CN112852767A

CN112852767A - Carbonyl reductase mutant and application thereof in catalytic synthesis of 17 beta-hydroxy steroid compound

Info

Publication number: CN112852767A
Application number: CN201911239961.7A
Authority: CN
Inventors: 王玉; 陈曦; 张红榴; 刘祥涛; 冯进辉; 吴洽庆; 朱敦明; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2019-12-06
Filing date: 2019-12-06
Publication date: 2021-05-28
Anticipated expiration: 2039-12-06
Also published as: CN112852767B

Abstract

The invention provides a carbonyl reductase mutant and application thereof in catalytic synthesis of 17 beta-hydroxy steroid compounds, wherein the mutant is mutated in a core amino acid of wild carbonyl reductase. The mutants provided by the invention can obviously improve the capability of carbonyl reductase for converting a series of 17-carbonyl steroid compounds, and have high stereoselectivity. The recombinant cell provided by the invention can be used as a biocatalyst, can obtain a target product with high yield by using high substrate feeding concentration, has few byproducts, the yield is not lower than 95%, the conversion time is short, the used biocatalyst is low in dosage, the space-time yield is far higher than the current reported level, and the preparation method is simple and convenient, mild in condition and environment-friendly.

Description

Carbonyl reductase mutant and application thereof in catalytic synthesis of 17 beta-hydroxy steroid compound

Technical Field

The invention relates to the field of enzyme and enzyme engineering, in particular to application of a carbonyl reductase mutant in catalyzing 17-carbonyl steroid compounds to synthesize 17 beta-hydroxy steroid compounds.

Background

The steroid medicine has strong pharmacological actions of resisting infection, anaphylaxis, virus and shock. With the continuous development of the times, steroid drugs have become the second largest class of drugs after antibiotics. Classification of steroid hormones drugs: adrenocortical hormones, including hydrocortisone, prednisone, etc., for treating addison's disease, anti-inflammatory, antiallergic, antishock, etc.; the protein assimilation hormone has the main physiological functions of inhibiting protein dissimilation and promoting protein synthesis, and is mainly used for treating diseases caused by protein increase and synthesis deficiency; sex hormones, including estrogen, androgen and progestin.

The 17 beta-hydroxy steroid compound has important medicinal value and industrial application potential as a medicament and a medicament intermediate. For example, Testosterone (TS) is an important steroid hormone drug, and is clinically used as a sex hormone drug to treat primary and secondary male hypogonadism, maintain male secondary characteristics, sexual function and the like. The heptanoate, propionate and semisynthetic products such as methyltestosterone and nandrolone phenylpropionate are also clinical medicines, and have the effects of maintaining muscle strength and quality, maintaining bone density and strength, refreshing and improving physical performance. The traditional industrial synthesis of 17 beta-hydroxy steroid compounds is prepared from sterol or 17-carbonyl steroid compounds by a series of chemical methods, and although the final product can be obtained, the product purity is low, the purification difficulty is increased by the generation of byproducts, and the problem of environmental pollution exists. By adopting the biological catalysis technology, the 17-carbonyl steroid compound can be converted into the 17 beta-hydroxyl steroid compound in one step, the reaction steps are simple, and the method has high stereoselectivity and regioselectivity and wide application prospect.

