CN112891513A

CN112891513A - Cationic polypeptide-heat shock protein-miRNA (micro ribonucleic acid) gene complex as well as preparation method and application thereof

Info

Publication number: CN112891513A
Application number: CN202110014161.6A
Authority: CN
Inventors: 杨曌
Original assignee: Yongchuan Hospital of Chongqing Medical University
Current assignee: Yongchuan Hospital of Chongqing Medical University
Priority date: 2021-01-06
Filing date: 2021-01-06
Publication date: 2021-06-04

Abstract

The invention discloses a cationic polypeptide-heat shock protein-miRNA oncogenic complex and a preparation method and application thereof, the complex is formed by combining a cationic polypeptide, heat shock protein Grp78 and miR-125a through non-covalent bonds, can be recognized by antigen presenting cells, induces powerful anti-tumor immunity, and effectively inhibits the growth of tumor cells; the preparation method of the compound is simple, can be used for preparing tumor therapeutic gene compounds, and has good development and application prospects in the field of tumor therapy.

Description

Cationic polypeptide-heat shock protein-miRNA (micro ribonucleic acid) gene complex as well as preparation method and application thereof

Technical Field

The invention relates to a gene complex, in particular to a cationic polypeptide-heat shock protein-miRNA gene complex, and also relates to a preparation method and application of the complex.

Background

In the treatment of malignant tumors, surgery, chemotherapy and radiotherapy have been the main methods for a long time, but all have the limitations, such as low surgical resection rate, high and unpredictable and uncontrollable postoperative recurrence rate, severe damage of immune system caused by radiotherapy and chemotherapy, and the like. The method for treating the malignant tumor with safety, effectiveness and no damage is urgently sought. Recent studies suggest that loss of cellular genes, mutation, and uncontrolled cell growth are the main mechanisms of malignant tumor development. The main causes of tumors include activation of oncogenes, which are pathogenic genes and act via oncogenes, and mutation inactivation of cancer suppressor genes, and alteration of cell cycle control genes. Gene therapy has now become a hotspot in the study of tumor therapy.

Heat Shock Proteins (HSPs) are widely present in eukaryotes and prokaryotes and are highly conserved. Based on the size of relative molecular mass and the homology of amino acid sequences, the protein is mainly classified into HSP110, HSPO, HSP7O, HSP60, HSP40 and a small molecular calorimetric shock protein subfamily. In recent years, Grp78 has attracted considerable attention for its important role in tumor immunity. Grp78 expression found in various tumors can induce and enhance the anti-tumor immune response of the body and inhibit the growth of tumors. Many research results prove that HSP can induce the body to generate immune response as an ideal molecular adjuvant and play an important role in treating diseases such as virus resistance and the like. Further studies have shown that HSPs can induce immune responses in the body by: (1) the immune adjuvant HSPs can be used as a carrier of antigen peptide to assist the recognition of the antigen peptide by the immune system of the body; (2) inducing DC to mature Kuppner and the like finds that the recombined HSP7O can be combined with immature DCs, improve the expression of costimulatory molecules such as CD40, CD86, CD83 and the like, and enhance the capacity of the DCs to activate antigen-specific T lymphocytes. (3) Activating NK cells induces migration of NK cells and cytolytic effect on tumor cells. (4) Activation of the complement System Prohaszka et al found that Grp78 activates complement directly through the classical pathway, independent of antibodies.

Macromolecular drugs (e.g., proteins or genes) are of great interest compared to current small molecule anticancer drugs due to their potency and specificity. However, intracellular delivery of these macromolecular drugs is a significant challenge. The development of novel antitumor drugs with high selectivity, new action mechanism and action target and difficult multi-drug resistance has become a problem to be solved urgently. In this regard, Drug Delivery Systems (DDS) have been sought to address the dilemma faced by these drug therapies. Over the past few decades, many biomaterials that have been newly developed have attracted great interest due to their potential use in various fields. To date, these biomaterials have had a significant impact in the field of cancer therapy. In anticancer drug delivery, cationic polypeptides represented by cell-penetrating peptides (CPPs) have received much attention due to their unique mechanism of action and great promise in tumor therapy.

