CN112877224B

CN112877224B - Low-temperature-resistant oil-producing yeast separated from Usnea indica (L.) kurz and application thereof

Info

Publication number: CN112877224B
Application number: CN202110244259.0A
Authority: CN
Inventors: 李俊; 赵心清; 章漳; 白龙
Original assignee: Jala Group Co; Shanghai Jiaotong University
Current assignee: Shanghai Natural Hall Group Co ltd; Shanghai Jiaotong University
Priority date: 2021-03-05
Filing date: 2021-03-05
Publication date: 2022-11-22
Anticipated expiration: 2041-03-05
Also published as: CN112877224A

Abstract

The invention discloses a low temperature resistant oil-producing yeast separated from Usnea indica Tibet and application thereof; the strain has excellent performance of producing grease under low temperature. The oil content and component detection shows that the strain can accumulate a large amount of oil by utilizing various different carbon sources such as glucose, glycerol, xylose and the like at the temperature of 20 ℃, wherein the oil accumulated under the condition that xylose is the only carbon source is the most, and about 57.66 percent of dry cell weight of the oil can be accumulated; under the condition of taking glucose and glycerol as carbon sources, the oil and fat with the cell dry weight of 45.45 percent and 41.85 percent can be respectively accumulated. Fatty acid analysis results show that fatty acid of the strain contains more C18:2 fatty acid linoleic acid, and can be used as a medical intermediate, and in addition, the strain can simultaneously utilize glucose and xylose to accumulate grease, and has the potential of utilizing lignocellulose biomass hydrolysate to produce microbial grease.

Description

Low-temperature-resistant oil-producing yeast separated from Usnea indica (L.) kurz and application thereof

Technical Field

The invention belongs to the field of microbial resources and application, and relates to a low-temperature-resistant oil-producing yeast (C.rogersiii) separated from Usnea indica Tibet and application thereof.

Background

Microbial Oils, also known as Single Cell Oils (SCOs), are lipids that utilize microorganisms such as bacteria, yeast, and molds, and are more sustainable lipid sources. At present, various microorganisms are known to produce high-value microbial oil by utilizing various cheap low temperatures, including saccharides, animal and plant waste oil, crop straw hydrolysate and the like. Some microbial oil hydrolysis can produce high value fatty acids, including polyunsaturated fatty acids with two or more double bonds and carbon chain lengths of 18 to 22 carbon atoms, including linoleic (C18: 2) and linolenic acids, and the like. Wherein linoleic acid is essential fatty acid, and has effects of preventing hypercholesterolemia, improving hypertension, and preventing myocardial infarction, cholelithiasis and arteriosclerosis.

China has abundant lignocellulose biomass resources, and the renewable biomass resources are utilized to produce high-value bio-based chemicals, so that the method has important significance for sustainable development. The biomass resource contains cellulose and hemicellulose components, and can hydrolyze to generate glucose and xylose which can be utilized by microorganisms, and the glucose and xylose are further metabolized by the microorganisms to synthesize grease and other various chemicals. Therefore, attention has been paid to the research and application of producing microbial oil by using fermentable sugars such as glucose and xylose.

It is known that some oleaginous yeasts can convert xylose into lipid with a conversion rate of more than 20% of their dry cell mass (DCW), including Rhodotorula glutinis (bioreagent technol.2009,100 (1): 356-61), trichosporon fermentum (bioreagent technol.2008,99 (16): 7881-5), rhodotorula toruloides (Rhodotorula toruloides) (applied Microbiol Biotechnol.2018,102 (1): 143-51), etc., and it is important to explore other novel microbial resources for producing microbial oils from xylose.

The yeast of the genus Curvibasidium was first reported in 2004, and the species was isolated in the grape skin and soil, and found to be present in a high amount in the leaf plane of vascular plants (International Journal of Food Microbiology,2019, 154-161 curr microbiol,2015, 70.

