc agatggcacc gttctgtgtc cgtgttgtca ggcaccgacc 180

cgtccgcagg cactgagcac caatctgcag ctggcacgtc tggttgaagg tctggcacag 240

gttccgcagg gtcattgtga agaacatctg gacccgctga gcatttattg tgaacaggat 300

cgtgcactgg tttgtggtgt ttgtgcaagc ctgggtagcc atcgtggtca tcgtctgctg 360

cctgcagccg aagcacatgc acgtctgaaa acccagctgc cgcagcagaa actgcagctg 420

caagaagcat gtatgcgtaa agaaaaaagc gttgcagttc tggaacatca gctggttgaa 480

gttgaagaaa ccgttcgtca gtttcgtggt gcagttggtg aacagctggg taaaatgcgt 540

gtttttctgg cagcactgga aggtagcctg gatcgtgaag cagaacgtgt tcgtggtgaa 600

gccggtgttg cactgcgtcg tgaactgggt agcctgaata gctatctgga acagctgcgt 660

cagatggaaa aagttctgga agaagttgca gataaaccgc agaccgaatt tctgatgaaa 720

tattgtctgg ttaccagccg tctgcagaaa attctggcag aaagtccgcc tccggcacgt 780

ctggatattc agctgccgat tattagtgat gattttaaat ttcaggtgtg gcgcaaaatg 840

tttcgtgcac tgatgcctgc actggaagaa ctgacctttg atccgagcag cgcacatccg 900

agcctggttg ttagctctag cggtcgtcgt gttgaatgta gcgaacagaa agcacctccg 960

gcaggcgaag atccgcgtca gtttgataaa gcagttgcag ttgttgccca tcagcagctg 1020

agcgaaggtg aacattattg ggaagttgat gttggtgata aaccgcgttg ggcactgggt 1080

gttattgcag cggaagcacc gcgtcgtggt cgtctgcatg cagttccgag ccagggtctg 1140

tggctgctgg gtctgcgtga aggtaaaatt ctggaagccc atgttgaagc aaaagaaccg 1200

cgtgcactgc gtagtccgga acgtcgtccg acccgtattg gtctgtatct gagctttggt 1260

gatggtgttc tgagctttta tgatgcaagt gatgcagatg cattagtacc gctgtttgca 1320

tttcatgaac gtctgcctcg tccggtttat ccgttttttg atgtttgctg gcatgataaa 1380

ggcaaaaatg cacagccgct gctgctggtt ggtccggaag gtgcagaagc ataa 1434

<210> 3

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> codon-optimized MG53 Forward primer FP1

<400> 3

ggagatcata tgatgagcgc agcaccgggt ct 32

<210> 4

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> TGGTGGTGCTCGAGTTATTATGCTTCTGCAC

