CN112843027B - Application of 2-chloro-6-methoxyresorcinol in inhibiting mycobacterium tuberculosis tyrosine phosphatase A - Google Patents

Abstract

The invention belongs to the technical field of medicinal chemistry, and particularly relates to application of 2-chloro-6-methoxyresorcinol in inhibiting mycobacterium tuberculosis tyrosine phosphatase A, in order to develop a novel antitubercular medicament, the invention provides novel application of a compound 2-chloro-6-methoxyresorcinol, the compound has remarkable inhibitory activity on mycobacterium tuberculosis tyrosine phosphatase A, has low cytotoxicity, can be developed into a novel antitubercular medicament taking MptpA as an action target spot, is prepared into a mycobacterium tuberculosis tyrosine phosphatase inhibitor or antitubercular medicament form, and improves a new direction for tuberculosis treatment.

Description

Application of 2-chloro-6-methoxyresorcinol in inhibiting mycobacterium tuberculosis tyrosine phosphatase A

Technical Field

The invention belongs to the technical field of medicinal chemistry, and particularly relates to application of 2-chloro-6-methoxyresorcinol in inhibiting mycobacterium tuberculosis tyrosine phosphatase A.

Background

Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium Tuberculosis (Mycobacterium Tuberculosis), mainly Tuberculosis, and seriously threatens human health. In order to deal with the serious prevention and control current situation of tuberculosis, the research and development of novel antituberculosis drugs, in particular to drugs for treating drug-resistant tuberculosis, is urgent and important.

Mycobacterium tuberculosis tyrosine phosphatase A (MptpA) is a key virulence factor secreted into host cells by Mycobacterium tuberculosis when infecting the host cells, and MptpA can be combined with V-ATPase on lysosome to enable the MTP to catalyze dephosphorylation of substrate human C vesicle sorting protein (VPS 33B), thereby blocking fusion of phagocytes and lysosomes, inhibiting phagosome maturation and preventing bacteria from being degraded by the lysosomes of the host. Following the MptpA deletion, the proliferation capacity of tubercle bacillus in macrophages is markedly reduced. Thus, MptpA plays an important role in the survival and growth of tubercle bacillus in host cells. Therefore, the search for inhibitors targeting MptpA is of great significance for the development of novel antituberculosis drugs, especially drug-resistant bacterial drugs.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides a new application of a compound 2-chloro-6-methoxyresorcinol, namely, the compound can inhibit mycobacterium tuberculosis tyrosine phosphatase A and can be applied to preparation of mycobacterium tuberculosis tyrosine phosphatase inhibitors or anti-tuberculosis drugs.

In order to achieve the purpose, the invention adopts the technical scheme that:

the invention provides application of 2-chloro-6-methoxyresorcinol in preparation of a mycobacterium tuberculosis tyrosine phosphatase A inhibitor.

The invention also provides application of the 2-chloro-6-methoxyresorcinol in preparing anti-tuberculosis drugs.

The research of the invention finds that the compound 2-chloro-6-methoxyresorcinol has obvious inhibitory activity on mycobacterium tuberculosis tyrosine phosphatase A and IC thereof ₅₀ 6.42 +/-0.46 mu M, low cytotoxicity to human breast cancer cells MCF-7 and human colorectal adenocarcinoma cells Caco-2, and low IC ₅₀ The values are all larger than 30 mu M, which proves that the compound can effectively inhibit the dephosphorylation activity of mycobacterium tuberculosis tyrosine phosphatase A, can be developed into a novel antitubercular drug taking MptpA as an action target spot, and has clinical application prospect and potential for tuberculosis treatment.

Preferably, the 2-chloro-6-methoxyresorcinol also comprises 2-chloro-6-methoxyresorcinol derivatives or/and pharmaceutically acceptable salts of 2-chloro-6-methoxyresorcinol, according to the above-mentioned application.

Specifically, the structure of the 2-chloro-6-methoxyresorcinol is shown as the formula (I):

the invention also provides a mycobacterium tuberculosis tyrosine phosphatase A inhibitor which takes 2-chloro-6-methoxy resorcinol as a main active ingredient.

The invention also provides an anti-tuberculosis drug, which takes 2-chloro-6-methoxyl resorcinol as a main active component.

Preferably, the concentration of the 2-chloro-6-methoxyresorcinol is 6.42 μ M to 30 μ M according to the mycobacterium tuberculosis tyrosine phosphatase A inhibitor or the anti-tubercular drug as described above.