The invention relates to a Curvibasidium yeast strain C.rogersii JBA-MBY-JT231 which is firstly reported in China and is separated, purified, identified and identified from an usnea sample collected in the Tibet region, wherein the strain can utilize a plurality of carbon sources including xylose to produce grease at low temperature. The intracellular grease content and components of the yeast are analyzed, and the yeast can utilize xylose and glucose to produce grease, so that the development potential of the yeast in different fields is shown.

Disclosure of Invention

The invention aims to provide a low-temperature-resistant oil-producing yeast (C.rogersiii) separated from Usnea tibetana and application thereof. The strain Curvibacilli rogenici (also called C.rogersii) has strong capability of accumulating grease at low temperature and can accumulate more high-value C18:2 fatty acids, and has great application potential in the aspect of development of producing microbial grease by utilizing lignocellulose biomass resources.

The invention relates to a Tibetan-derived wild yeast strain Curvibasidium rogencii JBA-MBY-JT231 which is already preserved in China general microbiological culture Collection center (CGMCC) at 12 months and 10 days in 2020, and has the address: the collection number of the microorganism research institute of Chinese academy of sciences, no.3 Xilu No.1 of Beijing, chaoyang, and the institute of microorganisms is CGMCC No.21346. The taxonomic name is Curvibasidium rogersii, and survival is detected.

The single colony of the C.rogersii strain JBA-MBY-JT231 related by the invention is cream-colored to light yellow, the edge is smooth, the single colony is slightly reflective, the colony is raised and is easy to pick up, and the cells under a microscope are oval and elliptical. It was identified as c.rogersii and named JBA-MBY-JT231 by observation of cell morphological characteristics, sequencing based on this molecular marker of ITS region and 26S D1/D2 sequence in the fungal genome and by alignment analysis with the NCBI database blastn. It is separated from Usnea, a Tibetan plant, and can effectively utilize glucose and xylose to produce oil and fat at the temperature of 4-25 ℃, most preferably 20 ℃.

The separation, purification and screening processes of the JBA-MBY-JT231 strain are as follows: soaking a sample in 75% ethanol, disinfecting the surface of the sample, washing the disinfected sample with normal saline, coating eluent on a YPD solid medium plate as a negative control, considering that microorganisms on the surface of the sample are killed if no microorganisms grow in the control, mashing the sample to obtain a sample homogenate containing endophytes, diluting the sample homogenate with normal saline, coating the sample homogenate on the solid medium plate, and setting the temperature of an incubator to be 15 ℃ in order to screen low-temperature-resistant microorganisms. And then picking the bacterial colony on the plate to a new YPD plate for streak culture, picking the single bacterial colony after obtaining the single bacterial colony, streaking again, and repeating for three times to obtain the low-temperature-resistant JBA-MBY-JT231 bacterial strain.

The purpose of the invention is realized by the following technical scheme:

in the first aspect, the invention relates to a yeast strain Curvisadium rogersii JBA-MBY-JT231, and the preservation number is CGMCC No.21346.

In a second aspect, the invention relates to the use of a yeast strain Curvibasidium rogersii JBA-MBY-JT231 in the production of lipids.

As one embodiment, the yeast strain produces oil under cryogenic conditions.

As an embodiment, the low temperature is 4-25 ℃.

As one embodiment, the yeast strain utilizes one or more of glucose, glycerol, xylose, sucrose, inulin and ethanol as a carbon source to produce the grease.

As one embodiment, the oil is predominantly C18 unsaturated fatty acid.

As one embodiment, the fats and oils are C18:1 fatty acids and C18:2 fatty acids.

As one embodiment, the yeast strain produces C18:1 and/or C18:2 unsaturated fatty acids using one or more of glucose, xylose, sucrose, ethanol, inulin as a carbon source.

As one embodiment, the yeast strain produces oil and fat by using lignocellulose hydrolysate (main components after hydrolysis: glucose and xylose) as a carbon source.