Since the 30 s in the twentieth century, researchers have begun to utilize different microorganisms to convert 17-carbonyl steroids to synthesize 17 β -hydroxy steroids, but the research researchers have the problems of low conversion efficiency, more byproducts and the like. The 17 beta-hydroxysteroid dehydrogenase is a catalytic enzyme in the last step of sex hormone synthesis process, which can catalyze the reduction and oxidation reaction between the carbonyl and hydroxyl at C17 position of steroid compound, and researchers use the enzyme as a biocatalyst to convert 17-carbonyl steroid compound to synthesize 17 beta-hydroxysteroid compound (Minglong Shao, Xiaoan Zhang, Zhiming Rao, et al Green Chemistry,2016(18):1774-1784), however, the conversion efficiency is not high, the required amount of bacteria is large, and the concentration of converted substrate is low. Therefore, the development of a biocatalyst with higher activity, and the application of the biocatalyst to the one-step conversion of the 17-carbonyl steroid compound into the 17 beta-hydroxy steroid compound are still hot spots of future research.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a carbonyl reductase mutant, which improves the conversion efficiency and is beneficial to the application of the carbonyl reductase mutant in catalytic synthesis of 17 beta-hydroxy steroid compounds.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a mutant carbonyl reductase having an amino acid sequence that is identical to the amino acid sequence of wild-type carbonyl reductase of SEQ ID NO: 1 is at least 90% identical and said mutant has the ability to convert a 17-carbonyl steroid to a 17 β -hydroxy steroid. Preferably, the wild-type carbonyl reductase is derived from Ralstonia sp.

In the invention, the inventor designs the mutation of the 205 th amino acid, and finds that the mutation of the site can improve the capability of carbonyl reductase for converting 17-carbonyl steroids and has high stereoselectivity. The 205 th amino acid is mutated from phenylalanine (F) to alanine (a), arginine (R), lysine (K), isoleucine (I), histidine (H), leucine (L), tryptophan (W), methionine (M), proline (P), cysteine (C), valine (V), glycine (G), serine (S), glutamine (Q), tyrosine (Y), aspartic acid (D), glutamic acid (E), threonine (T), asparagine (N), preferably alanine (a), valine (V), cysteine (C), isoleucine (I), leucine (L), threonine (T), serine (S), glycine (G), more preferably alanine (a), cysteine (C), isoleucine (I), glycine (G).

In a second aspect, the present invention provides a polynucleotide encoding a mutant according to the first aspect of the invention.

In a third aspect, the present invention provides a recombinant cell expressing a mutant according to the first aspect and further expressing a polypeptide capable of catalyzing NADP⁺Glucose Dehydrogenase (GDH) that synthesizes NADPH.

In a fourth aspect, the present invention provides a method for preparing 17 β -hydroxysteroids, wherein the recombinant cells according to the third aspect of the present invention are contacted with a substrate to perform a catalytic reaction, thereby obtaining 17 β -hydroxysteroids.

In another preferred embodiment, the reaction substrate comprises androst-4-ene-3, 17-dione, 9 α -hydroxyandrost-4-ene-3, 17-dione, androst-4-ene-3, 11, 17-trione, androst-4, 9(11) -diene-3, 17-dione, 19-norandrost-4-ene-3, 17-dione, estra-4, 9-diene-3, 17-dione, 19-hydroxyandrost-4-ene-3, 17-dione, 3 β -hydroxy-5-androsten-17-one, estrone, androst-1, 4-diene-3, 17-dione, epiandrosterone.

In another preferred embodiment, the reaction has one or more characteristics selected from the group consisting of:

(i) the pH of the reaction system is 5.0 to 9.0, preferably 5.0 to 8.0, more preferably 7.0;

(ii) the cosolvent of the reaction system is cosolvent, acetonitrile, acetone, methanol, ethanol, dimethyl sulfoxide, N-dimethylformamide, tetrahydrofuran, ethyl acetate, methyl tert-butyl ether, dichloromethane and 1, 4-dioxane, preferably cosolvent, methanol, ethanol, N-dimethylformamide and isopropanol, more preferably methanol, ethanol and isopropanol.

(iii) The temperature of the catalytic reaction is 20-60 ℃, preferably 25-50 ℃, more preferably 25-32 ℃.

(iiii) the reaction time is 1 to 24 hours, preferably 5 to 12 hours.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Compared with the prior art, the invention has the following beneficial effects:

(i) the invention provides a plurality of carbonyl reductase mutants, which can obviously improve the capability of converting carbonyl reductase into a series of 17-carbonyl steroid compounds and have high stereoselectivity.

