CN113913310B - Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof - Google Patents

Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof Download PDF

Info

Publication number
CN113913310B
CN113913310B CN202111133236.9A CN202111133236A CN113913310B CN 113913310 B CN113913310 B CN 113913310B CN 202111133236 A CN202111133236 A CN 202111133236A CN 113913310 B CN113913310 B CN 113913310B
Authority
CN
China
Prior art keywords
strain
gaba
jba
mby
saussurea involucrata
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111133236.9A
Other languages
Chinese (zh)
Other versions
CN113913310A (en
Inventor
李俊
赵心清
章漳
范婷婷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Natural Hall Group Co ltd
Original Assignee
Jala Group Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jala Group Co filed Critical Jala Group Co
Priority to CN202111133236.9A priority Critical patent/CN113913310B/en
Publication of CN113913310A publication Critical patent/CN113913310A/en
Application granted granted Critical
Publication of CN113913310B publication Critical patent/CN113913310B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/02—Separating microorganisms from their culture media
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/005—Amino acids other than alpha- or beta amino acids, e.g. gamma amino acids
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a quince yeast strain derived from Tibetan saussurea involucrata and application thereof, wherein the preservation number of the strain Metschnikowia reukaufii JBA-MBY-JT075 is CGMCC No.2.6475, the strain is separated from Tibetan saussurea involucrata, and can be used for producing gamma-aminobutyric acid (gamma-aminobutyric acid, GABA) by utilizing glucose and xylose, and can secrete more GABA into a fermentation culture medium at high temperature and with the addition of ethanol or acetic acid with proper concentration. The accuracy is reliable and reliable through observation by a chromogenic method and measurement by an ultra-high performance liquid chromatography-quadrupole mass spectrometer, so that the capability of the strain for producing GABA is revealed, accumulation of a large amount of GABA is detected in cells of the strain, and the strain is a potential GABA production strain and has good application potential and value in the fields of food and industry.