microRNA (miRNA) is non-coding RNA which is 20-25nt in length and is processed from a precursor with a hairpin structure and can regulate and control gene functions. In the whole development process of organisms, miRNA can regulate the early development of cells, participate in cell differentiation and tissue development, and regulate gene expression. Mirnas are involved in biological processes in the regulation of target genes in humans and mammals, primarily by binding to the 3 'untranslated region (3' UTR) of target mrnas to inhibit their protein expression. miRNA is used as eukaryotic expression regulation core, under the conditions of different cells, tissues, different developmental stages, different stimulation factors and the like, the expression of genes is accurately controlled, and once the functions of the miRNA are damaged, diseases such as tumors and the like can be caused.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a cationic polypeptide-heat shock protein-miRNA gene complex, which can be recognized by antigen presenting cells to induce potent anti-tumor immunity, does not require any adjuvant, and is not restricted by MHC when applied between species; the second purpose is to provide a preparation method of the cationic polypeptide-heat shock protein-miRNA gene complex; the third purpose is to provide the application of the cationic polypeptide-heat shock protein-miRNA gene complex in the aspect of medicine.

In order to achieve the purpose, the invention adopts the following technical scheme:

1. the cationic polypeptide-heat shock protein-miRNA gene complex is formed by combining a cationic polypeptide-heat shock protein complex Grp78 and miR-125a through non-covalent bonds, wherein the cationic polypeptide sequence has an amino acid sequence SPKLWMRWY shown in SEQ ID No. 1; the heat shock protein Grp78 has an amino acid sequence shown in SEQ ID No.6, and the miR-125a has a base sequence ucccugagacccuaacuuguga shown in SEQ ID No. 7.

Further, the cationic polypeptide-heat shock protein-miRNA molar ratio is 1: 1, and the particle size of the constructed cationic polypeptide-heat shock protein-miRNA gene complex is 20-50 nm.

2. The preparation method of the cationic polypeptide-heat shock protein-miRNA compound comprises the steps of respectively adding cationic polypeptide, heat shock protein Grp78 and miR-125a into Phosphate Buffer Solution (PBS) with the concentration of 0.02mol/L, pH of 7.2-7.4, uniformly mixing, incubating for 50 minutes at 42 ℃, and incubating for 1 hour at 37 ℃ to obtain the cationic polypeptide-heat shock protein-miRNA compound.

Further, the molar ratio of the raw materials is 1: 1 adding cationic polypeptide, heat shock protein and miRNA to make the concentration of heat shock protein Grp78 in PBS 2-5 mug/mL.

3. The application of the cationic polypeptide-heat shock protein-miRNA gene complex in preparing tumor gene complexes.

The invention has the beneficial effects that: research results show that the cationic polypeptide-heat shock protein-miRNA gene complex has good immunogenicity, and can effectively stimulate CTL to secrete interferon-gamma (IFN-gamma); and can effectively inhibit the level of POKEMON oncogene, inhibit the growth of tumor cells and improve the average survival time of tumor-bearing mice. Therefore, the complex of the invention can be activated in vivo and can be recognized by antigen presenting cells, induce strong anti-tumor immunity and effectively inhibit the growth of tumor cells; the preparation method of the compound is simple, can be used for preparing tumor therapeutic gene compounds, and has good development and application prospects in the field of tumor therapy.

Drawings

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail with reference to the accompanying drawings, in which:

FIG. 1 shows the result of agarose gel electrophoresis of PCR amplified GRP78 gene;

FIG. 2 shows the identification of GRP78 by Western Blot;

FIG. 3 is a transmission electron microscope image of the cationic polypeptide-heat shock protein-miRNA gene complex of the invention;

FIG. 4 shows the results of detection of IFN-. gamma.secretion by complex-stimulated CTL by enzyme-linked immunospot (ELISPOT) method;

FIG. 5 shows the result of the cationic polypeptide-heat shock protein-miRNA gene complex of the invention inducing apoptosis of tumor cells;

FIG. 6 shows the effect of the cationic polypeptide-heat shock protein-miRNA gene complex of the invention on tumor volume of tumor-bearing mice;

FIG. 7 shows the effect of the cationic polypeptide-heat shock protein-miRNA gene complex of the invention on the survival rate of tumor-bearing mice;

Detailed Description

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. The experimental procedures, in which specific conditions are not specified, in the preferred examples are generally carried out according to conventional conditions, for example, as described in the molecular cloning protocols (third edition, J. SammBruk et al, Huangpetang et al, scientific Press, 2002), or according to the conditions recommended by the manufacturers.