(ii) The recombinant cell provided by the invention can be used as a biocatalyst, can obtain a target product with high yield by using high substrate feeding concentration, has few byproducts, the yield is not lower than 95%, the conversion time is short, the used biocatalyst is low in dosage, the space-time yield is far higher than the current reported level, and the preparation method is simple and convenient, mild in condition and environment-friendly.

Drawings

FIG. 1 shows an HPLC chart of a 17 β -hydroxy-androst-4-en-3-one standard;

FIG. 2 shows HPLC charts of products obtained by converting androst-4-ene-3, 17-dione to example 4,5,6,7, with retention time of 17 β -hydroxy-androst-4-ene-3-one of 7.618min and retention time of androst-4-ene-3, 17-dione of 14.161 min;

FIG. 3 shows an HPLC chart of 17 β -hydroxy-19-nor-androst-4-ene-3, 17-dione standards;

FIG. 4 shows an HPLC chart of the product obtained by converting 19-norandrost-4-ene-3, 17-dione in examples 4,5,6,7, with the retention time of 17 β -hydroxy-19-norandrost-4-ene-3, 17-dione being 8.089min and the retention time of 19-norandrost-4-ene-3, 17-dione being 15.039 min;

FIG. 5 shows an HPLC plot of a 17 β -hydroxy-estra-4, 9-dien-3-one standard;

FIG. 6 shows the HPLC chart of the product obtained by converting estra-4, 9-diene-3, 17-dione in example 4,5,6,7, with a retention time of 10.653min for 17 β -hydroxy-estra-4, 9-diene-3-one and 21.067min for estra-4, 9-diene-3, 17-dione.

Detailed Description

To further illustrate the technical means and effects of the present invention, the following embodiments further illustrate the technical solutions of the present invention, but the present invention is not limited to the scope of the embodiments.

Term(s) for

As used herein, the term "AxxB" means the amino acid a at position xx is changed to amino acid B, e.g., "Y59A" means the amino acid Y at position 59 is mutated to a, and so on.

Example 1: preparation of wild-type carbonyl reductase (RasADH) recombinant expression plasmid and recombinant expression transformant

The sequence of SEQ ID No.1 is completely synthesized and then is connected to a pET21a vector, then is transferred into a competent cell of escherichia coli BL21(DE3), and a positive clone is selected, thus obtaining a recombinant expression transformant E.coli BL21(DE3)/pET-21 a-RasADH.

Example 2: construction of carbonyl reductase RasADH mutant

In order to improve the activity of wild carbonyl reductase RasADH (the amino acid sequence of which is SEQ ID No.1 and the coding nucleotide sequence of which is SEQ ID No.3), site 205 is subjected to site-directed saturation mutation, and the specific steps are as follows:

(i) introducing mutation: the forward and reverse primers were designed based on the nucleotide shown in SEQ ID No.3, and the specific primers are shown in Table 1 below:

TABLE 1

Site of the body	Upstream primer	Downstream primer
			F205A	CTGCGTGCTAAAGCTGCTGCTGCTACC	GGTAGCAGCAGCAGCTTTAGCACGCAG
F205R	CTGCGTGCTAAAAGGGCTGCTGCTACC	GGTAGCAGCAGCCCTTTTAGCACGCAG
			F205K	CTGCGTGCTAAAAAGGCTGCTGCTACC	GGTAGCAGCAGCCTTTTTAGCACGCAG
F205I	CTGCGTGCTAAAATTGCTGCTGCTACC	GGTAGCAGCAGCAATTTTAGCACGCAG
			F205H	CTGCGTGCTAAACATGCTGCTGCTACC	GGTAGCAGCAGCATGTTTAGCACGCAG
F205L	CTGCGTGCTAAACTTGCTGCTGCTACC	GGTAGCAGCAGCAAGTTTAGCACGCAG
			F205W	CTGCGTGCTAAATGGGCTGCTGCTACC	GGTAGCAGCAGCCCATTTAGCACGCAG
F205M	CTGCGTGCTAAAATGGCTGCTGCTACC	GGTAGCAGCAGCCATTTTAGCACGCAG
			F205P	CTGCGTGCTAAACCTGCTGCTGCTACC	GGTAGCAGCAGCAGGTTTAGCACGCAG
F205C	CTGCGTGCTAAATGCGCTGCTGCTACC	GGTAGCAGCAGCGCATTTAGCACGCAG
			F205V	CTGCGTGCTAAAGTTGCTGCTGCTACC	GGTAGCAGCAGCAACTTTAGCACGCAG
F205G	CTGCGTGCTAAAGGTGCTGCTGCTACC	GGTAGCAGCAGCACCTTTAGCACGCAG
			F205S	CTGCGTGCTAAATCTGCTGCTGCTACC	GGTAGCAGCAGCAGATTTAGCACGCAG
F205Q	CTGCGTGCTAAACAAGCTGCTGCTACC	GGTAGCAGCAGCTTGTTTAGCACGCAG
			F205Y	CTGCGTGCTAAATATGCTGCTGCTACC	GGTAGCAGCAGCATATTTAGCACGCAG
F205D	CTGCGTGCTAAAGATGCTGCTGCTACC	GGTAGCAGCAGCATCTTTAGCACGCAG
			F205E	CTGCGTGCTAAAGAGGCTGCTGCTACC	CTGCGTGCTAAAGAGGCTGCTGCTACC
F205T	CTGCGTGCTAAAACTGCTGCTGCTACC	GGTAGCAGCAGCAGTTTTAGCACGCAG
			F205N	CTGCGTGCTAAAAATGCTGCTGCTACC	GGTAGCAGCAGCATTTTTAGCACGCAG

Mixing a primer and a template plasmid, adding high-fidelity polymerase KOD-Plus, carrying out whole-plasmid PCR amplification, and detecting a PCR product by electrophoresis after the PCR is finished, wherein the PCR amplification system is as follows:

the amplification conditions of the PCR reaction were as follows:

(ii) and (3) transformation: adding Dpn I enzyme, digesting the template, transferring into Escherichia coli competence BL21(DE3), culturing overnight at 37 ℃, selecting a single clone to a test tube, and sequencing the corresponding gene;

(iii) inducing expression: inoculating the strain into a 100ml shake flask, culturing at 37 ℃ until OD600 is 0.8, reducing the culture temperature to 25 ℃, and adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1mM to induce expression for 16 h;

(iiii) determination of the mutant enzyme activity and reaction verification.

The enzyme activity determination method comprises the following steps: the enzyme-labeling instrument is adopted for detecting the method, and the specific method comprises the following steps: the cells after induction expression were collected, resuspended in a pH 7.0 phosphate buffer solution to a wet cell concentration of 10g/l, and after ultrasonication, the supernatant was collected by centrifugation at 13000 rpm. The enzyme activity measuring system 200. mu.l includes pH 7.0 phosphate buffer, 0.5mM NADPH, 0.8mM substrate (dissolved in methanol), and appropriate amount of enzyme solution is added to measure the change of NADPH absorbance value at 340nm, and the enzyme activity is defined: the amount of enzyme required to catalytically oxidize 1. mu. mol of NADPH per minute was 1 enzyme activity unit (U).

Reaction verification: pH 7.0 phosphate buffer, 10g/l crude enzyme solution after wet cell disruption, Glucose Dehydrogenase (GDH)3.2U/ml, substrate 10g/l (N, N-dimethylformamide solubilizing), 0.5g/l NADP⁺And reacting at 30 ℃ for 1-3h to stop the reaction. The reaction solution was extracted with ethyl acetate and the conversion and stereoselectivity were measured by HPLC. The substrate comprises androst-4-ene-3, 17-dione, 19-norandrost-4-ene-3, 17-dione, estra-4, 9-diene-3, 17-dione and androst-1, 4-diene-3, 17-dione.

The product determination method comprises the following steps: an agent high performance liquid chromatograph, a chromatographic column: chiralpak OD-H (5 μm, 4.6X 250mm), mobile phase: n-hexane-isopropyl alcohol (V/V70: 30), detection wavelength: 254nm, column temperature: 30 ℃, flow rate: 0.6 ml/min.