Description

Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof
Technical Field
The invention belongs to the technical field of microbial resources and application, and particularly relates to a GABA-producing merzizyphus strain (Metschnikowia reukaufii) derived from Tibetan saussurea involucrata and application thereof.
Background
GABA is a naturally occurring four-carbon non-protein amino acid that is widely found in plants, animals, and microorganisms. GABA can be used as the main ingredient of skin care product for skin cells, and has effect in smoothing wrinkles (Han et al, mycobiology,2017, 45:199-203). In addition, GABA is added to many sleep-aiding drugs and health care products, and is an inhibitory neurotransmitter in the human body, mainly regulating synaptic transmission, relaxing nerves, thereby playing the roles of aiding sleep and resisting depression, and also has the roles of resisting hypertension, diabetes and cancer (Ngo et al, molecular, 2019, 24:2678). At present, the GABA production route mainly comprises microbial synthesis, plant extraction, chemical synthesis and the like. Chemical synthesis and plant extraction have limitations such as environmental pollution and low yield, so that the synthesis of GABA by a microbial fermentation method has attracted attention of researchers.
Microorganisms for producing GABA comprise lactobacillus, saccharomycete and the like, wherein the saccharomycete has the advantages of strong stress resistance, no risk of phage pollution, easiness in industrial amplified culture and separation, capability of simultaneously synthesizing various active substances such as vitamins, polysaccharides and the like, good biological safety and the like, so that the production of GABA by utilizing the saccharomycete is attracting attention of more and more researchers. Many wild yeast and industrial yeast cells respond to a variety of stress pressures in adapting to ecological environment evolution and application to industrial production, to which the cells will react, and stress protective substances are accumulated to protect the cells from injury, and GABA as a stress protective substance, it has been reported that GABA content in Candida and Saccharomyces cerevisiae cells is increased under conditions of acetic acid (Wang et al, omics,2013, 17:150-159), high osmotic pressure (Ji et al, J Gen Appl Microbiol,2017,64:84-89), oxidative stress (Coleman et al, J Biol Chem,2001, 276:244-250), and the like.
The Mercury yeast Metschnikowia reukaufii is a yeast widely existing in nectar and capable of tolerating the extreme conditions of 400g/L sucrose (Garcia-Gonzalez et al Microb Biotechnol,2019,12: 1274-1285), and as a non-conventional yeast, a specific protease gene contained in the cell thereof was cloned for heterologous expression (Li et al Appl Biochem Biotechnol, 2009,159: 119-32), and also used in fermentation production in the food and industrial fields as a microbial cell factory, such as for producing isoprene sugar (Garcia-Gonzalez et al Microb Biotechnol,2019,12: 1274-1285) and D-arabitol (Nozaki et al Biosci Biotechnol Biochem,2003,67: 1923-1929), but there has been little systematic study of fermentation using the yeast as a microbial cell factory. There are studies on screening a strain of GABA-producing Meiqi yeast from banana epidermis, but the exact species could not be identified (Xu Xiaobo, university of Zhejiang [ D ], 2010), and furthermore, there has been no study on Metschnikowia reukaufii GABA production at home and abroad.
Xylose is the most abundant monosaccharide except glucose in nature, for example, lignocellulose biomass can be hydrolyzed to generate a lot of xylose, and microorganisms which can utilize xylose can ferment by taking lignocellulose hydrolysate as a substrate, so that industrial production is carried out to save cost, but the yeast which can naturally utilize xylose can be used for producing active substances, and the biomass refining by fully utilizing lignocellulose resources is more favorable.
Disclosure of Invention
In order to overcome the defects in the prior art, the primary aim of the invention is to provide a Metschnikowia strain Metschnikowia reukaufii JBA-MBY-JT075 which is derived from Tibetan saussurea. In particular to a yeast strain Metschnikowia reukaufii JBA-MBY-JT075 which can utilize glucose and xylose and produce GABA under the stress induction of ethanol or acetic acid from a Tibetan saussurea involucrata source, and the strain has the capacity of producing GABA, can respond to the stress induction of ethanol or acetic acid and has great application potential.
It is a further object of the present invention to provide the use of the above strain for the production of GABA.
It is a third object of the present invention to provide the use of the above strain for the production of GABA from lignocellulosic biomass.
To achieve the above primary object, the solution of the present invention is:
the Tibet saussurea involucrata-derived mermaid yeast strain Metschnikowia reukaufii JBA-MBY-JT075 is preserved in China general microbiological culture collection center (CGMCC) at 2021, 4 and 6 days, and has a preservation address: the collection number is CGMCC No.2.6475, the classification name is Metschnikowia reukaufii, and the detection is carried out on the collection number of the microbiological institute of China academy of sciences.
The isolation, purification and screening process of the JBA-MBY-JT075 strain is as follows: washing the surface of a sample with normal saline, coating the eluent on a YPD solid culture medium flat plate, placing the YPD solid culture medium flat plate in a constant temperature incubator at 25 ℃ for inversion culture for 1-2 days, taking out a colony on the flat plate, streaking and culturing the colony on a new YPD culture medium flat plate, taking out a single colony after single colony is obtained, streaking again, repeating for three times, finally taking out the single colony to a YPD liquid culture medium, placing the YPD liquid culture medium in a 25 ℃ for shake culture for 1-2 days, and preserving the YPD liquid culture medium with glycerol with a final concentration of 30% (v/v) to obtain a yeast strain JBA-MBY-JT075.
