CN112899244B

CN112899244B - Site-directed mutagenesis rice cryptochrome and construction method thereof

Info

Publication number: CN112899244B
Application number: CN202110243351.5A
Authority: CN
Inventors: 朱国萍; 刘莉; 王鹏; 文斌; 徐蕾; 胡德港; 王孟黎; 陈雪霏; 卞命杰
Original assignee: Anhui Normal University
Current assignee: Anhui Normal University
Priority date: 2021-03-04
Filing date: 2021-03-04
Publication date: 2023-02-21
Anticipated expiration: 2041-03-04
Also published as: CN112899244A

Abstract

The invention discloses a site-directed mutant rice cryptochrome and a construction method thereof, wherein a gene sequence is obtained from a gene library, and after artificial codon optimization and protein carboxyl terminal truncation are carried out, a target gene sequence is obtained and connected with pET22b plasmid to construct a recombinant expression plasmid. The truncated gene sequence is shown in SEQ ID NO 1. Designing a mutation primer, carrying out site-directed mutation by using a recombinant plasmid, and transforming the mutant recombinant plasmid into an escherichia coli competent cell to construct a genetic engineering bacterium for rice cryptochrome expression; compared with the prior art, the invention has the advantages that the polymerization form of the expressed mutant enzyme D393N is changed, the expression quantity is higher, and convenience is brought to in vitro research; free radicals generated by photoreduction are more, and oxidation is slower, so that the D393N mutant enzyme is beneficial to regulating and controlling the flowering period of rice, the rice can avoid harm, and the rice yield is further improved.

Description

Site-directed mutagenesis rice cryptochrome and construction method thereof

The technical field is as follows:

the invention belongs to the technical field of biological engineering, relates to the technical field of gene and protein engineering, and particularly relates to a rice cryptochrome gene and a construction method thereof.

Background art:

two proteins, namely cryptochrome and photorepair enzyme, form a cryptochrome/photorepair enzyme protein family (CPF), the cryptochrome is evolved from the photorepair enzyme, the family protein has higher sequence homology and similar spatial structure, but the functions of the two proteins are greatly different. The early earth has thin oxygen and no ozone layer formed in the atmosphere, so that ultraviolet rays can reach the earth without obstruction, and the medium and short wave ultraviolet rays can cause DNA damage of organisms and have strong killing effect on the organisms. The photorepair enzyme can repair DNA damage caused by medium-short wave ultraviolet rays, and mainly absorbs the light energy of blue light and long-wave ultraviolet rays to carry out photoactivation. Leuco is deficient in photorepair ability, and is a photoreceptor that regulates plant and animal circadian rhythms and acts as a receptor to control photomorphogenesis of plants to blue or long-wave ultraviolet light.

Both the photolyase and the leuco dye act by absorption of light energy by the flavin-type coenzyme. All cryptochromes and photorepair enzymes bind Flavin Adenine Dinucleotide (FAD). FAD has a variety of redox forms, which are classified as follows: fully oxidized (FAD) _ox ) Radical (semiquinone) and reduced (hydroquinone). The active form of the FAD coenzyme in the photolyase is reduced, and the active form of the FAD coenzyme in the cryptochrome is free radical.

The rice is used as a main planting variety in China, the planting area of the rice is 3 million hectares, and the total yield is over 2 hundred million tons. The rice cryptochrome can inhibit hypocotyl elongation by blue light, stimulate cotyledon expansion by blue light, regulate flowering time and stomatal opening, guide circadian rhythm and regulate gene expression, so that the rice cryptochrome can be beneficial to regulating the flowering period, the growth of rice is benefited and avoided, the rice yield is improved, and the influence on domestic livelihood is great. However, the research on the rice cryptochrome is rare at present.

The invention content is as follows:

the invention aims to solve the 1 st technical problem of providing a rice leuco gene with site-directed mutagenesis.

The 2 nd technical problem to be solved by the invention is to provide an expression vector containing the gene.

The 3 rd technical problem to be solved by the present invention is a host cell containing the gene.

The invention aims to solve the 4 th technical problem of the preparation method of the rice cryptochrome.

In order to solve the technical problems, the invention adopts the technical scheme that:

a site-directed mutant rice cryptochrome has a nucleotide sequence of SEQ ID NO.1 in a gene coded by the cryptochrome.