Preparation of cationic polypeptide-heat shock protein-miRNA (micro ribonucleic acid) gene complex

1. Design and Synthesis of cationic Polypeptides

The amino acid sequence of the designed cationic polypeptide is shown as SEQ ID No.1, and meanwhile, the amino acid sequence of the cationic polypeptide is shown as SEQ ID No.2 by taking an Ovalbumin (OVA) epitope peptide as a reference peptide.

The synthesis of the polypeptide was carried out on an ABI 431A solid phase polypeptide synthesizer (PE company, USA). The method employed a standard fluorenylmethyloxycarbonyl (Fmoc) protocol with arginine using two couplings. 0.125mmol of p-methylol phenoxymethyl polystyrene resin (HMP resin) is selected initially, and peptide chains are extended from carboxyl terminal to amino terminal one by one according to a polypeptide sequence, wherein the dosage of each amino acid is 0.5mmol, and the molar ratio of each amino acid to the resin is 4: 1. The alpha-amino group of each amino acid is protected by Fmoc, and the protecting groups of the other side chains are respectively as follows: lys (Boc), Ser (tBu), Glu (OtBu), Arg (Pmc), His (Trt), Thr (tBu), and Tyr (tBu). The first amino acid was attached to the resin using 4-Dimethylaminopyridine (DMAP), the amino acid was activated using 1-hydroxybenzotriazole (HOBt) and Dicyclohexylcarbodiimide (DCC), and after coupling the Fmoc protecting group was removed using 20% volume fraction piperidine in water. After polypeptide synthesis, the resin-crude peptide product is mixed in 10mL of cutting fluid A (composed of 0.75g of crystallized phenol, 0.25mL of 1, 2-Ethanedithiol (EDT), 0.5mL of thioanisole, 0.25mL of deionized water and 10mL of trifluoroacetic acid (TFA) under an ice bath condition), and after the temperature of the cutting fluid to be cut rises to room temperature, the reaction is carried out for 2 hours under stirring, so that a peptide chain is cleaved from the resin, and meanwhile, various protecting groups are removed. The reaction mixture was filtered through a G4 glass frit funnel to remove the resin, and the reaction flask, resin and funnel were repeatedly rinsed with 1mL TFA followed by 5-10 mL dichloromethane. Evaporating the filtrate to 1-2 mL at normal temperature and low pressure, adding 50mL of precooled ether to precipitate the polypeptide, standing overnight at 4 ℃, filtering by a G6 glass sand funnel, and vacuumizing to obtain a crude polypeptide product, and storing at-20 ℃ for later use.

The crude polypeptide was dissolved in dimethyl sulfoxide (DMSO) to prepare a 20mg/mL solution, which was filtered through a 0.45 μm pore size microporous membrane and purified by SOURCE gel column chromatography on an AKTA explorer 100 medium pressure liquid chromatograph (Amersham bioscience, Sweden). The mobile phase A consists of 10 volume percent of ethanol and 0.1 volume percent of TFA, and the mobile phase B consists of 90 volume percent of ethanol and 0.1 volume percent of TFA; the elution gradient was: eluting with 1.5 column volumes of mobile phase A, eluting with a mixture of mobile phase A and mobile phase B (the volume fraction of mobile phase B in the mixture gradually increases from 0% to 80% in 8 column volumes), eluting with a mixture of mobile phase A and mobile phase B (the volume fraction of mobile phase B in the mixture gradually increases from 80% to 100% in 0.5 column volumes), collecting polypeptide solution at main peak, freeze drying to obtain pure polypeptide, dissolving with DMSO, and storing at-20 deg.C for use.

The purity of the pure polypeptide is determined by a Delta 600 high pressure liquid chromatograph (Waters company, USA), a Symmetry Shield C18 column is adopted, a mobile phase consists of acetonitrile with the volume percentage of 10-60% and TFA with the volume percentage of 0.1%, and the mobile phase is eluted in a gradient way with the flow rate of 1 mL/min. The results show that the purity of the synthesized polypeptide reaches more than 90 percent. Meanwhile, the pure polypeptide product is used for measuring the molecular weight by an API 2000LC/MS type electrospray ionization mass spectrometer. The results show that the molecular weights of the synthesized polypeptides all agree with theoretical values.