The single colony of Metschnikowia reukaufii JBA-MBY-JT075 is creamy to light yellow, has smooth edges, slightly reflective, raised colony, is easy to pick up, cells under a microscope are oblong, are observed through morphological characteristics of the cells, are sequenced based on a molecular marker of 26s rDNA D1/D2 sequences in a fungal genome, are identified as Metschnikowia reukaufii related strains through NCBI database blast comparison, and are named Metschnikowia reukaufii JBA-MBY-JT075. It is isolated from saussurea involucrata, and can utilize glucose and xylose at 25deg.C, and can produce GABA under stress induction of high temperature, ethanol or acetic acid.
As a preferred embodiment of the present invention, the strain has a sequence as shown in SEQ ID NO. 1.
To achieve the above secondary object, the solution of the present invention is:
application of the above-mentioned Tibet saussurea involucrata-derived Meiqi strain Metschnikowia reukaufii JBA-MBY-JT075 in GABA production.
As a preferred embodiment of the present invention, metschnikowia genus Metschnikowia strain Metschnikowia reukaufii JBA-MBY-JT075, which is a source of saussurea involucrata, produces GABA using glucose and xylose as carbon sources.
As a preferred embodiment of the present invention, metschnikowia genus Metschnikowia strain Metschnikowia reukaufii JBA-MBY-JT075, which is a source of saussurea involucrata, produces GABA under high temperature, ethanol or acetic acid stress induction.
As a preferred embodiment of the present invention, the elevated temperature is 30-40deg.C, more preferably 37deg.C, at which substantial amounts of GABA can accumulate.
As a preferred embodiment of the present invention, the concentration of ethanol is 3-5% (v/v), more preferably 5% (v/v), at which a large amount of GABA can be accumulated.
As a preferred embodiment of the present invention, the concentration of acetic acid is 3-5g/L, more preferably 5g/L, at which a large amount of GABA can be accumulated.
To achieve the third object, the solution of the present invention is:
the application of Metschnikowia genus Meiqi strain Metschnikowia reukaufii JBA-MBY-JT075 derived from Tibetan saussurea involucrata in GABA production by using lignocellulose biomass.
By adopting the scheme, the invention has the beneficial effects that:
firstly, a Metschnikowia reukaufii strain producing GABA is separated and screened from Tibetan saussurea involucrata, and the GABA produced by the strain is observed by a chromogenic method and measured by an ultra-high performance liquid chromatography-quadrupole mass spectrometer (Waters, USA), so that the accuracy is reliable and reliable, the capability of producing GABA is revealed, and accumulation of a large amount of GABA is detected in cells of the strain, so that the potential and the value of the GABA produced by the strain in the fields of foods and industry are shown.
The Metschnikowia reukaufii strain of the invention is activated by liquid, and a large amount of GABA can be accumulated in fermentation medium which takes glucose and xylose as carbon sources at 37 ℃ and fermentation for 1-2 days.
Third, the Metschnikowia reukaufii strain of the invention produces GABA under stress induction of 5% (v/v) ethanol or 5g/L acetic acid at 37 ℃.
Drawings
FIG. 1 is a schematic diagram showing cell morphology of the strain of example 1 of the present invention under a 400-fold microscope.
FIG. 2 shows the growth of the strain of example 3 of the present invention fermented for 24 hours with different concentrations of glucose and xylose as carbon sources.
FIG. 3 shows GABA yields obtained by fermenting the strain of example 3 of the present invention with different concentrations of glucose and xylose as carbon sources for 24 hours.
FIG. 4 shows the growth of the strain broth of example 4 of the present invention after fermentation for 24 hours at high temperature, ethanol or acetic acid induction.
FIG. 5 shows GABA production from the strain broth of example 4 of the present invention by high temperature, ethanol or acetic acid-induced fermentation for 24 hours.
FIG. 6 shows the intracellular GABA accumulation levels of the strain of example 5 of the present invention after 24 hours of fermentation under different conditions.
The Meiqi yeast strain Metschnikowia reukaufii JBA-MBY-JT075 is preserved in China general microbiological culture Collection center (CGMCC) of China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) at 2021, 4 and 6, and the preservation address is as follows: the collection number of the microbiological institute of China academy of sciences is CGMCC No.2.6475, and the North Chen Xili No.1, 3 of the Chaoyang area of Beijing city.
Detailed Description
The invention provides a merzizyphus strain derived from Tibetan saussurea and application thereof.
According to the invention, a Metschnikowia mermaid yeast strain Metschnikowia reukaufii JBA-MBY-JT075 is separated, purified and identified from a saussurea bracteata sample collected in a Tibetan region, and can be used for producing GABA by xylose, and the extracellular GABA secretion is improved under various environmental conditions such as high temperature, ethanol or acetic acid, so that the Metschnikowia mermaid yeast strain has good development and application potential.
The invention is further illustrated by the following examples.
Example 1 screening and biological identification of Yeast strains
1) Screening of Yeast strains