The coding protein of the site-directed mutagenesis rice cryptochrome gene has an amino acid sequence of SEQ ID NO. 2.

The carrier is a recombinant plasmid which contains the site-directed mutant rice cryptochrome gene.

The host is a site-directed mutant rice cryptochrome recombinant engineering bacterium which is escherichia coli and contains the recombinant plasmid expression vector and a nucleotide sequence.

The invention adopts a site-directed mutagenesis method to reconstruct protein: desired changes (including base additions, deletions, point mutations) are introduced into the DNA fragment (plasmid, genome) of interest by Polymerase Chain Reaction (PCR).

The invention obtains a gene sequence from a gene library, carries out artificial codon optimization and protein carboxyl terminal truncation, obtains a target gene sequence, connects the target gene sequence with pET22b plasmid, and constructs a recombinant expression plasmid; designing a mutation primer, carrying out site-directed mutagenesis by using a recombinant plasmid, and transforming the mutant recombinant plasmid into an escherichia coli competent cell to construct a genetically engineered bacterium Rosetta (DE 3)/pET 22b-D393N for expressing the cryptochrome protein of rice; better expression was obtained at 20 ℃ at 180rpm/min and 1mM IPTG (isopropyl-. Beta. -D-thiogalactopyranoside).

Compared with the prior art, the mutant enzyme D393N expressed by the invention is a tetramer, while the wild type is a monomer, and the polymerization form is changed. The highest protein absorption peak of cryptochrome of wild rice is 254mAU, while the highest protein absorption peak of D393N mutant is 1330mAU, and the expression quantity of the D393N mutant is 5.23 times of that of the wild rice, thereby providing convenience for in vitro research. In addition, the D393N mutation reduces photo-generated more radicals and oxidizes more slowly, indicating that the D393N mutation can maintain the coenzyme in the radical form. Therefore, the D393N mutant enzyme is beneficial to regulating the flowering cycle of the rice, leads the growth of the rice to be in favor of avoiding harm, and further improves the yield of the rice.

Description of the drawings:

FIG. 1 is an SDS-PAGE electrophoresis of WT (wild type) and D393N mutant enzyme purifications.

M is a low molecular weight standard protein,

lanes

1 and 2 are respectively the wild-type prepared in example 3 and the D393N mutant enzyme purified protein prepared in example 2.

FIG. 2 is a gel filtration chromatogram of the WT rice cryptochrome prepared in example 3.

FIG. 3 is a gel filtration chromatogram of the D393N mutant enzyme prepared in example 2.

FIG. 4 is a reduction spectrum of the D393N mutant enzyme prepared in example 2

41. 42, 43, 44, 45 and 46 are respectively the absorption peak change curves of oxidation type FAD 450nm and free radical type FAD 580nm at 0s, 10s, 1min, 10min, 40min and 60 min.

FIG. 5 is a reduction spectrum of the latent pigment of WT rice prepared in example 3

51. 52, 53 and 54 are respectively the absorption peak change curves of oxidized FAD 450nm and free radical FAD 580nm at 0s, 10min and 30 min.

FIG. 6 is the enzyme oxidation spectrum of the D393N mutant prepared in example 2

61. 62, 63, 64, 65, 66 and 67 are respectively the change curves of the absorption peaks of the oxidized FAD at 450nm and the absorption peaks of the free radical FAD at 580nm at 0min, 2min, 10min, 20min, 30min, 60min and 90 min.

FIG. 7 is an oxidation spectrum of the WT rice cryptochrome produced in example 3

71. 72, 73, 74, 75 and 76 are respectively the change curves of the absorption peak of the oxidized FAD at 450nm and the absorption peak of the free radical FAD at 580nm at 0min, 1min, 5min, 10min, 20min and 30 min.

The specific implementation mode is as follows:

the present invention will be described in detail with reference to examples.

Example 1: obtaining of mutant enzyme D393N gene and construction of expression vector

1.1 obtaining the Gene oscry2 of the hidden pigment of WT Rice

The sequence of the leuco gene of NCBI (National Center for Biotechnology, AB 103094) rice was searched, optimized and truncated based on codon preference in Escherichia coli (E.coli), a gene suitable for expression in Escherichia coli was designed, and the gene was artificially synthesized by Nanjing Kingsler, and loaded onto pET22b plasmid vector, and after successful sequencing by the company, the successfully constructed recombinant plasmid pET22b-OsCRY2 was sent back. (Zhenganxiong. Escherichia coli synonymous codon preference summary [ J ]. Silicon valley, 2009 (01): 23-24.) (Fumiaki Hirose. Invasion of rice cryptochromes in de-ionization responses and flowing [ J ]. Plant Cell Physiol,2006,47 (7): 915-25.).