The data of the mutants on the enzyme activity of 4 substrates including androst-4-ene-3, 17-dione, 19-norandrost-4-ene-3, 17-dione, estra-4, 9-diene-3, 17-dione and androst-1, 4-diene-3, 17-dione are shown in Table 2 below.

TABLE 2

Example 3: construction of carbonyl reductase RasADH mutant and Glucose Dehydrogenase (GDH) co-expression recombinant cell

The RasADH mutant gene constructed in the example 2 and a glucose dehydrogenase gene existing in a laboratory are used as templates, the mutant gene and the GDH gene are amplified by a PCR method, are respectively connected to two reading frames of a co-expression vector pRSFDuet after being purified, and are transformed into escherichia coli competence BL21(DE3) after being verified successfully, and a positive clone is selected, namely the recombinant cell co-expressed by the RasADH mutant and the GDH is obtained.

Example 4: method for preparing 17 beta-hydroxy steroid compound by carbonyl reductase RasADH F205G and Glucose Dehydrogenase (GDH) co-expression recombinant cell

Preparing 50ml of seed solution, wherein the culture medium is LB culture medium, picking out single colony of constructed pRSFDuet-RasADH F205A-GDH gene engineering bacteria by using an inoculating loop, inoculating into the culture medium, and culturing at 37 ℃ and 200rpm overnight. The seed liquid for overnight culture was transferred to a fermentation medium (LB medium) at an inoculum size of 1%, cultured at 37 ℃ and 200rpm to OD₆₀₀About 0.6-1.0 mM IPTG was added and the mixture was induced at 25 ℃ and 200rpm for 10-16 h. The cells were collected by centrifugation at 4 ℃ and 6000rpm and used as biocatalysts.

(1) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate androst-4-ene-3, 17-dione (10% v/v methanol) is added to the thalli concentration of 15g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(2) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate 9 alpha-hydroxyandrost-4-ene-3, 17-diketone (10% v/v ethanol) is added to the thalli to the final concentration of 8g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(3) Taking the thalli to be resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, adding a substrate androst-4-ene-3, 11, 17-trione (10% v/v isopropanol) to the final concentration of 10g/l, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(4) The bacterial cells were resuspended in 100ml of phosphate buffer (pH 7.0, 100mM) at a bacterial concentration of 20g/l, and the substrate androsta-4, 9(11) -diene-3, 17-dione (10% v/v methanol) was added to a final concentration of 8g/l, reacted at 30 ℃ and 200r/min on a shaker, and the reaction was stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(5) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate 19-norandrost-4-ene-3, 17-diketone (10% v/v ethanol) is added to the thalli concentration of 20g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(6) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate of estra-4, 9-diene-3, 17-diketone (10% v/v isopropanol) is added to the thalli concentration of 15g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 97% (β) by HPLC.

(7) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate 19-hydroxyandrost-4-ene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 10g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(8) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate 3 beta-hydroxy-5-androstene-17-ketone (10% v/v ethanol) is added to the thalli concentration of 5g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(9) The cells were resuspended in 100ml of phosphate buffer (pH 7.0, 100mM) at a cell concentration of 20g/l, the substrate estrone (10% v/v isopropanol) was added to a final concentration of 5g/l, the reaction was carried out at 30 ℃ and 200r/min on a shaker, and the reaction was stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(10) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate androstane-1, 4-diene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 20g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(11) The thalli is taken and resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/l, a substrate epiandrosterone (10% v/v ethanol) is added to the thalli concentration of 5g/l, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

Example 5: method for preparing 17 beta-hydroxy steroid compound by carbonyl reductase RasADH F205C and Glucose Dehydrogenase (GDH) co-expression recombinant cell