In a third aspect, the invention relates to the use of a yeast strain, curvisadium rogersii JBA-MBY-JT231, in the conversion of grease by using lignocellulosic biomass.

Compared with the prior art, the invention has the following beneficial effects:

1) The C.rogersii strain capable of producing grease at low temperature is separated and screened from different strains, and the capability of accumulating grease at low temperature is realized;

2) A C.rogersii strain is activated by liquid, and can accumulate a large amount of grease when being fermented for 2-10 days, most preferably 9 days under the conditions of 4-25 ℃, most preferably 20 ℃ by respectively taking glucose, glycerol and xylose carbon sources as fermentation culture media;

3) The invention determines the components of grease accumulated by a C.rogersii strain, mainly accumulates C18 grease, and can accumulate more high-value C18:2 grease compared with the widely lipolyticed Saccharomyces cocoanum ATCC201249 researched at present;

4) The C.rogersii strain can naturally utilize main components glucose and xylose after lignocellulose hydrolysis to produce grease, and shows potential application capability of the strain in the field of high-efficiency conversion of lignocellulose biomass energy;

5) The C.rogersii strain can utilize glucose, xylose and glycerol to accumulate a large amount of grease under the condition of low temperature, and has high value and research potential in future industrial application.

Drawings

FIG. 1 colony morphology of the strain on YPD plates and cell morphology under 400-fold microscope;

FIG. 2 is a photograph of a plate of JBA-MBY-JT231 ((3) -2B) and S288C as a control strain cultured in YPD solid medium at different temperatures for 72 hours; wherein, 10 ℃ (A), 15 ℃ (B), 20 ℃ (C), 25 ℃ (D);

FIG. 3 fluorescent photograph of JBA-MBY-JT231 stained with Nile Red under confocal laser microscopy

Detailed Description

The present invention will be described in detail with reference to examples. The following examples will aid those skilled in the art in further understanding the present invention, but are not intended to limit the invention in any manner. It should be noted that it would be apparent to those skilled in the art that several modifications and improvements can be made without departing from the inventive concept. All falling within the scope of the present invention.

Example 1 screening and biological identification of Low temperature resistant Yeast strains

1) Screening of Low temperature resistant Yeast strains

Collecting plant and soil samples at different geographical positions in Tibet plateau, washing the samples with normal saline to obtain eluent, and coating the eluent on a YPD solid culture medium flat plate to separate microorganisms on the surface of the samples. Soaking a sample in 75% ethanol, disinfecting the surface of the sample, washing the disinfected sample with normal saline, coating an eluent on a YPD solid culture medium flat plate as a negative control, considering that microorganisms on the surface of the sample are killed if no microorganisms grow in the control, mashing the sample to obtain a sample homogenate containing endophytes, diluting the sample with normal saline, coating the sample on the solid culture medium flat plate, and setting the temperature of an incubator to be 15 ℃ in order to screen low temperature resistant microorganisms. And then picking the bacterial colony on the plate to a new YPD plate for streak culture, picking the single bacterial colony for streak culture again after obtaining the single bacterial colony, and repeating for three times to obtain the low temperature resistant bacterial strain. The low temperature resistant JBA-MBY-JT231 strain of this example was isolated from a Usnea sample collected at an altitude of 4220 m (94 DEG 45 '55' east longitude and 29 DEG 40 '21') in Tibet region of China.

2) Identification of the rogersii Strain

The formula of the culture medium is as follows (sterilization conditions are 115 ℃ and 20 min),

YPD liquid medium (1L): 10g of yeast powder, 20g/L of peptone and 20g of glucose. And (5) autoclaving.

YPD solid Medium (1L): 10g of yeast powder, 20g/L of peptone, 20g of glucose and 20g of agar. And (5) autoclaving.

YPD fermentation medium (1L): 10g of yeast powder, 10g/L of peptone and 40g of glucose. And (5) autoclaving.