Washing the surface of a sample with normal saline, coating the eluent on a YPD solid culture medium flat plate, placing the YPD solid culture medium flat plate in a constant temperature incubator at 25 ℃ for inversion culture for 1-2 days, after bacterial colonies grow out on the flat plate, picking the bacterial colonies to a new YPD culture medium flat plate for streak culture, after single bacterial colonies are obtained, picking the single bacterial colonies for streak again, repeating the steps for three times, finally picking the single bacterial colonies to a YPD liquid culture medium, placing the YPD solid culture medium flat plate in a 25 ℃ for shake culture for 1-2 days, and preserving the YPD liquid culture medium with glycerol with a final concentration of 30% (v/v) to obtain the yeast strain.
2) Identification of Metschnikowia reukaufii Strain
The formulation of the medium of this example is as follows (sterilization conditions are 115 ℃ C., 20 min):
GABA producing strain screening solid Medium (1L): 10g of yeast powder, 20g of peptone, 20g of glucose, 20g of agar, 0.001g of bromocresol green, 0.02g of glyoxylate and 0.02g of succinic acid.
YPD liquid medium (1L): yeast powder 10g, peptone 20g and glucose 20g. And (5) autoclaving.
YPD solid medium (1L): yeast powder 10g, peptone 20g, glucose 20g and agar 20g. And (5) autoclaving.
YPD fermentation medium (1L): yeast powder 10g, peptone 20g, glucose 20/40g. And (5) autoclaving.
YPX fermentation medium (1L): yeast powder 10g, peptone 20g, xylose 20/40g. And (5) autoclaving.
After culturing the yeast strain in YPD plates for about 2 days, the cell state was observed under a 400x microscope; the cell is oblong, and the asexual propagation mode is unilateral bud. Microscopic pictures of the strain under 400-fold microscope of YPD are shown in fig. 1.
The strain is subjected to genome extraction and classification identification of 26s rDNA D1/D2 sequence sequencing. PCR amplification was performed with genome as template by fungal 26s rDNA D1/D2 primer (forward 26s-F:5'-GCATATCGGTAAGCGGAGGAAAAG-3' SEQ ID NO.2; reverse 26s-R:5'-GGTCCGTGTTTCAAGACGG-3' SEQ ID NO. 3). Blast (http:// blast-t.ncbi.lm.nih.gov/blast.cgi) homology alignment was performed with the final 26s rDNA D1/D2 sequence, which was most similar to strain Metschnikowia reukaufii NRRL Y-7112, with a maximum similarity of 99.78%, thus identifying the strain as Metschnikowia reukaufii.
Wherein the JBA-MBY-JT075 26s rDNA D1/D2 sequence (SEQ ID NO. 1) is as follows:
GCAAAAGCTCAAATTTGAAATCCTTCGGGAATTGTATTTTGAAGGTGGGTTTGGTTA GGAAAAGTTACTTTAAGTCCATTGGAAAATGGCGCCATGGAGGGTGATAGCCCCGTAAAAGTACCCCTTTTCCTTTTATCCATTCCCTCCAAAGAGTCGAGTTGTTTGGGAATGCAGCT CTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAA TTGTTGAAAGGGAAGGGCTTGCAAGCAGACACAACCTCGGTTGGGCCAGCATCGGAGTGGGGGGAGACAAAAAAGAAAAGGAATGTAACTCTTTCGAGTATTATAGCCTTTTTCTCAT ATCTCCACCCCCTTCCGAGGCCTGCGATTCTTCAAGGATGCTGGCGTA。
morphological characteristics and culture of the present example strain JBA-MBY-JT 075: after 2d incubation on YPD plates at 25℃the single colonies were creamy to pale yellow, smooth in edge, slightly reflective, raised and easy to pick up. Microscopic features: after 2d incubation on YPD plates, the cells were oblong and asexually propagated in a unilateral budding. Metschnikowia reukaufii JBA-MBY-JT075 has good low temperature resistance, and can utilize various carbon sources including glucose and xylose.
Example 2 determination of GABA yield in JBA-MBY-JT075 fermentation broth
The GABA content of the fermentation broth of JBA-MBY-JT075 was measured in this example.
The preparation method comprises inoculating 20 μL of JBA-MBY-JT075 strain stored at-80deg.C in 1mL YPD liquid medium, culturing in shaking table at 25deg.C and 200rpm for 24 hr, transferring to 100mL YPD seed medium (i.e. YPD liquid medium), culturing in shaking table at 25deg.C for 18 hr, and adjusting OD 600 Inoculating 0.1 into YPD fermentation medium, sealing with air-permeable sealing film, fermenting at 25deg.C and 200rpm for 24 hr, sampling, centrifuging at 8000rpm for 3min, diluting the supernatant 50 times, mixing, filtering with 0.22 μm filter membrane, and measuring GABA content with ultra-high performance liquid chromatography-quadrupole mass spectrometer for about 1.010min.
Example 3, JBA-MBY-JT075 GABA was produced using glucose and xylose as carbon
This example measures the ability of JBA-MBY-JT075 to produce GABA using glucose and xylose as carbon sources.
The preparation method comprises inoculating 20 μL of JBA-MBY-JT075 strain stored at-80deg.C in 1mL YPD liquid medium, culturing in shaking table at 25deg.C and 200rpm for 24 hr, transferring to 100mL YPD seed medium (i.e. YPD liquid medium), culturing in shaking table at 25deg.C for 18 hr, and adjusting OD 600 Inoculating to YPD (glucose 20 g/L) and YPX (xylose 20g/L and xylose 40 g/L) fermentation medium (shown in figure 2) 0.1, sealing with air-permeable sealing membrane, fermenting at 25deg.C and 200rpm for 24 hr, sampling, centrifuging at 8000rpm for 3min, diluting the supernatant 50 times, mixing with 0.22 μm filter membrane, measuring GABA content with ultra high performance liquid chromatography-quadrupole mass spectrometer, and measuring GABA content with full waveThe light absorption value at 600nm is measured by a long enzyme label instrument, and the OD in the fermentation liquid of the strain is measured 600 As shown in FIG. 2, the GABA content is shown in FIG. 3.
Example 4, JBA-MBY-JT075 Induction of GABA production in response to stress at high temperature, ethanol or acetic acid
This example measures GABA content of JBA-MBY-JT075 at high temperature under fermentation conditions of ethanol or acetic acid addition.
The preparation method comprises inoculating 20 μL of JBA-MBY-JT075 strain stored at-80deg.C in 1mL YPD liquid medium, culturing at 25deg.C and 200rpm for 24 hr, transferring to 100mL YPD seed medium (i.e. YPD liquid medium), culturing in 25 deg.C shaking table for 18 hr, and adjusting OD 600 Inoculating to YPD (glucose 20 g/L) fermentation medium (shown in figure 4) 0.1, adding ethanol 3% (v/v) and 5% (v/v) respectively, adding acetic acid 3g/L and 5g/L to fermentation broth, sealing with air-permeable sealing film, fermenting at 25deg.C and 200rpm for 24 hr, sampling, fermenting at 30deg.C and 37 deg.C and 200rpm for 24 hr, centrifuging at 8000rpm for 3min, diluting supernatant 50 times, mixing with 0.22 μm filter membrane, measuring GABA content with ultra-high performance liquid chromatography-quadrupole mass spectrometer, measuring light absorption value at 600nm with full wavelength enzyme-labeling instrument, and measuring OD in the strain fermentation broth 600 As shown in FIG. 4, the GABA content is shown in FIG. 5.