Preferably, the mycobacterium tuberculosis tyrosine phosphatase a inhibitor or the anti-tuberculosis drug further comprises a pharmaceutically acceptable carrier and/or excipient. The mycobacterium tuberculosis tyrosine phosphatase A inhibitor or the anti-tuberculosis medicine takes 2-chloro-6-methoxyl resorcinol as a main active ingredient, is mixed with a pharmaceutically acceptable carrier and/or excipient to prepare a composition, and is prepared into a clinically acceptable dosage form.

Furthermore, the dosage forms refer to clinically common injections, tablets, capsules and the like. Pharmaceutical formulations may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically), and if certain drugs are unstable under gastric conditions, they may be formulated as enteric coated tablets.

Further, the excipient refers to diluents, binders, lubricants, disintegrants, cosolvents, stabilizers and other pharmaceutical matrixes which can be used in the pharmaceutical field.

Further, the carrier is a functional pharmaceutical adjuvant acceptable in the pharmaceutical field, and comprises a surfactant, a suspending agent, an emulsifier and some novel pharmaceutical high polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid and the like.

Compared with the prior art, the invention has the beneficial effects that:

the compound has obvious inhibition activity on mycobacterium tuberculosis tyrosine phosphatase A, has low cytotoxicity, can be developed into a novel anti-tuberculosis medicament taking MptpA as an action target spot, is prepared into a form of mycobacterium tuberculosis tyrosine phosphatase inhibitor or anti-tuberculosis medicament, and improves a new direction for treating tuberculosis.

Drawings

FIG. 1 shows SDS-PAGE results of purified Mycobacterium tuberculosis tyrosine phosphatase A protein;

in FIG. 1, lane M is a protein molecular weight standard.

FIG. 2 is an IC50 curve showing the inhibition of Mycobacterium tuberculosis tyrosine phosphatase A enzyme activity by the compound 2-chloro-6-methoxyresorcinol;

in FIG. 2, the abscissa is the logarithm of the concentration of the compound, and the ordinate is the inhibition ratio.

FIG. 3 shows the type of inhibition of Mycobacterium tuberculosis tyrosine phosphatase A (MptpA) and human tyrosine phosphatase 1B (PTP1B) by compound 2-chloro-6-methoxyresorcinol.

In FIG. 3, the abscissa is the reciprocal of the pNPP substrate concentration and the ordinate is the reciprocal of the reaction rate.

Detailed Description

The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

The experimental procedures in the following examples were carried out by conventional methods unless otherwise specified, and the test materials used in the following examples were commercially available by conventional methods unless otherwise specified.

EXAMPLE 12 preparation of chloro-6-methoxyresorcinol

The compound 2-chloro-6-methoxyresorcinol used in the examples was obtained in a one-step reaction according to the following reaction scheme, starting from 3-chloro-4-hydroxy-5-oxymethylbenzaldehyde (CAS: 19463-48-0), in a yield of 97%:

the preparation method comprises the following steps:

(1) 3-chloro-4-hydroxy-5-oxymethylbenzaldehyde was dissolved in 4% aqueous NaOH solution (1.5mL) (final concentration: 1 mmol), followed by addition of H ₂ O ₂ Aqueous solution (30%, 0.2mL), following the reaction by TLC (thin layer chromatography) for 20 to 30 min;

(2) adding the concentrate into the reaction solutionHydrochloric acid (0.37mL), and adding a small amount of FeCl ₃ ·6H ₂ O (1.12mmol) solution;

(3) filtering the precipitate and recrystallizing with acetone;

(4) purifying the recrystallized product by silica gel column chromatography using CH ₂ Cl ₂ Elution with MeOH (9:1) afforded the product 2-chloro-6-methoxyresorcinol.

In addition, the compound 2-chloro-6-methoxyresorcinol can also be isolated from the Tibetan Rhamnella viridis endophytic fungus Neurospora sp.DHLRH-F (Nature's science) with reference to the method in the literature (yellow plum, Hugupin, Chenbin, etc.. Dahua Rhamnella viridis endophytic fungus Neurospora sp.DHLRH-F, 2016, 55(2):81-84, proceedings of Zhongshan university, which is deposited at the institute of plateau biology, GenBank accession number KR492687, of the Tibetan autonomous region). The structural formula of the compound 2-chloro-6-methoxyresorcinol obtained by any method is the same, and the functions are the same, so the source of the compound is not limited by the invention. The compound 2-chloro-6-methoxyresorcinol is dissolved in DMSO, the concentration of mother liquor is 10mM, and the mixture is stored at room temperature and in dark for later use.