YPX fermentation medium (1L): 10g of yeast powder, 10g/L of peptone and 40g of xylose. And (5) autoclaving.

YPG fermentation medium (1L): 10g of yeast powder, 10g/L of peptone and 40g of glycerol. And (5) autoclaving.

Observing the cell state of the low-temperature yeast strain under a 400 Xmicroscope after culturing the low-temperature yeast strain in a YPD plate for about 7 days; the cells are oval and elliptical, and the cell size is (3.1-4.2X 1.3-2.3) μm. The vegetative propagation mode is unilateral budding.

A micrograph of the strain at YPD under 400-fold microscope is shown in FIG. 1.

And (3) extracting the genome of the strain, and performing classification identification of ITS sequence and 26S D1/D2 sequence sequencing. Genome-specific PCR amplification was performed with fungal ITS universal primers (forward ITS1:5'-TCCGTAGGTGAACCTGCGG-3' SEQ ID NO.3; reverse ITS4:5'-TCCTCCGCTTATTGATATGC-3' SEQ ID NO.4) and 26S D1/D2 universal primers (forward 26s-F:5 '-GCATATCAATAAGGCGGAGAAAAG-3' SEQ ID NO.5; reverse 26s-R:5 '-GGTCCGTGTTTCAAGACGGG-3' SEQ ID NO.6). The ITS sequence and 26S D1/D2 sequence were finally determined and aligned for Blastn (http:// blas-t.ncbi.nlm.nih.gov/blast.cgi) homology and the results identified are shown in Table 1, which has a high degree of similarity to the sequence of C.rogersii (GenBank accession number: JX 188232.1), thus identifying this strain as C.rogersii.

TABLE 1D 1/D2 sequence and ITS sequence differences of JBA-MBY-JT231 and ITS most similar strains

The sequences of partial ITS and 26S D1/D2 of the strain JBA-MBY-JT231 are as follows:

JBA-MBY-JT231 ITS sequence SEQ ID No.1:

TCATTTTCCAACTCTGTGCACTATTGGCGGACTGGCAGTAAGAAATTACTATTCAGTCTGCGGCTCACTATTAAACATTAGTTAAAGTATGTATATAAAAACAAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCTCTGGTATTCCGGAGAGTATGTCTGTTTGAGTGTCATGAACTCTTCAACCTACCGATTTCTAGTAAATCGGATTAGTGTTTGGATTCTGAACGTCTGCTGGCCTTTATTGGCGAAGCTCGTTCGTAAATGATTAGCATCTCATATTCGAAAATCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACGCTCTTTCGGGAGTGGCCGAGTTTTGTAAAGTAGAAGCTTCTAACTCTATTAGTCAACTTTAGATTAGACCTCAGATCAGGCAGGATTACCCGCTGAACTTAAGCATA

JBA-MBY-JT231 26S rDNA D1/D2 sequence SEQ ID NO.2:

TTGTAATCTGGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGCGCCGGACTGCATACAAGTCTGTTGGAATACAGCGTCATAGTGGTGAGAACCCCGTAACTGATGCAGATGCCCGGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGATTGAAGTCAGACTTGTTATCTGGAGTTCAGCCTTTAGGTGTACTCTCCAGTTTACAGGCCAGCATCAGTTTTTGGGGCGGGAAAATCGTAATTAGAAGGTAGCAGCCTAGCTGTGTTATAGCTTTTTACTGGATTCCGCTTCGGGGACTGAGGAATGCAGTGTGCTTTTAGCAATACCTTCGGGTATTTCACACTTAGGA

the strain JBA-MBY-JT231 of the invention has morphological characteristics and culture: after culturing for 7d on an YPD plate at 15 ℃, the single colony is cream-colored to faint yellow, has smooth edge, is slightly reflective, and is easy to pick up. Microscopic characteristics: after 7 days of YPD plate culture, the cells were oval or elliptical in shape and (2.5-4.3X 1.3-2.3) μm in size. The vegetative propagation mode is unilateral budding. Rogersii JBA-MBY-JT231 showed better growth status in low temperature environment than model yeast s288c, was able to accumulate fats and oils using various carbon sources including glucose, glycerol and xylose, and had a higher proportion of linoleic acid in the fat and oil content than the control strain, lipolytica.