2. Preparation of GRP78

(1) Cloning of the GRP78 Gene

According to the GRP78 gene sequence with GenBank accession number NC-000009.12 and the multiple cloning site of eukaryotic expression vector pcDNA3.1, the following PCR primers are designed and synthesized to amplify the full length of GRP78 cDNA with restriction enzyme sites at both ends: f2: 5' -accggatcctaaaatagttcgcaaa-3' (SEQ ID No.3), the underlined part is the BamHI site; r2: 5' -gtacagtctagatgatgtgaagttaatgg-3' (SEQ ID No.4), the XbaI cleavage site is underlined; carrying out PCR by taking a plasmid containing the full length of GRP78 cDNA as a template and F2 and R2 as upstream and downstream primers under the following conditions: pre-denaturation at 94 ℃ for 4 min, then denaturation at 94 ℃ for 30 sec, annealing at 58 ℃ for 30 sec, extension at 72 ℃ for 2.5 min for 30 cycles, and final extension at 72 ℃ for 10 min; and identifying the PCR product through agarose gel electrophoresis, and cutting, recovering and purifying the gel by a gel recovery kit.

The agarose gel electrophoresis result of the PCR product is shown in FIG. 1, wherein lane M is a DNA molecular weight standard, lane 1 is a PCR product, and it can be seen that the PCR product shows a single specific band at about 2000bp, which is consistent with the size of the target fragment.

(2) Construction of GRP78 eukaryotic expression vector

The purified PCR product and eukaryotic expression vector pcDNA3.1 are respectively double digested by BamH I and Xba I, the full length of GRP78 cDNA after double digestion is recovered by gel recovery kit gel cutting and is connected with linearized vector pcDNA3.1 overnight at 16 ℃, the connection product is transformed into colon bacillus TOP10 competent cells, LB plate containing ampicillin is used for screening positive clone, positive clone plasmid is extracted, BamH I and Xba I are used for double digestion identification, Shanghai's company is entrusted to determine plasmid sequence, and the positive clone plasmid inserted with GRP78 cDNA full length sequence (SEQ ID No.5) is named as GRP78 eukaryotic expression vector pcDNA3.1-GRP 78.

(3) Preparation of GRP78 engineering bacteria

The preparation method comprises the steps of carrying out enzyme digestion on a GRP78 eukaryotic expression vector pcDNA3.1-GRP78 by SalI to linearize, transforming pichia pastoris GS115 competent cells by an electroporation method, coating a transformed product on an MD (MD) plate, culturing for 3-4 days at 30 ℃, selecting white yeast colonies, respectively dotting the white yeast colonies on the MD plate and an MM plate, culturing for 3-6 days at 30 ℃ (100 mu L of methanol is added into the MM plate every day), selecting yeast colonies which grow obviously faster than the MM plate on the MD plate, dotting the yeast colonies on a YPD plate containing G418 with the concentration of 4mg/mL, culturing for 7 days at 30 ℃, and obtaining a single yeast colony which is a high-copy GRP78 engineering bacterium.

(4) Inducible expression of GRP78

Culturing high copy GRP78 engineering bacteria at 30 deg.C until OD600 is 2, inoculating into BMGY culture medium at 10%, culturing at 30 deg.C for 24 hr, centrifuging for 5 minutes at 5000g, discarding the supernatant, washing the thallus with sterile water for 2 times, suspending in BMMY culture medium with the same volume, performing induced expression at 30 ℃ for 3 days (adding inducer methanol every 24 hours till the final volume percentage concentration is 0.5%), centrifuging at 4 ℃ for 5 minutes at 6000G, collecting the supernatant, adding ammonium sulfate with the mass percentage concentration of 80% to precipitate proteins, centrifuging and discarding the supernatant, dialyzing the protein precipitate by PBS with the concentration of 0.02mol/L, pH of 8.0 to desalt, separating and purifying by using a Q-Sepharose column, performing linear gradient elution by using a sodium chloride solution with the concentration of 1mol/L, collecting eluent containing GRP78, desalting by using a Sephadex G-25 column after proper concentration to obtain the purified GRP78 (the amino acid sequence is shown as SEQ ID No. 6).