Example 5, JBA-MBY-JT075 intracellular GABA content under xylose fermentation and high temperature stress conditions
The present example measured the intracellular GABA content of JBA-MBY-JT075.
The preparation method comprises inoculating 20 μL of JBA-MBY-JT075 strain stored at-80deg.C in 1mL YPD liquid medium, culturing in shaking table at 25deg.C and 200rpm for 24 hr, transferring to 100mL YPD seed medium (i.e. YPD liquid medium), culturing at 25deg.C and 200rpm for 18 hr, and adjusting to initial OD 600 Inoculating to YPD (glucose 20 g/L) and YPX (xylose 20 g/L) fermentation medium (shown in FIG. 6) at 0.1, placing control and xylose fermented two groups on 25 deg.C shaker, placing high temperature group on 30 deg.C shaker, sealing with air-permeable sealThe mouth membrane is sealed, fermentation is carried out for 24 hours at 200rpm, 50mL of the sample is sampled, centrifugation is carried out for 5 minutes at 4 ℃ and 3000rpm, thalli are collected, then the thalli are washed twice by sterile deionized water, 4mL of 0.1mol/L hydrochloric acid solution is added, cells are suspended, and then the cells are split-packed into five 1.5 mL centrifuge tubes according to 800 mu L/tube. After centrifugation of one tube of the cell liquid at 10000rpm for 2min, the supernatant was removed, the cells were placed in a 50℃oven until the dry weight of the cells became constant, the dry weight of the cells was measured by a precision analytical balance, the remaining four tubes were each filled with 500. Mu.L of glass beads having a diameter of 0.5mm, placed in a pre-chilled metal module at-20℃and the cells were broken by a cell breaker, followed by centrifugation at 12000rpm for 5min to collect all the supernatant in a 5mL centrifuge tube, the two tube supernatants were combined into one tube, then a suitable volume of pre-chilled sulfosalicylic acid (16.7%, w/v) was added to a final concentration of 4.5% (w/v), shaking and mixing was performed, standing at 4℃for 1h, centrifugation was performed at 15000rpm for 30min to collect the supernatant, pH was adjusted to 1.9 by 1mol/L NaOH, and after membrane filtration by a membrane filtration membrane of 0.22. Mu.m, the GABA content was detected by an amino acid analyzer, and the results are shown in FIG. 6.
As can be seen from FIG. 6, the cell of the strain Metschnikowia reukaufii JBA-MBY-JT075 identified in this example also contains a large amount of GABA resources, the highest yield is 54.09mg/g dry weight, and the GABA accumulation amount of unit cell is higher than that of the control group in which glucose is the sole carbon source and the culture condition is 25 ℃ under the condition of high temperature, which shows the potential and application value in the production of GABA as a microbial cell factory.
In summary, the invention provides a GABA-producing Meiqi yeast strain separated from saussurea involucrata samples collected in Tibetan areas of China, and the GABA-producing Meiqi yeast strain is classified as Metschnikowia reukaufii by molecular identification. The strain is preserved in China general microbiological culture Collection center (Beijing) for 4 months and 6 days in 2021, and the original name is JBA-MBY-JT075, and the preservation number is CGMCC No.2.6475. Through preliminary screening, the strain is found to be capable of producing GABA, and the capability of producing GABA of the strain is determined by utilizing an ultra-high performance liquid chromatography-quadrupole mass spectrometer. The strain has strong low temperature resistance, can grow at 4 ℃ and has best growth at 25 ℃. The strain can utilize glucose and xylose to produce GABA, responds to induction of various stress conditions of high temperature, ethanol or acetic acid, and most preferably utilizes glucose as a carbon source at 37 ℃ and adds 5g/L acetic acid to induce GABA production, and the highest yield in shake flasks reaches 125.93mg/L. In addition, a large amount of GABA is accumulated in cells of the strain, and the highest yield is 54.09mg/g dry weight, so that the potential and application value of the strain in GABA production as a microbial cell factory are shown.
The previous description of the embodiments is provided to facilitate a person of ordinary skill in the art in order to make and use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles described herein may be applied to other embodiments without the use of the additional inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art will appreciate that, in light of the principles of the present invention, improvements and modifications can be made without departing from the scope of the invention.
Sequence listing
<110> Galangal (group) Co., ltd
<120> Meiqi Yeast Strain derived from Tibetan saussurea and application thereof
<141> 2021-09-22
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 459
<212> DNA
<213> Yeast (Curvibasidium rogersii)
<400> 1
gcaaaagctc aaatttgaaa tccttcggga attgtatttt gaaggtgggt ttggttagga 60
aaagttactt taagtccatt ggaaaatggc gccatggagg gtgatagccc cgtaaaagta 120
ccccttttcc ttttatccat tccctccaaa gagtcgagtt gtttgggaat gcagctctaa 180
gtgggtggta aattccatct aaagctaaat attggcgaga gaccgatagc gaacaagtac 240
agtgatggaa agatgaaaag cactttgaaa agagagtgaa aaagtacgtg aaattgttga 300
aagggaaggg cttgcaagca gacacaacct cggttgggcc agcatcggag tggggggaga 360
caaaaaagaa aaggaatgta actctttcga gtattatagc ctttttctca tatctccacc 420
cccttccgag gcctgcgatt cttcaaggat gctggcgta 459
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence (Artficial Sequence)
<400> 2
gcatatcggt aagcggagga aaag 24
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence (Artficial Sequence)
<400> 3
ggtccgtgtt tcaagacgg 19