The different carbon source assimilation abilities of the two strains were tested and compared with the most closely related strains c.rogersii, c.cygneicolum, r.nothofiagi and c.pallidicorallinum in the phylogenetic tree, and the results are shown in table 2 below:

TABLE 2 JBA-MBY-JT231 carbon source assimilation test results and comparison

^* Y231 is the abbreviation of JBA-MBY-JT231, +, strongly assimilated; -dissimilation, s, slow assimilation; l, delayed assimilation; w, weak assimilation; v, part of the strains are assimilable, and part of the strains are not assimilable; n, no data.

2. The data source is as follows: north American Fungi,2012,7 (12): 1-8.

3. The data source is as follows: the Yeasts,5th edition, edited by P.kurtzmman C, W.Fell J, boekhout T.Elsevier, 2011.

In carbon source assimilation experiments, the JBA-MBY-JT231 strain can assimilate glucose, mannitol, glycerol (slow assimilation), rhamnoides (weak assimilation), xylitol, sucrose, raffinose (weak assimilation), xylose (slow assimilation), D-arabinose (delayed assimilation), sorbose, N-acetylglucosamine (weak assimilation), inulin, trisaccharide (weak assimilation), salicin, ethanol, gluconolactone, and succinic acid. None assimilate lactose, maltose, erythritol, trehalose, ribose, gluconate, soluble starch, cellobiose, lactic acid, methanol, inositol and hexadecane, many of which are different from the most similar species c.

The nitrogen source assimilation ability of both strains was examined and compared with c.rogersii, c.cygneicolum, r.nothofiagi and c.pallidicorallinum, which are the closest relatives in phylogenetic trees, and the results are shown in table 3 below:

TABLE 3 JBA-MBY-JT231 nitrogen source assimilation test results and comparison

Name(s)	Y231	C.rogersii ²	C.cygneicollum ³	R.nothofagi ³	C.pallidicorallinum ³
						Nitrate salt	-	-	-	-	-
Benzoxazine hydrochloride	-	-	N	N	N
						L-lysine	+	+	N	N	N

^* 1.+, strong assimilation; -asynchronism, s, slow assimilation; l, delayed assimilation; w, weak assimilation; v, part of the strains are assimilable, and part of the strains are not assimilable; n, no data.

2. The data source is as follows: north American Fungi,2012,7 (12): 1-8.

In the nitrogen source assimilation experiment, the Y231 strain can assimilate L-lysine, and can not assimilate nitrate and benoxazine hydrochloride. Consistent with the closest species c.

Example 2 Low temperature resistance of JBA-MBY-JT231

The invention determines the low temperature resistance of JBA-MBY-JT231.

The method comprises collecting preserved strain JBA-MBY-JT231 and 10. Mu.l of S288C as a control were cultured in a 5ml centrifuge tube (containing 1ml YPD), JBA-MBY-JT231 was cultured at 20 ℃ and 150rpm, and S288C was cultured at 30 ℃ and 150 rpm. When the strain grows to OD600 of about 1, secondary activation is carried out, namely 200. Mu.l of the cultured strain is taken and continuously cultured in a centrifuge tube of 5ml (containing 1ml YPD). When the bacterial strain grows to OD600 of 0.6-0.8, 3) adjusting the bacterial liquid OD600 to 1, taking 100 mu l of bacterial liquid, and respectively diluting 10 percent of bacterial liquid with water ¹ ,10 ² ,10 ³ ,10 ⁴ After 105-fold incubation, 2. Mu.l of each of the bacterial suspension was spotted on YPD solid medium, and the results of the experiment are shown in FIG. 2. JBA-MBY-JT231 has good low temperature resistance, the growth condition of the JBA-MBY-JT231 is obviously better than that of a control strain under the condition of culturing for 72 hours at 10 ℃ and 15 ℃, the strain has poor tolerance to high temperature, and the JBA-MBY-JT231 grows obviously worse than that of the control strain and can not grow basically under the condition of culturing for 72 hours at 25 ℃.