(1) Taking the thalli to be resuspended in 100ml of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, adding a substrate androst-4-ene-3, 17-diketone (10% v/v methanol) to the final concentration of 15g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(2) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 9 alpha-hydroxyandrost-4-ene-3, 17-diketone (10% v/v ethanol) to the final concentration of 10g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(3) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate androst-4-ene-3, 11, 17-trione (10% v/v isopropanol) to the final concentration of 12g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(4) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate androstane-4, 9(11) -diene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 8g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(5) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the concentration of the thalli to be 20g/L, adding a substrate 19-norandrostane-4-alkene-3, 17-diketone (10% v/v ethanol) to the final concentration of 25g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(7) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 19-hydroxyandrost-4-ene-3, 17-diketone (10% v/v methanol) to the final concentration of 10g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(8) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the concentration of the thalli to be 20g/L, adding a substrate of 3 beta-hydroxy-5-androstene-17-ketone (10% v/v ethanol) to the final concentration of 5g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

Example 6: method for preparing 17 beta-hydroxy steroid compound by carbonyl reductase RasADH F205A and Glucose Dehydrogenase (GDH) co-expression recombinant cell

(1) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate androst-4-ene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 18g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(2) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 9 alpha-hydroxyandrost-4-ene-3, 17-diketone (10% v/v ethanol) to the final concentration of 12g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(3) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate androst-4-ene-3, 11, 17-trione (10% v/v isopropanol) to the final concentration of 15g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(4) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate androstane-4, 9(11) -diene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 10g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(5) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 19-norandrostane-4-alkene-3, 17-diketone (10% v/v ethanol) to the final concentration of 25g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(7) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 19-hydroxyandrost-4-ene-3, 17-diketone (10% v/v methanol) to the final concentration of 15g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(10) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate androstane-1, 4-diene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 25g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

Example 7: method for preparing 17 beta-hydroxy steroid compound by carbonyl reductase RasADH F205I and Glucose Dehydrogenase (GDH) co-expression recombinant cell

(1) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate androst-4-ene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 20g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(2) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 9 alpha-hydroxyandrost-4-ene-3, 17-diketone (10% v/v ethanol) to the final concentration of 15g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(3) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate androst-4-ene-3, 11, 17-trione (10% v/v isopropanol) to the final concentration of 18g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(4) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate androstane-4, 9(11) -diene-3, 17-diketone (10% v/v methanol) is added to the thalli concentration of 15g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 8 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

(6) The thalli is taken and resuspended in 100mL of phosphate buffer (pH 7.0, 100mM), the thalli concentration is 20g/L, a substrate of estra-4, 9-diene-3, 17-diketone (10% v/v isopropanol) is added to the thalli concentration of 20g/L, the reaction is carried out on a shaking table at 30 ℃ and 200r/min, and the reaction is stopped after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 97% (β) by HPLC.

(7) Taking the thalli to be resuspended in 100mL of phosphate buffer (pH 7.0, 100mM) and the thalli concentration is 20g/L, adding a substrate 19-hydroxyandrost-4-ene-3, 17-diketone (10% v/v methanol) to the final concentration of 18g/L, reacting on a shaking table at 30 ℃ and 200r/min, and stopping the reaction after 5 h. After the reaction, the reaction solution was extracted with ethyl acetate several times, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. Conversion > 96% and de > 99% (β) by HPLC.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> carbonyl reductase mutant and application thereof in catalytic synthesis of 17 beta-hydroxy steroid compound

<130> Minglong Shao, Xian Zhang, Zhiming Rao, et al. Green Chemistry,

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 249

<212> PRT

<213> Ralstonia sp.