1.2 construction of mutant strains

Designing a pair of mutation primers, wherein the mutation primers are respectively as follows:

D393N S:5'CGCGGATCTGGAAAGCAATATCCTGGGCTG 3'

D393N AS:5'TGCTTTCCAGATCCGCGTCCAGCAGCA 3'

the principle of rapid site-directed mutagenesis: the target gene is amplified by PCR, and the extension product is digested by Dpn I. Since the original template plasmid was derived from E.coli, was dam-methylated, modified, and minced in response to Dpn I (the Dpn I recognition sequence is methylated G) ^m ATC), whereas the in vitro synthesized plasmid with the mutation is not cut due to lack of methylation, i.e.Clones of the mutated plasmids can be obtained.

PCR reaction System (60. Mu.l)

PCR reaction conditions

Digestion reaction System (20. Mu.l)

Dpn I 2μl

10×FastDigest Buffer 2μl

Plasmid pET22b-D393N 16. Mu.l

Digestion reaction conditions

37℃ 90min

80℃ 5min

PCR amplification is carried out by taking pET22b-OsCRY2 recombinant plasmid as a template, and the reaction condition is pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 50s, annealing at 60 ℃ for 50s, extension at 72 ℃ for 3min, and 30 cycles; fully extending for 10min at 72 ℃. After the enzyme digestion reaction of DpnI, the mutant plasmid pET22b-D393N is transformed into an escherichia coli E.coli DH5 alpha competent cell, and positive clone is screened by Amp resistance and sent to a general biology company for sequencing and identification. The 393 position mutation is found to be successful by the sequence alignment result.

And (3) streaking the successfully mutated thallus plate, selecting the thallus, shaking the thallus, re-extracting the plasmid, transforming the thallus into an Escherichia coli E.coli Rosetta (DE 3) competent cell, and constructing an engineering bacterium Rosetta (DE 3)/pET 22b-D393N.

Example 2: expression and purification of mutant rice cryptochrome D393N protein

2.1 protein expression

(1) Inoculating bacteria: selecting engineering bacteria Rosetta (DE 3)/pET 22b-D393N, inoculating to 5mlLB (Amp) ⁺ ,Cam ⁺ ) Culturing overnight at 37 deg.C and 225rpm in liquid culture medium;

(2) Expanding culture: 5ml of overnight-cultured bacterial liquid was transferred to 500Culturing in ml of liquid LB containing corresponding antibiotics at 37 deg.C and 225rpm for 4-5h to OD ₆₀₀ Is about 1;

(3) Induction: adding 500 μ l of 1MIPTG to a final concentration of 1mM,20 deg.C, 180rpm, inducing expression for 20h;

(4) Collecting bacteria: after the induction expression is finished, centrifuging at 4 ℃ and 5500rpm for 5min, collecting thalli, and then storing in a refrigerator at-80 ℃.

2.2 protein purification

Start Buffer(500ml)

Elution Buffer(500ml)：

Protein Buffer(500ml)：

(all adjusted to pH7.2 with HCl and ddH added ₂ O constant volume to 500 ml)

(1) Crushing: adding 30ml of Start Buffer to resuspend the thallus, placing the bacterial liquid in an ultrasonic crusher, and crushing for 30min at 70Mpa for 1s of work and 2s of pause;

(2) Centrifuging: centrifuging the crushed solution at 4 deg.C, 10000rpm and 12min at high speed;

(3) Combining: adding 30ml of Ni into the supernatant after crushing and centrifugation ²⁺ Mixing in ion affinity column; shaking the sample on a horizontal shaking table for 15min at 4 ℃ to ensure that the supernatant is fully combined with the nickel ion resin;

(4) And (3) elution: after the combination is finished, washing the resin by 25ml of StartBuffer, eluting the target protein by 25ml of Elutionbuffer, and collecting the eluted protein by a 50ml small beaker;

(5) And (3) concentrating: adding the collected eluted protein into an ultrafiltration centrifugal tube, concentrating at 4 ℃ and 5000rpm to 600 mu l;

(6) Degassing: transferring the concentrated protein into a 1.5ml EP tube by using a pipette, centrifuging for 10min at 4 ℃ and 12000 rpm;

(7) Gel filtration chromatography: the protein sample was aspirated with a 1ml syringe and injected into the loading well. Running the preset program to carry out chromatography. Collecting the target protein for subsequent test.