Example 3 intracellular fluorescence Signal after staining JBA-MBY-JT231 with Nile Red

The invention measures the intracellular fluorescent signal of JBA-MBY-JT231 after Nile red dyeing

Specifically, JBA-MBY-JT231 strain is subjected to static culture on a YPD solid culture medium plate for 4-25 ℃, most preferably 15 ℃ for 2-10 days, most preferably 9 days by using a plate streaking method, colonies are picked and diluted in sterile water, prepared 0.5mg/ml nile red dye is added into a bacterial liquid at a ratio of 1/1000, lipid drops in the strain body are stained in a dark environment for 5min, and a fluorescence signal in a cell is observed by using a laser confocal microscope with the fluorescence intensity of an excitation wavelength of 488nm and an emission wavelength of 570nm, and the result is shown in figure 3.

Intracellular fluorescence signal intensity of the identified C.rogersii strain after nile red staining shows that the yeast strain has the potential of accumulating a large amount of grease at low temperature by using glucose as a substrate.

Example 4 JBA-MBY-JT231 intracellular lipid content

The invention determines the intracellular lipid content of JBA-MBY-JT231.

The method comprises the following specific steps of taking 10 mu l of a preserved strain JBA-MBY-JT231 and a strain lipolytic yarrowia cocoata (YL-CON) with a preservation number of ATCC201249 as a control strain, culturing the strain JBA-MBY-JT231 at the speed of 20 ℃ and culturing the strain YL-CON at the speed of 150rpm in a 5ml (containing 1ml YPD) centrifuge tube, respectively adding the strain into 100ml YPD, YPX and YPG fermentation culture media when the strain grows to the OD600 of about 1, culturing the strain JBA-MBY-JT231 at the speed of 20 ℃ and culturing the strain YL-CON at the speed of 150rpm at the speed of 30 ℃, centrifuging the strain at the speed of 8000rpm after 9 days, collecting thalli, washing twice with sterile water, removing supernatant, quickly freezing the cells by using liquid nitrogen, and freezing and drying the cells by using a centrifuge. 100mg of the dried cells were taken out separately in 50ml centrifuge tubes, then 10ml of 4M HCl solution was added, incubated for 2h in a water bath at 60 ℃, and the acid hydrolyzed biomass was mixed with 15ml of chloroform/methanol 2:1 (v/v%) mixture, and incubated for 2h at room temperature in a shaker at 160rpm, then the sample was centrifuged at 4000rpm for 10min, the upper chloroform layer was added to a 50ml centrifuge tube after oven-drying and weighing, the organic phase was evaporated in a water bath at 60 ℃ and finally dried to constant weight at 55 ℃. The intracellular lipid content was calculated by ω = W1/W2 x 100%, where ω is the total lipid content (%), W1 is the lipid content (g), and W2 is the dry weight of the cells before extraction (g), and the results are shown in table 4.

TABLE 4 lipid content of JBA-MBY-JT231 in different carbon source media

Name (R)	Cell Dry weight (mg)	Weight of oil (mg)	Total lipid content (%)
				YL-CON-YPD	103±1.00	69.95±7.45	67.85±6.57
YL-CON-YPG	101±1.00	54.05±3.95	53.56±4.44
				JBA-MBY-JT231YPD	102.5±0.5	46.6±2.8	45.45±2.51
JBA-MBY-JT231YPG	103.35±1.95	43.25±0.85	41.85±0.04
				JBA-MBY-JT231YPX	105.15±2.15	60.65±2.55	57.66±1.25

^* YPD means that the carbon source was glucose, the carbon source in YPG was glycerol, the remainder was the same as YPD, the carbon source in YPX was xylose, and the remainder was the same as YPD. YL represents yarrowia lipolytica and CON represents control.