<400> 1

Met Tyr Arg Leu Leu Asn Lys Thr Ala Val Ile Thr Gly Gly Asn Ser

1 5 10 15

Gly Ile Gly Leu Ala Thr Ala Lys Arg Phe Val Ala Glu Gly Ala Tyr

20 25 30

Val Phe Ile Val Gly Arg Arg Arg Lys Glu Leu Glu Gln Ala Ala Ala

35 40 45

Glu Ile Gly Arg Asn Val Thr Ala Val Lys Ala Asp Val Thr Lys Leu

50 55 60

Glu Asp Leu Asp Arg Leu Tyr Ala Ile Val Arg Glu Gln Arg Gly Ser

65 70 75 80

Ile Asp Val Leu Phe Ala Asn Ser Gly Ala Ile Glu Gln Lys Thr Leu

85 90 95

Glu Glu Ile Thr Pro Glu His Tyr Asp Arg Thr Phe Asp Val Asn Val

100 105 110

Arg Gly Leu Ile Phe Thr Val Gln Lys Ala Leu Pro Leu Leu Arg Asp

115 120 125

Gly Gly Ser Val Ile Leu Thr Ser Ser Val Ala Gly Val Leu Gly Leu

130 135 140

Gln Ala His Asp Thr Tyr Ser Ala Ala Lys Ala Ala Val Arg Ser Leu

145 150 155 160

Ala Arg Thr Trp Thr Thr Glu Leu Lys Gly Arg Ser Ile Arg Val Asn

165 170 175

Ala Val Ser Pro Gly Ala Ile Asp Thr Pro Ile Ile Glu Asn Gln Val

180 185 190

Ser Thr Gln Glu Glu Ala Asp Glu Leu Arg Ala Lys Phe Ala Ala Ala

195 200 205

Thr Pro Leu Gly Arg Val Gly Arg Pro Glu Glu Leu Ala Ala Ala Val

210 215 220

Leu Phe Leu Ala Ser Asp Asp Ser Ser Tyr Val Ala Gly Ile Glu Leu

225 230 235 240

Phe Val Asp Gly Gly Leu Thr Gln Val

245

<210> 2

<211> 262

<212> PRT

<213> Bacillus sp.

<400> 2

Met Gly Tyr Pro Asp Leu Lys Gly Lys Val Val Ala Ile Thr Gly Ala

1 5 10 15

Ala Ser Gly Leu Gly Lys Ala Met Ala Ile Arg Phe Gly Lys Glu Gln

20 25 30

Ala Lys Val Val Ile Asn Tyr Tyr Ser Asn Lys Gln Asp Pro Asn Glu

35 40 45

Val Lys Glu Glu Val Ile Lys Ala Gly Gly Glu Ala Val Val Val Gln

50 55 60

Gly Asp Val Thr Lys Glu Glu Asp Val Lys Asn Ile Val Gln Thr Ala

65 70 75 80

Ile Lys Glu Phe Gly Thr Leu Asp Ile Met Ile Asn Asn Ala Gly Leu

85 90 95

Glu Asn Pro Val Pro Ser His Glu Met Pro Leu Lys Asp Trp Asp Lys

100 105 110

Val Ile Gly Thr Asn Leu Thr Gly Ala Phe Leu Gly Ser Arg Glu Ala

115 120 125

Ile Lys Tyr Phe Val Glu Asn Asp Ile Lys Gly Asn Val Ile Asn Met

130 135 140

Ser Ser Val His Glu Val Ile Pro Trp Pro Leu Phe Val His Tyr Ala

145 150 155 160

Ala Ser Lys Gly Gly Ile Lys Leu Met Thr Glu Thr Leu Ala Leu Glu

165 170 175

Tyr Ala Pro Lys Gly Ile Arg Val Asn Asn Ile Gly Pro Gly Ala Ile

180 185 190

Asn Thr Pro Ile Asn Ala Glu Lys Phe Ala Asp Pro Lys Gln Lys Ala

195 200 205

Asp Val Glu Ser Met Ile Pro Met Gly Tyr Ile Gly Glu Pro Glu Glu

210 215 220

Ile Ala Ala Val Ala Ala Trp Leu Ala Ser Lys Glu Ala Ser Tyr Val

225 230 235 240

Thr Gly Ile Thr Leu Phe Ala Asp Gly Gly Met Thr Gln Tyr Pro Ser

245 250 255

Phe Gln Ala Gly Arg Gly

260

<210> 3

<211> 750

<212> DNA

<213> Ralstonia sp.