Example 3: expression and purification of WT (wildtype) rice leuco protein

Removing: inoculating bacteria: the engineering bacteria Rosetta (DE 3)/pET 22b-OsCRY2 are picked and inoculated in 5ml LB (Amp) ⁺ ,Cam ⁺ ) Culturing in liquid culture medium at 37 deg.C and 225rpm overnight;

the rest was the same as in example 2.

As shown in fig. 1: there is a single highly specific band at 56kDa, indicating that the purity of the purified protein is high (above 90%). And the molecular weight is consistent with the molecular weight calculated by the amino acid sequence. The D393N mutant enzyme bands are coarser than WT, which shows that the expression level of the D393N mutant enzyme is improved.

As shown in FIG. 2, the WT rice cryptochrome produced in example 3 had an elution volume of 14.75ml and a calculated molecular weight of 57kDa, indicating that the WT rice cryptochrome was monomeric. The highest absorption peak of the protein is 254mAU.

As shown in FIG. 3, the elution volume of the D393N mutant enzyme prepared in example 2 was 12.02ml, and the calculated molecular weight was 210kDa, indicating that the D393N mutant enzyme is a tetramer. The highest protein absorption peak is 1330mAU, and further shows that the D393N mutant enzyme has higher expression quantity.

Example 4: the mutant D393N prepared in example 2 and the WT rice cryptochrome protein prepared in example 3 have the spectral properties.

The plant cryptochrome FAD purified in vitro exists in an oxidation type, and can generate a reduction reaction through blue light irradiation to form a free radical type. The oxidized form has an absorption peak at 450nm, while the radical form has an absorption peak at 580nm, so that the reduction and oxidation rates can be calculated by detecting the decrease and increase of the peaks at 450nm and 580 nm.

3.1 reduction Spectroscopy

Mu.l of the protein sample prepared in example 2 or 3 was taken and placed in a semimicrocuvette, and 6. Mu.l of 1M Dithiothreitol (DTT) electron donor was added to a final concentration of 10mM. The cuvette was placed in a 50ml small beaker, which was then placed in ice water at 0 ℃ (ice was changed in time to ensure ice water bath conditions). And (3) irradiating the sample by using a 446nm LED blue lamp, and detecting the spectral change at regular intervals until the protein is completely reduced.

3.2 Oxidation Spectroscopy

After photoreduction, the sample was placed in a UV-1800 UV-vis spectrophotometer. Under the aerobic condition, the temperature is controlled within the range of 17 +/-0.5 ℃, and the rice cryptochrome protein is continuously and slowly oxidized. At intervals, the machine automatically records the spectral changes until the oxidation process is complete.

As shown in FIG. 4, the D393N mutant enzyme prepared in example 2 was gradually reduced within 60min, and the reduction rate was slowed down until the reduction was completed in 60 min. And free radicals generated in the reduction process of the mutant enzyme are more than that of WT, which shows that the mutant can enable the cryptochrome of the rice to play a more stable function.

As shown in FIG. 5, the WT rice plants produced in example 3 showed rapid reduction of cryptochrome, complete reduction within 10s, and no significant change within 30min, with coenzyme FAD being reduced from oxidized to free radical.

As shown in FIG. 6, the D393N mutant prepared in example 2 was oxidized slowly and completely within 90min, indicating that the mutant coenzyme FAD was maintained in a free radical state for a longer time than WT, which is beneficial to the cryptochrome regulation of rice in flowering cycle, and further, the productivity was improved.

As shown in FIG. 7, the WT rice cryptochrome produced in example 3 was completely oxidized within 30 min.