The intracellular lipid content result of the strain C.rogersii identified by the invention shows that the strain C.rogersii can be used as a microbial factory for producing grease by using one or more of glucose, xylose, sucrose, ethanol and inulin as carbon sources. The oleaginous yeast can respectively accumulate oil accounting for 45.45%, 41.85% and 57.66% of dry cell weight by using three carbon sources of glucose, glycerol and xylose at low temperature, which also shows that the oleaginous yeast has potential application prospect and value in the process of high-efficiency conversion of biomass resources.

Example 5 analysis of intracellular lipid composition of JBA-MBY-JT231

The invention determines the intracellular lipid component of JBA-MBY-JT231

The specific steps are that 100mg of cells dried by JBA-MBY-JT231 and a reference strain YL-CON are respectively taken, 5ml of 15% sulfuric acid-methanol is added into a test tube, the test tube is shaken every a period of time in a water bath at 70 ℃ for 1 hour in a closed test tube, and then 0.75ml of ddH is added after the test tube is condensed to 10 DEG C ₂ And O, adding 2ml of n-hexane, uniformly mixing, centrifuging at 4000rpm for 10min, taking the supernatant, and determining the composition of fatty acid methyl ester by using gas chromatography-mass spectrometry. The results are shown in tables 5 and 6.

TABLE 5 lipid composition of control Strain YL-CON in different carbon source media

TABLE 6 lipid composition of JBA-MBY-JT231 Strain in different carbon source Medium

* Data show mean ± standard deviation in percent, n.d. represents no detection; YPD means that the carbon source was glucose, the carbon source in YPG was glycerol, the remainder was the same as YPD, the carbon source in YPX was xylose, and the remainder was the same as YPD. YL represents yarrowia lipolytica and CON represents control.

It can be seen from the table that JBA-MBY-JT231 and the control strain, lipolytica, saccharomyces cocoanum (YL-CON) accumulated mainly C18 fatty acids, and JBA-MBY-JT231 accumulated more C18:2 fatty acids in the cells than YL-CON.

The results of intracellular lipid components of the C.rogersii strain identified by the invention show that JBA-MBY-JT231 can accumulate a large amount of C18 unsaturated fatty acids by using one or more of glucose, xylose, sucrose, ethanol and inulin as carbon sources, and has a very high application prospect.

In conclusion, the invention separates a yeast strain capable of producing grease at low temperature from an usnea sample at altitude of 4220 meters in Tibet of China (94 DEG 45' to east, 55 ' to north latitude 29 DEG 40 ') and classifies the yeast strain as C.rogersii (namely, curvisadium rogersii) through morphological observation and molecular identification. The strain is preserved in China (Beijing) general microbiological culture collection center in 12 months and 10 days in 2020, and the original name is JBA-MBY-JT231, and the preservation numbers are CGMCC No.21346 respectively. Through Nile red staining observation and liquid fermentation evaluation of a glucose, glycerol and xylose fermentation culture medium, JBA-MBY-JT231 is found to have excellent performance of producing oil under low temperature conditions. Further, oil content and component detection shows that JBA-MBY-JT231 can accumulate a large amount of oil by taking one or more of glucose, xylose, sucrose, ethanol and inulin as carbon sources at 4-25 ℃, preferably 20 ℃, wherein the oil accumulated under the condition that xylose is a sole carbon source is the most, and the oil with the cell dry weight of about 57.66 percent can be accumulated. JBA-MBY-JT231 can respectively accumulate oil with the cell dry weight of 45.45% and 41.85% under the condition of taking glucose and glycerol as carbon sources. The fatty acid analysis result shows that the fatty acid of the strain contains more C18:2 fatty acid linoleic acid, can be used as a medical intermediate, and has potential application value in different fields of chemical industry, machinery, mineral separation, daily chemical production and the like. JBA-MBY-JT231 can simultaneously utilize glucose and xylose to accumulate grease, and has the potential of producing microbial grease by utilizing lignocellulose biomass hydrolysate.