<400> 4

tggtggtgct cgagttatta tgcttctgca c 31

<210> 5

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> MG53S189A forward primer

<400> 5

ctggcagcac tggaaggtgc cctggatcgt g 31

<210> 6

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> MG53S189A reverse primer

<400> 6

cacgatccag ggcaccttcc agtgctgcca g 31

<210> 7

<211> 1434

<212> DNA

<213> Artificial sequence

<220>

<223> MG53S189A plasmid sequence

<400> 7

atgagcgcag caccgggtct gctgcatcaa gaactgagct gtccgctgtg tctgcagctg 60

tttgatgcac cggttaccgc agaatgtggt catagctttt gtcgtgcatg tctgggtcgt 120

gttgccggtg aaccggcagc agatggcacc gttctgtgtc cgtgttgtca ggcaccgacc 180

cgtccgcagg cactgagcac caatctgcag ctggcacgtc tggttgaagg tctggcacag 240

gttccgcagg gtcattgtga agaacatctg gacccgctga gcatttattg tgaacaggat 300

cgtgcactgg tttgtggtgt ttgtgcaagc ctgggtagcc atcgtggtca tcgtctgctg 360

cctgcagccg aagcacatgc acgtctgaaa acccagctgc cgcagcagaa actgcagctg 420

caagaagcat gtatgcgtaa agaaaaaagc gttgcagttc tggaacatca gctggttgaa 480

gttgaagaaa ccgttcgtca gtttcgtggt gcagttggtg aacagctggg taaaatgcgt 540

gtttttctgg cagcactgga aggtgccctg gatcgtgaag cagaacgtgt tcgtggtgaa 600

gccggtgttg cactgcgtcg tgaactgggt agcctgaata gctatctgga acagctgcgt 660

cagatggaaa aagttctgga agaagttgca gataaaccgc agaccgaatt tctgatgaaa 720

tattgtctgg ttaccagccg tctgcagaaa attctggcag aaagtccgcc tccggcacgt 780

ctggatattc agctgccgat tattagtgat gattttaaat ttcaggtgtg gcgcaaaatg 840

tttcgtgcac tgatgcctgc actggaagaa ctgacctttg atccgagcag cgcacatccg 900

agcctggttg ttagctctag cggtcgtcgt gttgaatgta gcgaacagaa agcacctccg 960

gcaggcgaag atccgcgtca gtttgataaa gcagttgcag ttgttgccca tcagcagctg 1020

agcgaaggtg aacattattg ggaagttgat gttggtgata aaccgcgttg ggcactgggt 1080

gttattgcag cggaagcacc gcgtcgtggt cgtctgcatg cagttccgag ccagggtctg 1140

tggctgctgg gtctgcgtga aggtaaaatt ctggaagccc atgttgaagc aaaagaaccg 1200

cgtgcactgc gtagtccgga acgtcgtccg acccgtattg gtctgtatct gagctttggt 1260

gatggtgttc tgagctttta tgatgcaagt gatgcagatg cattagtacc gctgtttgca 1320

tttcatgaac gtctgcctcg tccggtttat ccgttttttg atgtttgctg gcatgataaa 1380

ggcaaaaatg cacagccgct gctgctggtt ggtccggaag gtgcagaagc ataa 1434

<210> 8

<211> 477

<212> PRT

<213> Artificial sequence

<220>

<223> N-terminal amino acid sequence of MG53S189A

<400> 8

Met Ser Ala Ala Pro Gly Leu Leu His Gln Glu Leu Ser Cys Pro Leu

1 5 10 15

Cys Leu Gln Leu Phe Asp Ala Pro Val Thr Ala Glu Cys Gly His Ser

20 25 30

Phe Cys Arg Ala Cys Leu Gly Arg Val Ala Gly Glu Pro Ala Ala Asp

35 40 45

Gly Thr Val Leu Cys Pro Cys Cys Gln Ala Pro Thr Arg Pro Gln Ala

50 55 60

Leu Ser Thr Asn Leu Gln Leu Ala Arg Leu Val Glu Gly Leu Ala Gln

65 70 75 80

Val Pro Gln Gly His Cys Glu Glu His Leu Asp Pro Leu Ser Ile Tyr

85 90 95

Cys Glu Gln Asp Arg Ala Leu Val Cys Gly Val Cys Ala Ser Leu Gly

100 105 110

Ser His Arg Gly His Arg Leu Leu Pro Ala Ala Glu Ala His Ala Arg

115 120 125

Leu Lys Thr Gln Leu Pro Gln Gln Lys Leu Gln Leu Gln Glu Ala Cys

130 135 140

Met Arg Lys Glu Lys Ser Val Ala Val Leu Glu His Gln Leu Val Glu

145 150 155 160

Val Glu Glu Thr Val Arg Gln Phe Arg Gly Ala Val Gly Glu Gln Leu

165 170 175

Gly Lys Met Arg Val Phe Leu Ala Ala Leu Glu Gly Ala Leu Asp Arg

180 185 190

Glu Ala Glu Arg Val Arg Gly Glu Ala Gly Val Ala Leu Arg Arg Glu

195 200 205

Leu Gly Ser Leu Asn Ser Tyr Leu Glu Gln Leu Arg Gln Met Glu Lys

210 215 220

Val Leu Glu Glu Val Ala Asp Lys Pro Gln Thr Glu Phe Leu Met Lys

225 230 235 240

Tyr Cys Leu Val Thr Ser Arg Leu Gln Lys Ile Leu Ala Glu Ser Pro

245 250 255

Pro Pro Ala Arg Leu Asp Ile Gln Leu Pro Ile Ile Ser Asp Asp Phe

260 265 270

Lys Phe Gln Val Trp Arg Lys Met Phe Arg Ala Leu Met Pro Ala Leu

275 280 285

Glu Glu Leu Thr Phe Asp Pro Ser Ser Ala His Pro Ser Leu Val Val

290 295 300

Ser Ser Ser Gly Arg Arg Val Glu Cys Ser Glu Gln Lys Ala Pro Pro

305 310 315 320

Ala Gly Glu Asp Pro Arg Gln Phe Asp Lys Ala Val Ala Val Val Ala

325 330 335

His Gln Gln Leu Ser Glu Gly Glu His Tyr Trp Glu Val Asp Val Gly

340 345 350

Asp Lys Pro Arg Trp Ala Leu Gly Val Ile Ala Ala Glu Ala Pro Arg

355 360 365