Claims (7)

1. A quincuncial yeast (Metschnikowia reukaufii) strain JBA-MBY-JT075 derived from saussurea involucrata, characterized in that: the China general microbiological culture Collection center CGMCC (China general microbiological culture Collection center) is preserved in 2021, 6 and 24 days, and the preservation address is: the collection number of the microbiological institute of China academy of sciences is CGMCC No.2.6475, and the North Chen Xili No.1, 3 of the Chaoyang area of Beijing city.
2. Use of a quince yeast (Metschnikowia reukaufii) strain JBA-MBY-JT075 derived from saussurea involucrata as defined in claim 1 for producing GABA.
3. The use according to claim 2, characterized in that: the Tibet saussurea involucrata-derived merthiola (Metschnikowia reukaufii) strain JBA-MBY-JT075 produces GABA using glucose and xylose as carbon sources.
4. The use according to claim 2, characterized in that: the Tibet saussurea involucrata-derived merthiola (Metschnikowia reukaufii) strain JBA-MBY-JT075 produces GABA under high temperature, ethanol or acetic acid stress induction.
5. The use according to claim 4, characterized in that: the high temperature is 30-40 ℃.
6. The use according to claim 4, characterized in that: the concentration of the ethanol is 3-5% (v/v).
7. The use according to claim 4, characterized in that: the concentration of the acetic acid is 3-5g/L.
CN202111133236.9A 2021-09-27 2021-09-27 Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof Active CN113913310B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111133236.9A CN113913310B (en) 2021-09-27 2021-09-27 Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111133236.9A CN113913310B (en) 2021-09-27 2021-09-27 Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof

Publications (2)

Publication Number Publication Date
CN113913310A CN113913310A (en) 2022-01-11
CN113913310B true CN113913310B (en) 2023-08-11

Family

ID=79236196

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111133236.9A Active CN113913310B (en) 2021-09-27 2021-09-27 Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof

Country Status (1)

Country Link
CN (1) CN113913310B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1065276A1 (en) * 1999-06-24 2001-01-03 Ajinomoto Co., Inc. Methods for producing D-arabitol, D-xylulose and xylitol using the yeast Metschnikowia
JP2007054018A (en) * 2005-08-26 2007-03-08 Unitika Ltd METHOD FOR HIGHLY PURIFYING gamma-AMINOBUTYRIC ACID-CONTAINING COMPOSITION
CN101085449A (en) * 2007-03-31 2007-12-12 杨培根 Deodorization method for town refuse biology re-fermentation
CN104830705A (en) * 2015-05-08 2015-08-12 黑龙江省科学院微生物研究所 Glucose/xylose co-metabolism saccharomyces cerevisiae strain and application thereof
CN112725208A (en) * 2021-03-05 2021-04-30 伽蓝（集团）股份有限公司 Tibetan-derived yeast strain capable of producing oil at low temperature and application thereof
CN112877224A (en) * 2021-03-05 2021-06-01 伽蓝（集团）股份有限公司 Low-temperature-resistant oil-producing yeast separated from Usnea indica (L.) kurz and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4434927B2 (en) * 2004-11-17 2010-03-17 株式会社ニチレイフーズ Method for producing γ-aminobutyric acid-containing food, and yeast having high γ-aminobutyric acid production ability
US20180195093A1 (en) * 2016-12-21 2018-07-12 Creatus Biosciences Inc. Metschnikowia species for biosynthesis of compounds