Western Blot identification: taking purified GRP78, adding internal reference beta-actin and a sample loading buffer solution, heating for 3-5 minutes at 100 ℃, performing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) by using separation gel with the mass percentage concentration of 12% and lamination gel with the mass percentage concentration of 5%, after electrophoresis is finished, electrically transferring a separation product onto a PVDF (polyvinylidene fluoride) membrane, sealing the membrane by using degreased milk with the mass percentage concentration of 5%, adding a mouse anti-human GRP78 monoclonal antibody and a mouse anti-human beta-actin monoclonal antibody, incubating for 1 hour at 37 ℃, washing the membrane, adding rabbit anti-mouse IgG labeled by horseradish peroxidase, incubating for 1 hour at 37 ℃, washing the membrane, and developing; a negative control was also set (no purified GRP78 added); the results are shown in FIG. 2, wherein lane 1 is purified GRP78, lane 2 is a negative control, and lane 1 shows a distinct protein band in addition to the internal reference beta-actin band, while lane 2 shows no corresponding band.

3. Preparation of cationic polypeptide-heat shock protein-miRNA (micro ribonucleic acid) gene complex

In Phosphate Buffer Solution (PBS) with the concentration of 0.02mol/L, pH of 7.2-7.4, the molar ratio is 1: 1 adding cationic polypeptide: the heat shock protein Grp78 and the miR-125a enable the concentration of the heat shock protein Grp78 in PBS to be 2-5 mu g/mL, the mixture is uniformly mixed, the mixture is incubated for 50 minutes at 42 ℃, and then the incubation is carried out for 1 hour at 37 ℃, so as to obtain the cationic polypeptide-heat shock protein-miRNA compound.

Transmission electron microscopy analysis: dropping the new-prepared compound on a 200-mesh copper net, adsorbing for 3 minutes, blotting the new-prepared compound by using absorbent paper, airing for 30 seconds, carrying out negative dyeing on the new-prepared compound by using a 1% by mass volume aqueous solution of uranium acetate for 30 seconds, blotting the new-prepared compound by using the absorbent paper, airing for 30 seconds, and observing by using a 80kV transmission electron microscope. As shown in FIG. 3, the obtained composite was in the form of nearly circular particles with uniform size, and the major diameter of the particles was 20 to 50 nm.

Research on anti-tumor growth of cationic polypeptide-heat shock protein-miRNA (micro ribonucleic acid) gene complex

Preparation of effector cells: 30 female HBV transgenic Babl/c mice 6-8 weeks old were randomly divided into 3 groups: experimental, control and blank groups of 10 individuals each; respectively dissolving the cationic polypeptide-heat shock protein-miRNA gene complex and the OVA-GRP78-miRNA complex (the ovalbumin and the GRP78 are prepared by the method in the step 3) with PBS (phosphate buffer solution) with the concentration of 0.1mol/L, pH of 7.4 to prepare a solution with the concentration of 0.5 mg/mL; the experimental group takes cationic polypeptide-heat shock protein-miRNA complex solution with concentration of 0.5mg/mL as immunogen, the control group takes OVA-GRP78-miRNA complex solution with concentration of 0.5mg/mL as immunogen, and the blank group takes PBS with concentration of 0.1mol/L, pH of 7.4 as immunogen; each group was given 100. mu.L of each immunogen subcutaneously to the roots of the dorsal cauda of mice, followed by 1-week intervals by 1 booster immunization in the same manner for 3 total immunizations.

1. ELISPOT method for detecting capability of cationic polypeptide-heat shock protein-miRNA gene complex for stimulating CTL to secrete IFN-gamma

1 week after the last immunization, the mice were sacrificed by cervical dislocation, spleens were removed under aseptic conditions, ground with a 100 mesh screen, cell suspensions were collected, and centrifuged with a polysucrose-diatrizoate stratified liquid density gradientThe method comprises separating splenic lymphocyte, regulating cell density to 1 × 10 with RPMI 1640 culture medium containing 10% fetal calf serum⁶Per mL as effector cells; detecting by using an ELISPOT detection kit according to the kit instruction: adding 100 μ L of ethanol with a volume percentage concentration of 70% into each well of a 96-well culture plate, standing at room temperature for 10 minutes, washing with PBS, adding 100 μ L of IFN-gamma capture antibody (dilution of 1: 100), incubating overnight at 4 ℃, washing with PBS, adding 100 μ L of skimmed milk powder with a mass percentage concentration of 2%, blocking at room temperature for 2 hours, washing with PBS, adding 100 μ L of effector cells, incubating at 37 ℃ for 48 hours, washing with PBST (PBS containing 0.1% by mass of Tween 20), adding 100 μ L of biotin-labeled anti-IFN-gamma antibody (dilution of 1: 100), incubating at 37 ℃ for 1.5 hours, washing with PBST, adding 100 μ L of streptavidin-labeled alkaline phosphatase (dilution of 1: 5000), incubating at 37 ℃ for 1 hour, washing with PBST, drying the culture plate, adding 100 μ L of instant BCIP/NBT substrate reaction solution, developing in a dark place at room temperature for 2-10 minutes until spots are formed, terminating the reaction with distilled water, and detecting the number of the spots after drying; negative controls (no effector cells added) were also set, and the number of spots in each set was expressed as the mean of 3 replicate wells.