Sequence listing

<110> university of teacher's university in Anhui

<120> site-directed mutagenesis hidden pigment for rice and construction method thereof

<130> 2021.1.8

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1476

<212> DNA

<213> cryptochrome of rice (artificially synthesized Oryza sativa cryptochromee)

<400> 1

atggcgggta gcgagcgtac cgtggtttgg tttcgtcgtg acctgcgtat cgacgataac 60

ccggcgctgg cgagcgcggc gcgtgacggc gcggtgctgc cggtttttat ttggtgcccg 120

gcggatgagg gccagttcta cccgggccgt tgcagccgtt ggtggctgaa gcagagcctg 180

ccgcacctga gccaaagcct ggaaagcctg ggttgcccgc tggtgctgat ccgtgcggag 240

agcaccctgg aagcgctgct gcgttgcatt gacagcgtgg gcgcgacccg tctggtttac 300

aaccacctgt atgatccggt tagcctggtt cgtgacgata aaatcaagaa agagctgagc 360

gcgctgggta tcagcattca aagcttcaac ggcgacctgc tgtacgagcc gtgggaaatc 420

tatgacgata gcggtctggc gtttaccacc ttcaacatgt actgggagaa gtgcatggaa 480

ctgccgattg atgcgagccc gagcctggcg ccgtggaaac tggtgccggt tccgggtctg 540

gagagcgtgc gtagctgcag cgttgacgat ctgggcctgg aaagcagcaa ggacgaggaa 600

agcagcaacg cgctgctgat gcgtgcgtgg agcccgggtt ggcgtaacgc ggaaaaaatg 660

ctggaggaat ttgtgagcca cggcctgctg gagtatagca agcacggtat gaaagttgag 720

ggtgcgacca ccagcctgct gagcccgtac ctgcacttcg gtgaggtgag cgttcgtaag 780

gtgtatcagc tggttcgtat gcagcaaatc aaatgggaga acgaaggtac cagcgaagcg 840

gaggaaagca tccacttctt tatgcgtagc attggcctgc gtgagtacag ccgttatctg 900

tgcttcaact ttccgttcac ccacgaaaag agcctgctgg gcaacctgaa gcactacccg 960

tggaaagtgg acgaggaacg ttttaaaagc tggcgtcagg gtatgaccgg ctatccgctg 1020

gttgatgcgg gtatgcgtga actgtgggcg accggttgga cccacaaccg tatccgtgtg 1080

atcattagca gctttgcggt taagttcctg ctgattccgt ggacctgggg tatgaaatac 1140

ttctgggacg tgctgctgga cgcggatctg gaaagcaata tcctgggctg gcaatatatt 1200

agcggtagcc tgccggatgg tcatgagctg agccgtctgg ataacccgga agttcagggt 1260

caaaagtacg acccggatgg cgtgtatgtt cgtacctgga ttccggagct ggcgcgtatg 1320

ccgaccgaat ggattcacca cccgtgggat gcgccgagct gcattctgga agtggcgggt 1380

gttgaactgg gctttaacta cccgaagccg atcgtggacc tgcacattgc gcgtgagtgc 1440

ctggacgata gcatcagcac catgtggcag ctggat 1476

<210> 2

<211> 492

<212> PRT

<400> 2

Met Ala Gly Ser Glu Arg Thr Val Val Trp Phe Arg Arg Asp Leu Arg

1 5 10 15

Ile Asp Asp Asn Pro Ala Leu Ala Ser Ala Ala Arg Asp Gly Ala Val

20 25 30

Leu Pro Val Phe Ile Trp Cys Pro Ala Asp Glu Gly Gln Phe Tyr Pro

35 40 45

Gly Arg Cys Ser Arg Trp Trp Leu Lys Gln Ser Leu Pro His Leu Ser

50 55 60

Gln Ser Leu Glu Ser Leu Gly Cys Pro Leu Val Leu Ile Arg Ala Glu

65 70 75 80

Ser Thr Leu Glu Ala Leu Leu Arg Cys Ile Asp Ser Val Gly Ala Thr

85 90 95

Arg Leu Val Tyr Asn His Leu Tyr Asp Pro Val Ser Leu Val Arg Asp

100 105 110

Asp Lys Ile Lys Lys Glu Leu Ser Ala Leu Gly Ile Ser Ile Gln Ser

115 120 125

Phe Asn Gly Asp Leu Leu Tyr Glu Pro Trp Glu Ile Tyr Asp Asp Ser

130 135 140

Gly Leu Ala Phe Thr Thr Phe Asn Met Tyr Trp Glu Lys Cys Met Glu

145 150 155 160

Leu Pro Ile Asp Ala Ser Pro Ser Leu Ala Pro Trp Lys Leu Val Pro

165 170 175