<400> 3

atgtaccgtc tgctgaacaa aaccgctgtt atcaccggtg gtaactctgg tatcggtctg 60

gctaccgcta aacgtttcgt tgctgaaggt gcttacgttt tcatcgttgg tcgtcgtcgt 120

aaagaactgg aacaggctgc tgctgaaatc ggtcgtaacg ttaccgctgt taaagctgac 180

gttaccaaac tggaagacct ggaccgtctg tacgctatcg ttcgtgaaca gcgtggttct 240

atcgacgttc tgttcgctaa ctctggtgct atcgaacaga aaaccctgga agaaatcacc 300

ccggaacact acgaccgtac cttcgacgtt aacgttcgtg gtctgatctt caccgttcag 360

aaagctctgc cgctgctgcg tgacggtggt tctgttatcc tgacctcttc tgttgctggt 420

gttctgggtc tgcaggctca cgacacctac tctgctgcta aagctgctgt tcgttctctg 480

gctcgtacct ggaccaccga actgaaaggt cgttctatcc gtgttaacgc tgtttctccg 540

ggtgctatcg acaccccgat catcgaaaac caggtttcta cccaggaaga agctgacgaa 600

ctgcgtgcta aattcgctgc tgctaccccg ctgggtcgtg ttggtcgtcc ggaagaactg 660

gctgctgctg ttctgttcct ggcttctgac gactcttctt acgttgctgg tatcgaactg 720

ttcgttgacg gtggtctgac ccaggtttaa 750

Claims

1. A mutant carbonyl reductase, having an amino acid sequence that differs from the amino acid sequence of a wild-type carbonyl reductase of SEQ ID NO: 1 is at least 90% identical and said mutant has the ability to convert a 17-carbonyl steroid to a 17 β -hydroxy steroid.

2. The mutant according to claim 1, wherein the wild-type carbonyl reductase (RasADH) is derived from Ralstonia sp.

3. The mutant according to claim 1 or 2, comprising a mutation at a position corresponding to the amino acid sequence of SEQ ID NO: 1, position 205 in amino acids 1 to 249.

4. The mutant according to claim 3, which corresponds to SEQ ID NO: 1 to alanine (a), arginine (R), lysine (K), isoleucine (I), histidine (H), leucine (L), tryptophan (W), methionine (M), proline (P), cysteine (C), valine (V), glycine (G), serine (S), glutamine (Q), tyrosine (Y), aspartic acid (D), glutamic acid (E), threonine (T), asparagine (N), preferably alanine (a), valine (V), cysteine (C), isoleucine (I), leucine (L), threonine (T), serine (S), glycine (G), more preferably alanine (a), cysteine (C), isoleucine (I), glycine (G).

5. A polynucleotide encoding the carbonyl reductase mutant of any one of claims 1 to 4.

6. A recombinant cell, whereinThe recombinant cell expresses the carbonyl reductase mutant of any one of claims 1-4, and expresses the carbonyl reductase mutant capable of catalyzing NADP⁺Glucose Dehydrogenase (GDH) synthesizing NADPH, the amino acid sequence of which is set forth in SEQ ID NO: 2, respectively.

7. A process for the preparation of a 17 β -hydroxysteroid compound, characterized in that the recombinant cells obtained in claim 6 are contacted with a reaction substrate and subjected to a catalytic reaction, thereby obtaining said 17 β -hydroxysteroid compound.

8. The method of claim 7, wherein the reaction substrate comprises androst-4-ene-3, 17-dione, 9 α -hydroxyandrost-4-ene-3, 17-dione, androst-4-ene-3, 11, 17-trione, androst-4, 9(11) -diene-3, 17-dione, 19-norandrost-4-ene-3, 17-dione, estra-4, 9-diene-3, 17-dione, 19-hydroxyandrost-4-ene-3, 17-dione, 3 β -hydroxy-5-androsten-17-one, estrol, androsta-1, 4-diene-3, 17-dione, epiandrosterone.