The structure of the 2-chloro-6-methoxyresorcinol is shown as a formula (I) (the number in the formula represents the serial number of a carbon atom in a structural formula):

example 2 expression and purification of Mycobacterium tuberculosis tyrosine phosphatase A (MptpA)

The Mycobacterium tuberculosis H37Ra genome DNA is used as a template, PCR amplification is carried out by using a key effector protein molecule MptpA gene specific primer, cloning is carried out to an expression vector pET28a, transformation is carried out to escherichia coli, and induced expression and MptpA purification are carried out.

1. Experimental Material

(1) Bacterial strains

Escherichia coli DH5 α, e.coli BL21(DE3) competent cells: all purchased from Beijing Quanzijin Biotechnology Ltd;

mycobacterium tuberculosis H37Ra (the strain is available from Shanghai Jingnuo Biotech, Inc.).

(2) Expression vector

The E.coli expression vector pET28a (purchased from Novagen).

(3)0.1M IPTG: weighing 0.24g of IPTG, dissolving in 10mL of double distilled water, filtering, sterilizing and storing at-20 ℃;

(4) protease inhibitor mini tablet, EDTA free (Pierce);

(5) histidine-tagged protein purification buffer:

1) lysis buffer: 25mM Tris, 500mM NaCl, 20mM imidazole, pH 7.8;

2) washing buffer solution: 25mM Tris, 500mM NaCl, 50mM imidazole, pH 7.8;

3) elution buffer: 25mM Tris, 500mM NaCl, 350mM imidazole, pH 7.8;

4) preservation buffer solution: 25mM Tris, 100mM NaCl, pH 7.8.

(6)Ni Sepharose 6Fast Flow(GE)；

(7) BCA protein concentration detection kit (Pierce).

2. Experimental methods

(1) Construction of prokaryotic expression recombinant vector

The genomic DNA of Mycobacterium tuberculosis H37Ra was extracted according to the instructions of the bacterial genome extraction kit (Omega). The extracted genomic DNA of M.tuberculosis H37Ra was used as a template for PCR amplification with an mptpA gene (Rv2234) specific primer (mptpA upstream primer: ATGGGTCGCGGATCCGTGTCTGATCCGCTG; mptpA downstream primer: GTGGTGGTGCTCGAGTCAACTCGGTCCGTT). The PCR reaction system is as follows:

the PCR reaction procedure was as follows:

the PCR product recovery and purification method refers to the DNA recovery kit (Vazyme), the purified product is cloned to an expression vector pET28a by using a one-step cloning kit (Vazyme), and transformed into Escherichia coli DH5 alpha to construct a recombinant plasmid, and the pET28a-MptpA expression plasmid is obtained after sequencing verification of the recombinant plasmid.

(2) Expression of recombinant plasmids in E.coli

The recombinant plasmid pET28a-MptpA is transformed into an Escherichia coli expression strain BL21(DE3) to obtain an engineering strain of the Escherichia coli for expressing MptpA. The engineering strain is inoculated to LB liquid culture medium containing kanamycin and shake culture is carried out at 37 ℃ for overnight. Inoculating 2mL of the overnight culture liquid into 100mL of LB culture liquid containing kanamycin, performing shake culture at 37 ℃ for 1.5h, adding an inducer IPTG (final concentration of 0.1mM), performing shake culture at 20 ℃ overnight, and inducing the engineering bacteria to express the target protein MptpA at low temperature.

(3) Purification of MptpA protein

1) And (3) collecting thalli: centrifuge at 5000 Xg for 5min at 4 deg.C, and discard the supernatant medium. The subsequent steps are carried out on ice, and the buffer solution is precooled. Add 20mL lysis buffer, resuspend the cells, centrifuge at 4 ℃ 5000 Xg for 5min, discard the supernatant.

2) Cracking: the cells were resuspended in 10mL lysis buffer and 0.1mL TritonX-100, 50. mu.L DTT (1M), one tablet of protease inhibitor, was added. The mixture was placed in an ice-water bath to sonicate the cells (sonication conditions: 3s on, 3s off, 15min total), the disrupted bacterial solution was transferred to a 50mL centrifuge tube, centrifuged at 4 ℃ at 10000 Xg for 25min, and the supernatant was purified by column chromatography.