Val Pro Gly Leu Glu Ser Val Arg Ser Cys Ser Val Asp Asp Leu Gly

180 185 190

Leu Glu Ser Ser Lys Asp Glu Glu Ser Ser Asn Ala Leu Leu Met Arg

195 200 205

Ala Trp Ser Pro Gly Trp Arg Asn Ala Glu Lys Met Leu Glu Glu Phe

210 215 220

Val Ser His Gly Leu Leu Glu Tyr Ser Lys His Gly Met Lys Val Glu

225 230 235 240

Gly Ala Thr Thr Ser Leu Leu Ser Pro Tyr Leu His Phe Gly Glu Val

245 250 255

Ser Val Arg Lys Val Tyr Gln Leu Val Arg Met Gln Gln Ile Lys Trp

260 265 270

Glu Asn Glu Gly Thr Ser Glu Ala Glu Glu Ser Ile His Phe Phe Met

275 280 285

Arg Ser Ile Gly Leu Arg Glu Tyr Ser Arg Tyr Leu Cys Phe Asn Phe

290 295 300

Pro Phe Thr His Glu Lys Ser Leu Leu Gly Asn Leu Lys His Tyr Pro

305 310 315 320

Trp Lys Val Asp Glu Glu Arg Phe Lys Ser Trp Arg Gln Gly Met Thr

325 330 335

Gly Tyr Pro Leu Val Asp Ala Gly Met Arg Glu Leu Trp Ala Thr Gly

340 345 350

Trp Thr His Asn Arg Ile Arg Val Ile Ile Ser Ser Phe Ala Val Lys

355 360 365

Phe Leu Leu Ile Pro Trp Thr Trp Gly Met Lys Tyr Phe Trp Asp Val

370 375 380

Leu Leu Asp Ala Asp Leu Glu Ser Asn Ile Leu Gly Trp Gln Tyr Ile

385 390 395 400

Ser Gly Ser Leu Pro Asp Gly His Glu Leu Ser Arg Leu Asp Asn Pro

405 410 415

Glu Val Gln Gly Gln Lys Tyr Asp Pro Asp Gly Val Tyr Val Arg Thr

420 425 430

Trp Ile Pro Glu Leu Ala Arg Met Pro Thr Glu Trp Ile His His Pro

435 440 445

Trp Asp Ala Pro Ser Cys Ile Leu Glu Val Ala Gly Val Glu Leu Gly

450 455 460

Phe Asn Tyr Pro Lys Pro Ile Val Asp Leu His Ile Ala Arg Glu Cys

465 470 475 480

Leu Asp Asp Ser Ile Ser Thr Met Trp Gln Leu Asp

485 490

Claims

1. A coding gene of rice cryptochrome site-directed mutant protein is characterized in that: the gene consists of a nucleotide sequence shown in SEQ ID NO. 1.

2. A site-directed mutant rice leuco protein, which is characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO. 2.

3. A carrier, characterized by: comprising the nucleotide sequence of claim 1.

4. A host cell, characterized in that: which comprises the amino acid sequence of claim 2.

5. A host cell, characterized in that: comprising the vector of claim 3.

6. The method for constructing site-directed mutant rice cryptochrome protein as claimed in claim 2, comprising the steps of: obtaining a gene sequence from a gene library, carrying out artificial codon optimization and protein carboxyl terminal truncation, obtaining a target gene sequence, connecting the target gene sequence with pET22b plasmid, and constructing a recombinant expression plasmid; designing a mutation primer, performing site-directed mutagenesis by using recombinant plasmids, and transforming the mutated recombinant plasmids into escherichia coli competent cells to construct genetically engineered bacteria Rosetta (DE 3)/pET 22b-D393N for expression of cryptochrome protein of rice; at 20 ^o C180 Expression was obtained at rpm and 1mM IPTG;

the mutation primers are respectively:

D393N S: 5' CGCGGATCTGGAAAGCAATATCCTGGGCTG 3'

D393N AS: 5' TGCTTTCCAGATCCGCGTCCAGCAGCA 3'。