The result is shown in figure 4, the number of spots in the experimental group is obviously higher than that in the control group, the blank group and the negative control group, and the result shows that the cationic polypeptide-heat shock protein-miRNA gene complex has good immunogenicity and can effectively stimulate CTL to secrete IFN-gamma.

2. Detection of Activity to induce apoptosis in tumor cells

The experiments were randomly divided into three groups: control group I, control group II and experimental group, control group I treated CT-26 cells (mouse colon cancer cells) with PBS; treating CT-26 cells with OVA-GRP78-miRNA complex in control group II; the experimental group treats CT-26 cells with the cationic polypeptide-heat shock protein-miRNA gene complex, after 48 hours of co-culture, PBS is used for washing, 5 mu L of Fluorescein Isothiocyanate (FITC) labeled phospholipid binding protein V (annexin V) with the concentration of 250 mu g/mL and 5 mu L of Propidium Iodide (PI) with the concentration of 250 mu g/mL are added, ice bath is used for dark incubation for 10 minutes, PBS is used for washing, and FACS Calibur flow cytometry is used for detecting the apoptosis condition: normal living cells Annexin V and PI are low-stained; apoptotic cells Annexin V are highly stained and PI is lowly stained; necrotic cells were highly stained for Annexin V and PI.

The results are shown in figure 5, the apoptosis rate of the control group I is 7.1%, the apoptosis rate of the control group II is 8.9%, and the apoptosis rate of the experimental group is 52.3%, which indicates that the cationic polypeptide-heat shock protein-miRNA gene complex can effectively induce the apoptosis of tumor cells.

3. In vivo inhibition of tumor cell growth assay

Tumor-bearing nude mice were randomly divided into three groups: a control group I, a control group II and an experimental group, wherein the tail vein of the control group I is injected with normal saline; the tail of the control group II is injected with OVA-GRP78-miRNA compound; injecting the cationic polypeptide-heat shock protein-miRNA gene complex into tail vein of experimental group; survival rates and tumor volumes of the groups of mice within 60 days were observed, and tumor growth curves were plotted.

The results are shown in FIGS. 6 and 7: compared with the control group I and the control group II, the tumor growth of the mice in the experimental group is slow, and the survival rate of the mice in the experimental group is high.

Finally, it is noted that the above-mentioned embodiments illustrate rather than limit the invention, and that, while the invention has been described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

1. A cationic polypeptide-heat shock protein-miRNA gene complex, which is characterized in that: the gene complex is a delivery carrier and adjuvant taking a cationic polypeptide-heat shock protein complex Grp78 as miR-125 a.

2. The cationic polypeptide-heat shock protein-miRNA gene complex of claim 1, wherein: the molar ratio of the cationic polypeptide to the heat shock protein to the miRNA is 1: 1, the particle size of the constructed cationic polypeptide-heat shock protein-miRNA gene complex is 20-50 nm.

3. The method for preparing the cationic polypeptide-heat shock protein-miRNA complex of claim 1, wherein the method comprises the following steps: respectively adding cationic polypeptide, heat shock protein Grp78 and miR-125a into Phosphate Buffer Solution (PBS) with the concentration of 0.02mol/L, pH of 7.2-7.4, uniformly mixing, incubating for 50 minutes at 42 ℃, and incubating for 1 hour at 37 ℃ to obtain the cationic polypeptide-heat shock protein-miRNA compound.

4. The method for preparing the cationic polypeptide-heat shock protein-miRNA complex of claim 3, wherein the method comprises the following steps: the molar ratio of the raw materials is 1: 1 adding cationic polypeptide, heat shock protein Grp78 and miR-125a to ensure that the concentration of the heat shock protein Grp78 in PBS is 2-5 mu g/mL.

5. The use of the cationic polypeptide-heat shock protein-miRNA complex of claim 1 in the preparation of a tumor gene therapy vector.