3) And (3) purification: the purification packing Ni Sepharose 6Fast Flow agarose gel was loaded to a gravity purification column as specified and equilibrated with 10 bed volumes of lysis buffer. Adding the supernatant into a purification column, and standing on ice for 10min to fully combine the target protein with the filler. The deproteinized protein is washed by adding 20mL portions of washing buffer, and then the target protein is eluted with 10 column volumes of elution buffer.

4) Desalting and concentrating: transferring the protein eluate to Amicon Ultra-15(3kDa) ultrafiltration tube, centrifuging and concentrating (5000 Xg, 4 deg.C, 15min), and discarding the outer layer of collection tube liquid. The storage buffer was added to the upper collection tube and the buffer system was replaced by centrifugation (5000 Xg, 4 ℃ C., 15 min). The ultrafiltered concentrated protein was dispensed, stored at 4 ℃, and the purified protein concentration was determined according to the BCA protein assay kit (Pierce) and analyzed for size and purity by SDS-PAGE electrophoresis.

3. Results of the experiment

The successfully expressed MptpA carries a His-tag (protein size about 20kDa), and the target protein can be purified by a nickel-chelating Sepharose affinity column, and the nickel-chelating Sepharose filler Ni Sepharose 6Fast Flow (GE) is loaded onto a chromatographic gravity column (NEB) according to the instructions. During the optimized purification process, the MptpA protein bound to the nickel purification column was eluted with 5mL of elution buffers containing different imidazole concentrations (from low to high concentration), and the eluates from each purification step were collected and examined by SDS-PAGE. As shown in FIG. 1, when the sonicated supernatant was bound to the nickel affinity column for 5min, most of the target protein was bound to the nickel purification column, and when the imidazole concentration was 100mM, most of the contaminating proteins were washed away without eluting the target protein, and when the imidazole concentration was 200mM, the target protein began to be eluted. Therefore, the optimum imidazole concentration of the washing solution is 100mM, and the optimum imidazole concentration of the eluent is 350 mM.

Coli expression and purification procedures for Mycobacterium tuberculosis tyrosine phosphatase B (MptpB), human tyrosine phosphatase 1B (PTP1B) were the same as MptpA. Briefly, the genomic DNA of Mycobacterium tuberculosis H37Ra or the cDNA cloning vector of human PTP1B (purchased from Beijing Yiqian Shenzhou Biotechnology Co., Ltd.) is respectively used as a template, MPtpB (Rv0153c) or PTP1B gene (NM _002827.2) specific primers (MptpB upstream primer TGGACATATGATGGCTGTCCGTGAACT; MptpB downstream primer CCGCTCGAGTCCGAGCAGCACCC; PTP1B upstream primer GGATCCATATGATGGAGATGGAAAAGGAGTTCGAGC; PTP1B downstream primer AATATGCGGCCGCATTGTGTGGCTCCAGGATTCGTTT) are used for PCR amplification, the PCR amplification is carried out to clone to an expression vector pET28a, Escherichia coli DH5 alpha is transformed to construct a recombinant plasmid, the sequence of the recombinant plasmid is verified to obtain pET28a-MptpB, pET28a-PTP1B expression plasmids, the recombinant plasmids are transformed to Escherichia coli expression strain BL21(DE3), and an engineering strain of Escherichia coli expressing MptpB or PTP1B is obtained.

EXAMPLE 3 analysis of the enzyme inhibitory Activity of 2-chloro-6-methoxyresorcinol on Mycobacterium tuberculosis tyrosine phosphatase A (MptpA)

An experiment of inhibiting the enzyme activity of the compound was carried out in a reaction buffer (50mM Tris, 100mM NaCl, pH 7.0) using disodium p-nitrophenylphosphate (pNPP) as a substrate, and the Mycobacterium tuberculosis tyrosine phosphatase A used was the protein purified in example 1.