Sequence listing

<110> Shanghai university of transportation

Kalan group Ltd

<120> low temperature resistant oil-producing yeast separated from Usnea indica Tibet and application thereof

<141> 2021-03-05

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 530

<212> DNA

<213> Yeast (Curvibasidium rogersii)

<400> 1

tcattttcca actctgtgca ctattggcgg actggcagta agaaattact attcagtctg 60

cggctcacta ttaaacatta gttaaagtat gtatataaaa acaaaacaaa aaaaaacttt 120

caacaacgga tctcttggct ctcgcatcga tgaagaacgc agcgaaatgt gataagtaat 180

gtgaattgca gaattcagtg aatcatcgaa tctttgaacg caccttgcac tctctggtat 240

tccggagagt atgtctgttt gagtgtcatg aactcttcaa cctaccgatt tctagtaaat 300

cggattagtg tttggattct gaacgtctgc tggcctttat tggcgaagct cgttcgtaaa 360

tgattagcat ctcatattcg aaaatcggat tgactcagtg taatagacta ttcgctgagg 420

acgctctttc gggagtggcc gagttttgta aagtagaagc ttctaactct attagtcaac 480

tttagattag acctcagatc aggcaggatt acccgctgaa cttaagcata 530

<210> 2

<211> 510

<212> DNA

<213> Yeast (Curvibasidium rogersii)

<400> 2

ttgtaatctg gcactttcag tgtccgagtt gtaatctcga gaagtgtttt ccgcgccgga 60

ctgcatacaa gtctgttgga atacagcgtc atagtggtga gaaccccgta actgatgcag 120

atgcccggtg ctttgtgata cactttcgaa gagtcgagtt gtttgggaat gcagctcaaa 180

ttgggtggta aattccatct aaagctaaat attggcgaga gaccgatagc gaacaagtac 240

cgtgagggaa agatgaaaag cactttggaa agagagttaa cagtacgtga aattgttgga 300

agggaaacga ttgaagtcag acttgttatc tggagttcag cctttaggtg tactctccag 360

tttacaggcc agcatcagtt tttggggcgg gaaaatcgta attagaaggt agcagcctag 420

ctgtgttata gctttttact ggattccgct tcggggactg aggaatgcag tgtgctttta 480

gcaatacctt cgggtatttc acacttagga 510

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tccgtaggtg aacctgcgg 19

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcctccgctt attgatatgc 20

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcatatcaat aagcggagga aaag 24

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtccgtgtt tcaagacgg 19

Claims

1. A yeast strain Curvibasidium rogerii JBA-MBY-JT231 with the preservation number of CGMCC No.21346.

2. Use of the yeast strain Curvibasidium rogersii JBA-MBY-JT231 according to claim 1 for the production of lipids at low temperatures of 10-15 ℃.

3. The use according to claim 2, wherein the yeast strain produces the oil by using one or more of glucose, glycerol, xylose, sucrose and inulin as a carbon source.

4. Use according to claim 3, wherein the fat is a C18:1 fatty acid and/or a C18:2 fatty acid.

5. Use according to claim 2, wherein the yeast strain produces oil using lignocellulosic hydrolysate as a carbon source.

6. Use of the yeast strain Curvibasidium rogersii JBA-MBY-JT231 according to claim 1 for the conversion of lipids using lignocellulosic biomass, said yeast strain producing lipids at low temperatures of 10-15 ℃.