Arg Gly Arg Leu His Ala Val Pro Ser Gln Gly Leu Trp Leu Leu Gly

370 375 380

Leu Arg Glu Gly Lys Ile Leu Glu Ala His Val Glu Ala Lys Glu Pro

385 390 395 400

Arg Ala Leu Arg Ser Pro Glu Arg Arg Pro Thr Arg Ile Gly Leu Tyr

405 410 415

Leu Ser Phe Gly Asp Gly Val Leu Ser Phe Tyr Asp Ala Ser Asp Ala

420 425 430

Asp Ala Leu Val Pro Leu Phe Ala Phe His Glu Arg Leu Pro Arg Pro

435 440 445

Val Tyr Pro Phe Phe Asp Val Cys Trp His Asp Lys Gly Lys Asn Ala

450 455 460

Gln Pro Leu Leu Leu Val Gly Pro Glu Gly Ala Glu Ala

465 470 475

Claims

A mitsugumin53 (MG53) mutant, characterized in that the serine site in the ceiling-coil domain of MG53 is mutated to an amino acid other than threonine and tyrosine.
2. The MG53 mutant of claim 1, wherein the serine is mutated to a non-polar amino acid.
3. The MG53 mutant of claim 2, wherein the nonpolar amino acid is alanine, glycine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, or methionine.
4. The MG53 mutant of claim 3, wherein the nonpolar amino acid is alanine and the MG53 mutant is any one or more selected from MG53S150A, MG53S189A, and MG53S 211A.
5. A method of making the MG53 mutant of any of claims 1-4, comprising the steps of:

(1) mutating wild MG53 to obtain MG53 mutant, and cloning into plasmid;

(2) expressing the MG53 mutant plasmid in a cell;

(3) the MG53 mutant protein produced is purified using chromatography, such as DEAE column chromatography and CM column chromatography, optionally Source 30Q column chromatography.
6. The method of claim 5, wherein the mutation is site-directed mutagenesis of the full-length sequence of the wild-type MG53 plasmid using a site-directed mutagenesis kit to obtain the MG53 mutant plasmid.
7. The method of claim 6, wherein the wild-type MG53 is codon optimized.
8. The process of claim 6, wherein in the DEAE column chromatography, binding solution A is 20mM Tris, pH8.0, eluent B is 20mM Tris and 1.0M NaCl, pH8.0, optionally eluted with a 5% (volume ratio) solution of eluent B in a mixture of A and B and/or eluent B.
9. The process of claim 6 wherein in the CM column chromatography, binding solution A is 20mM PB, pH6.0, eluent B is 20mM PB and 1.0M NaCl, pH6.0, optionally eluting with a solution of eluent B at 10% (by volume) in a mixture of A and B and/or a gradient of eluent B between 10% and 30% (by volume) in a mixture of A and B and/or eluent B.
10. The process of claim 6 wherein in the Source 30Q column chromatography, binding solution A is 20mM Tris, pH 8.5 and eluent B is 20mM Tris and 1.0M NaCl, pH 8.5, optionally eluting with eluent B.
11. A pharmaceutical composition comprising the MG53 mutant of any one of claims 1-4.
12. The pharmaceutical composition of claim 11, further comprising a pharmaceutically acceptable excipient or carrier.
13. Use of a MG53 mutant according to any one of claims 1-4 for the preparation of a pharmaceutical composition for the prevention and/or treatment of a disease associated with cell membrane damage.
14. The use of claim 13, wherein the disease associated with cell membrane damage comprises one or more selected from the group consisting of: diseases associated with myocardial cell injury, diseases associated with ulcers, trauma with wounds, particularly refractory wounds, intestinal leaks, and kidney injury.
15. The use of claim 14, wherein the disease associated with myocardial cell injury comprises one or more selected from the group consisting of diseases associated with the following symptoms: myocardial ischemia, cardiac ischemia/reperfusion injury, myocardial infarction, heart failure, arrhythmia, and cardiac rupture.
16. The use of claim 14, wherein the ulcer-related disease comprises one or more selected from the group consisting of: chronic ulcer, peptic ulcer, diabetic foot gangrene, and chronic gastric ulcer.
17. A dry powder formulation comprising MG53 or the MG53 mutant of any of claims 1-4.
18. A method of making a dry powder formulation comprising MG53 or the MG53 mutant of any of claims 1-4, comprising the steps of:

(1) dissolving excipients and mixing them with MG53 or the MG53 mutant solution of any one of claims 1 to 4, adjusting the PH to 6.5 to 8.0 to obtain a protein solution comprising 0.1 to 2.0 MG/ml;

(2) a dry powder formulation obtained by filter sterilization and freeze-drying the solution comprising 0.5-2MG/ml of MG53 or MG53 mutant of any of claims 1-4 under suitable freeze-drying conditions.
19. The method according to claim 18, wherein the excipient comprises one or more selected from the group consisting of: polyols, saccharides, surfactants and polymers.
20. The method according to claim 19, wherein the polyol comprises one or more selected from the group consisting of: glycerol, mannitol, sorbitol, inositol and polyethylene glycol, the saccharide comprising one or more selected from the group consisting of: sucrose, glucose, lactose, trehalose, mannose and maltose, the surfactant comprising one or more selected from the group consisting of: tween80, sodium lauryl sulfate, and/or the polymer comprises one or more selected from the group consisting of: polyethylene glycol, polyvinyl pyrrolidone.
21. The method according to claim 20, wherein the excipients are sucrose, mannitol and histidine.
22. The method according to claim 20, wherein the excipients are sucrose, mannitol and Tween-80.
23. The method according to claim 18, wherein the suitable freeze-drying conditions are:

(1) pre-freezing to-45 deg.C, holding for 2 hr, pre-vacuumizing to 12 + -2 Pa,

(2) heating to-6 ℃ for 90 minutes, keeping the temperature for 10 hours,

(3) heating to 15 ℃ for 1 hour, holding for 5 hours, and

(4) and (5) further drying.
24. A hydro-acupuncture formulation comprising MG53 or the MG53 mutant of any of claims 1-4.
25. A method of making a hydro-acupuncture formulation comprising MG53 or the MG53 mutant of any of claims 1-4, comprising the steps of:

(1) dissolving lyophilized MG53 or the MG53 mutant of any of claims 1-4 in a solvent,

(2) adjusting the pH value, filtering,

(3) sealing and sterilizing to produce a hydro-acupuncture formulation comprising MG53 or the MG53 mutant of any one of claims 1-4.
26. The method of claim 25, wherein the solvent is a solvent commonly used in medicine, preferably water or physiological saline.
27. A spray formulation comprising MG53 or the MG53 mutant of any of claims 1-4.
28. A method of making a spray formulation comprising MG53 or the MG53 mutant of any of claims 1-4, comprising the steps of:

(1) lyophilized MG53 or the MG53 mutant of any of claims 1-4,

(2) dissolving the lyophilized MG53 or the MG53 mutant of any one of claims 1-4 with a solvent to formulate a spray formulation comprising 50ng to 100 μ g/ml MG53 or the MG53 mutant of any one of claims 1-4.
29. The method of claim 28, wherein the solvent is a solvent commonly used in medicine, preferably water or physiological saline.
30. A gel formulation comprising MG53 or the MG53 mutant of any of claims 1-4.
31. A method of making a gel formulation comprising MG53 or the MG53 mutant of any of claims 1-4, comprising the steps of:

(1) lyophilized MG53 or the MG53 mutant of any of claims 1-4,

(2) dissolving the lyophilized MG53 or the MG53 mutant of any one of claims 1-4 with a solvent to formulate a gel solvent.
32. The method of claim 31, wherein the solvent is a polyoxyethylene-polyoxypropylene block copolymer or a mixture of carbomer, glycerin, chitosan.
33. The method of claim 32, wherein the polyoxyethylene-polyoxypropylene block copolymer is a polyoxyethylene-polyoxypropylene block copolymer stored at low temperatures, such as 4-8 ℃.
34. An emulsion comprising MG53 or the MG53 mutant of any one of claims 1-4.
35. A method of making an emulsion comprising MG53 or the MG53 mutant of any of claims 1-4, comprising the steps of:

(1) lyophilized MG53 or the MG53 mutant of any of claims 1-4,

(2) dissolving the lyophilized MG53 or the MG53 mutant of any one of claims 1-4 in a chitosan solution, adding an emulsion base and glycerol, and formulating into an emulsion.
36. The method of claim 35, wherein the emulsion base comprises stearic acid, glyceryl monostearate, white petrolatum, Tween-80, glycerin, and water.