(1) Semi-inhibitory concentration IC ₅₀ Determination of value

The reaction was carried out in a 200. mu.L system, and 0.75. mu.g of MptpA, a gradient of the compound 2-chloro-6-methoxyresorcinol (final concentrations: 0. mu.M, 0.78. mu.M, 1.56. mu.M, 3.125. mu.M, 6.25. mu.M, 12.5. mu.M, 25. mu.M, 50. mu.M, respectively), and the compound and MptpA were added sequentially to a 96-well plate and premixed at room temperature for 5 min. pNPP (p-nitrophenylphosphate disodium salt) substrate was added to a final concentration of 1.2mM, reacted at 37 ℃ for 5min, and the absorbance was read from each well at 405 nm. At the same time, a blank control (DMSO or compound only) was set. The inhibitory activity of the compounds against the MptpA enzyme was calculated according to the following calculation method:

inhibition (%) [ 1- (experimental absorbance-blank absorbance)/(negative control absorbance-blank absorbance) ] × 100%.

The logarithm of the compound concentration is plotted on the abscissa and the inhibition on the ordinate, and IC50 is fitted and calculated by Origin Pro 8 software. Triplicate samples were made for each concentration and results are expressed as mean ± sd.

(2) Inhibition type analysis

Absorbance values were determined for different concentrations of pNPP substrate (0.1mM, 0.2mM, 0.4mM, 0.8mM, 1.6mM, 3.2mM) at different compound concentrations (0. mu.M, 5. mu.M, 10. mu.M, 20. mu.M) as described above, with 3 parallel wells for each concentration. Taking reciprocal of substrate concentration as abscissa and reciprocal of reaction rate as ordinate, performing double reciprocal mapping, determining inhibition type and calculating inhibition constant K _i 。

(3) Enzyme inhibition specificity assay for compounds

The compound has the inhibitory activity on mycobacterium tuberculosis tyrosine phosphatase B (MptpB) and human tyrosine phosphatase 1B (PTP1B), and the reaction system is the same as MptpA. Except that the reaction system of MptpB contained 1.5. mu.g of MptpB, 1.3mM of pNPP, and the concentration of the compound was 100. mu.M; the reaction system of PTP1B contained 1. mu.g of PTP1B, 2mM of pNPP, and the concentrations of the compounds were 0. mu.M, 0.78. mu.M, 1.56. mu.M, 3.125. mu.M, 6.25. mu.M, 12.5. mu.M, 25. mu.M, and 50. mu.M, respectively.

(4) Results of the experiment

The half-inhibitory concentration IC of the compound 2-chloro-6-methoxyresorcinol on the tyrosine phosphatase A of mycobacterium tuberculosis is measured through experiments ₅₀ 6.42. + -. 0.46. mu.M (see Table 1, FIG. 2); the compound has good specificity on MptpA enzyme inhibition, has no inhibition effect on mycobacterium tuberculosis homologous protein MptpB at the concentration of 100 mu.M, has selectivity more than 15 times (Table 1), also has inhibition effect on human PTP1B, but has lower inhibition activity than MptpA (IC) ₅₀ The values differ by a factor of 1.7, see table 1).

Further identifying the type of the inhibitory action of the compound 2-chloro-6-methoxyresorcinol on MptpA and PTP1B, intersecting four straight lines of inhibitors with different concentrations on the abscissa axis (see FIG. 3), indicating that the compound 2-chloro-6-methoxyresorcinol is a non-competitive inhibitor, and simultaneously obtaining the inhibitory constant K of the compound 2-chloro-6-methoxyresorcinol on MptpA and PTP1B _i The concentration was 6.13. + -. 0.51. mu.M, and 8.92. + -. 1.31. mu.M, respectively (Table 2).

TABLE 1 results of in vitro enzyme inhibitory Activity of Compound 2-chloro-6-methoxyresorcinol

SI is a selectivity index ^* ＝IC ₅₀ ^MptpB /IC ₅₀ ^MptpA .SI ^** ＝IC ₅₀ ^PTP1B /IC ₅₀ ^MptpA .

TABLE 2 Compound 2-chloro-6-methoxyresorcinol on MptpA, PTP1B enzymeInhibition constant measurement result (K) _i ,μM) ^a

^a The experiment was repeated three times and the results are expressed as mean ± standard deviation.

EXAMPLE 4 cell proliferation toxicity test of 2-chloro-6-methoxyresorcinol, a Compound

(1) Cell culture

Human breast cancer cell MCF-7 was cultured in DMEM medium containing 10% Fetal Bovine Serum (FBS), and human colorectal carcinoma cell Caco-2 was cultured in DMEM medium containing 20% FBS.