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1065276A1 (en) * 1999-06-24 2001-01-03 Ajinomoto Co., Inc. Methods for producing D-arabitol, D-xylulose and xylitol using the yeast Metschnikowia
JP2007054018A (en) * 2005-08-26 2007-03-08 Unitika Ltd METHOD FOR HIGHLY PURIFYING gamma-AMINOBUTYRIC ACID-CONTAINING COMPOSITION
CN101085449A (en) * 2007-03-31 2007-12-12 杨培根 Deodorization method for town refuse biology re-fermentation
CN104830705A (en) * 2015-05-08 2015-08-12 黑龙江省科学院微生物研究所 Glucose/xylose co-metabolism saccharomyces cerevisiae strain and application thereof
CN112725208A (en) * 2021-03-05 2021-04-30 伽蓝（集团）股份有限公司 Tibetan-derived yeast strain capable of producing oil at low temperature and application thereof
CN112877224A (en) * 2021-03-05 2021-06-01 伽蓝（集团）股份有限公司 Low-temperature-resistant oil-producing yeast separated from Usnea indica (L.) kurz and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
5株生物合成GABA酵母菌株的分离、筛选和鉴定;徐晓波等;微生物学杂志;第29卷(第01期);第55-59页 *

Also Published As

Publication number Publication date
CN113913310A (en) 2022-01-11

Similar Documents

Publication Publication Date Title
Wang et al. Heterotrophic culture of Chlorella pyrenoidosa using sucrose as the sole carbon source by co-culture with immobilized yeast
Díaz-Santos et al. Study of bioflocculation induced by Saccharomyces bayanus var. uvarum and flocculating protein factors in microalgae
CN110218676A (en) A kind of clostridium butyricum and its application
CN106635920A (en) High-yield fucoidanase ocean alternating pseudomonas and application thereof
CN114480205B (en) Bacillus amyloliquefaciens and application thereof in brewing of solid-state fermentation vinegar
Rahman et al. Effect of various parameters on the growth and ethanol production by yeasts isolated from natural sources
CN114621880A (en) Abnormal yeast Weikehan for producing ester and application of abnormal yeast Weikehan in white spirit Daqu
CN114032187B (en) Kluyveromyces marxianus strain from Tibetan yoghurt and application thereof
CN112852780B (en) Monascus flavus and application thereof in preparing tannase and degrading tannin
CN116286560B (en) Raoult bacterium HC6 and application thereof in low-temperature production of 2, 3-butanediol
CN113913310B (en) Meiqi yeast strain derived from Tibetan saussurea involucrata and application thereof
WO2021056683A1 (en) Strain for producing lipase and application thereof
CN111518711B (en) Enterobacter strain and application thereof in coproduction of microbial exopolysaccharide and 2,3-butanediol
CN107723300B (en) Overexpression of CgGsh1 gene to improve 2-phenethyl alcohol tolerance and yield of glycerol-producing candida
Bechem et al. Characterization of palm wine yeasts using osmotic, ethanol tolerance and the isozyme polymorphism of alcohol dehydrogenase
WO2023000618A1 (en) Bacillus xiaoxiensis and application thereof
CN115851501A (en) Bacillus, microbial preparation, culture method and application
CN113913311B (en) Welch ginger fruit-derived Wick ham yeast strain and application thereof
CN109161488A (en) One plant height produces Irpex lacteus strain and its cultural method of cordycepin
CN114517157A (en) Screening and identification of pichia kudriavzevii X-8 for producing phenethyl acetate and application of pichia kudriavzevii X-8 in white spirit brewing
CN103952334A (en) Strain HD385 producing L-erythrulose through microorganism fermentation, and method
CN112980731B (en) L-xylulose producing strain and application thereof
CN116179402B (en) Carotenoid synthetic strain and application thereof
CN113913313B (en) Saccharomyces cerevisiae strain and application thereof
Ali et al. Evaluation of Growth Kinetics and Biomass Yield of Baker's Yeast on Potato Flour

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address
CP03 Change of name, title or address

Address after: 201403 Shanghai City, Fengxian District Lifenglu No. 12

Patentee after: Shanghai Natural Hall Group Co.,Ltd.

Country or region after: China

Address before: 201403 Shanghai City, Fengxian District Lifenglu No. 12

Patentee before: JALA Group Co.

Country or region before: China