(2) Cell plating

When the cell adherence convergence reaches 80-90%, abandoning the culture medium, washing the cells twice with PBS, adding pancreatin for digestion, adding the culture medium after digestion to stop digestion, transferring to a centrifuge tube, and centrifuging for 4min at 600 rpm. The supernatant was discarded, the cells were resuspended in a medium (MCF-7: 10% FBS; Caco-2: 20% FBS), and a small amount of the cell suspension was counted. The density of the cell resuspension was adjusted to 5X 10 with the culture medium ⁴ cells/mL, diluted cells were seeded at 100. mu.L/well in 96-well plates. Place the cell culture plate in CO at 37 ℃ ₂ And (5) an incubator for overnight culture.

(3) Treatment of compounds

To a 96-well plate inoculated with cells, culture solution (0.78. mu.M, 1.56. mu.M, 3.125. mu.M, 6.25. mu.M, 12.5. mu.M, 25. mu.M, 50. mu.M, 100. mu.M) containing the compound 2-chloro-6-methoxyresorcinol at various concentrations was added, while a negative control group (containing 1% DMSO) and a blank control group (medium alone) were set, and three parallel wells were set for each concentration of the compound. Place the cell culture plate in CO at 37 ℃ ₂ And (5) culturing for 72 hours in an incubator.

(4) MTS processing

The medium was discarded from the wells, and 100. mu.L of the medium and 20. mu.L of MTS (promega) were added to each well and cultured for 0.5 to 1 hour. The plates were removed and the Absorbance (Absorbance, Ab) at 490nM was measured for each well. The inhibitory activity of the compounds on cell proliferation was obtained at different concentrations according to the following formula:

inhibition rate (%) ([ 1- (Ab) ] _{Experimental group} -Ab _{Blank group} )/(Ab _{Negative control} -Ab _{Blank group} )]×100％。

The logarithm of the compound concentration was plotted on the abscissa and the inhibition rate on the ordinate, and IC was calculated by Origin Pro 8 software fitting ₅₀ Results are expressed as mean ± standard deviation.

(5) Results of the experiment

The experimental result shows that the compound 2-chloro-6-methoxyresorcinol has lower cytotoxicity to human breast cancer cells MCF-7 and human colorectal adenocarcinoma cells Caco-2, and IC ₅₀ The values were all greater than 30. mu.M (see Table 3).

TABLE 3 cell proliferation toxicity test results (IC) of 2-chloro-6-methoxyresorcinol compound ₅₀ ,μM) ^a

^a The experiment was repeated three times and the results are expressed as mean ± standard deviation.

The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, and still fall within the scope of the invention.

Sequence listing

<110> Zhongshan university

Application of <120> 2-chloro-6-methoxyresorcinol in inhibiting mycobacterium tuberculosis tyrosine phosphatase A

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> mptpA upstream primer (Artificial sequence)

<400> 1

atgggtcgcg gatccgtgtc tgatccgctg 30

<210> 2

<211> 30

<212> DNA

<213> mptpA downstream primer (Artificial sequence)

<400> 2

gtggtggtgc tcgagtcaac tcggtccgtt 30

<210> 3

<211> 27

<212> DNA

<213> MptpB upstream primer (Artificial sequence)

<400> 3

tggacatatg atggctgtcc gtgaact 27

<210> 4

<211> 23

<212> DNA

<213> MptpB downstream primer (Artificial sequence)

<400> 4

ccgctcgagt ccgagcagca ccc 23

<210> 5

<211> 36

<212> DNA

<213> PTP1B upstream primer (Artificial sequence)

<400> 5

ggatccatat gatggagatg gaaaaggagt tcgagc 36

<210> 6

<211> 37

<212> DNA

<213> PTP1B downstream primer (Artificial sequence)

<400> 6

aatatgcggc cgcattgtgt ggctccagga ttcgttt 37

Claims (4)

1. Application of 2-chloro-6-methoxyresorcinol in preparing medicine for resisting tuberculosis is provided.
2. 2. Use according to claim 1, wherein the anti-tuberculosis agent is mycobacterium tuberculosis tyrosine phosphatase a.
3. 3. Use according to claim 1, wherein the concentration of 2-chloro-6-methoxyresorcinol is in the range of 6.42 μ Μ to 30 μ Μ.
4. 4. The use according to claim 1, wherein the medicament further comprises a pharmaceutically acceptable carrier and/or excipient.

Images