CN112831586B - Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof - Google Patents

Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof Download PDF

Info

Publication number
CN112831586B
CN112831586B CN202110138307.8A CN202110138307A CN112831586B CN 112831586 B CN112831586 B CN 112831586B CN 202110138307 A CN202110138307 A CN 202110138307A CN 112831586 B CN112831586 B CN 112831586B
Authority
CN
China
Prior art keywords
potato
virus
resistance gene
marker
indel
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110138307.8A
Other languages
Chinese (zh)
Other versions
CN112831586A (en
Inventor
聂碧华
黄维
宋波涛
涂振
李春燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202110138307.8A priority Critical patent/CN112831586B/en
Publication of CN112831586A publication Critical patent/CN112831586A/en
Application granted granted Critical
Publication of CN112831586B publication Critical patent/CN112831586B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A and application thereof. The A virus extreme resistance gene Ra linked Indel molecular marker comprises: an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC and the downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided. The invention takes potato common cultivar Barbara as a parent to be hybridized with F58050 to construct a backcross population. And (3) utilizing an NGS-BSA technology and combining molecular marker development to obtain an Indel marker linked with the extreme resistance gene Ra of the potato A virus. The invention utilizes Indel marker linked with extreme resistance gene Ra of potato virus A to detect the breeding high-generation line in the laboratory, and finds that the coincidence rate is as high as 65.5 percent, which indicates that the marker can be applied to auxiliary selection in potato antiviral breeding.

Description

Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof
Technical Field
The invention relates to the field of plant genetic engineering, in particular to an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A and application thereof. The Indel marker linked to the potato extreme resistance gene Ra is located on chromosome 4 of potato and is designated as M10-8.
Background
Potatoes (Solanum tuberosum L.) are used as the fourth major food crop in the world and are also important agricultural economic crops in China. With the promotion of the main grain deployment of potatoes in China, the potatoes which are used as both food and vegetables are more and more valued. However, in the past 20 years, potato virus disease and potato virus-induced seed potato degeneration have become one of the important problems affecting potato production. As many as 40 or more viruses and viroids can infect potatoes under field conditions, wherein six viruses such as Potato Virus Y (PVY), Potato Leaf Roll Virus (PLRV), Potato Virus A (PVA), Potato Virus X (PVX), Potato Virus M (PVM), Potato Virus S (PVS) and the like and one potato spindle tuber viroid (PSTVd) are the most harmful in China. These viruses not only cause physiological metabolic disorders and reduced viability of plants, but also cause various degrees of yield and quality reduction. The yield reduction caused by PVY and PLRV can reach more than 40% (Neibahua, et al, 2012; Palukaitis, 2012), and although the PVA has a slight infection symptom and a small influence, the PVA also causes more serious yield reduction when being infected with other viruses in a compound way.
PVA and PVY viruses infect potato plants at the cellular level, so that chemical agents are difficult to control, and the cultivation of disease-resistant varieties is the most effective, economic and environment-friendly virus control strategy. There are two main types of known potato host resistance, Extreme Resistance (ER) and Hypersensitive Resistance (HR), respectively. Extreme resistance refers to the absence of any symptoms resulting from the virus infecting the potato, whereas allergic resistance refers to the occurrence of necrotic symptoms resulting from the virus infecting the potato. However, during the course of continued infection with the virus, allergic resistance is overcome by the virus, but extreme resistance is not. The extreme resistance genes controlling PVA and PVY were previously reported as Ra and Ry, respectively. There are many reports on Ry at present, and three main sources of 4 Extreme Resistance (ER) genes have been reported, including Ry derived from solanum chacoensechcRy from S.tuberosum Group andigenadgAnd Ry derived from sstoAnd Ry-fstoThey map to potato chromosomes 9, 11 and 12, respectively (Valkonen et al, 2017). In addition, there are several Ny genes that mediate PVY allergic Resistance (HR) located (Valkonen et al, 2017). Meanwhile, related molecular markers are also developed for main resistance genes, such as molecular markers RY186, RYSC3 and YES3-3A and Ry respectivelychc、RyadgAnd RystoLinked and successfully applied in the breeding process of potatoes to help improve the selection efficiency (Ramakrishnan et al, 2015; Baileyi and Guohuachun, 2017; Lijia et al, 2017; Xujiafei and Jinliping, 2017).
However, the research on the resistance of PVA viruses belonging to the same genus of Y virus is relatively rare. Resistance identification of 4 potyviruses (TEV, PVY, PVA, PVV) was performed by Valkonen (1997) in partially-rooted potato wild species and cultivars, and the results showed that wild species S.stoloniferum, S.sucrense, and cultivar KingEdward, Pentland Dell, after inoculation with PVA virus, produced symptoms of allergic necrosis on the inoculated leaves and apical leaves, respectively, which may contain Na genes controlling allergic resistance, while the wild species s.ployadenium, which was asymptomatic neither in the rubdown nor in the engrafting inoculated with PVA, was undetectable for the presence of virus, and may contain Ra genes controlling extreme resistance (Valkonen, 1997). Studies showed that potato 2x (v-2)7 from s.tuberosum subsp.andigen was asymptomatic after rubbing inoculation with PVA and no virus was detected by ELISA. After grafting inoculation, the top leaf is necrotic, but low content of PVA is detected only in the part with necrosis symptoms, the asymptomatic part does not contain PVA virus, and the material also has an extreme resistance gene Ry to the PVY virusadg. The genetic analysis according to the linkage map of potato and tomato shows that RaadgLocated on chromosome 11 by the distance RyadgOnly 6.8cM (
Figure BDA0002927839820000021
et al, 1998). This is the first time that the extreme resistance gene of PVA is mapped in potato, however, the molecular marker studies related to the extreme resistance gene associated with potaavirus on the remaining chromosomes have not been reported.
The problems existing in the prior art are as follows: at present, Indel molecular markers linked with the extreme resistance gene Ra of the potato virus A are not reported; at present, no ideal marker capable of being used for molecular marker-assisted selection of the extreme resistance gene Ra of the potato virus A has been developed. Although the ELISA detection technology is accurate, the resistance needs to be identified after the material is inoculated, the breeding period is increased, and a large amount of manpower, material resources and financial resources are consumed.
Disclosure of Invention
The key technical problem to be solved by the invention is to provide an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A and application thereof.
In order to solve the technical problems, the invention adopts the following technical scheme:
1. the full-length sequence of the Indel molecular marker linked with the extreme resistance gene Ra of the potato A virus is as follows:
an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC, respectively;
a downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided.
2. The screening method of the potato A virus extreme resistance gene Ra linked Indel molecular marker comprises the following steps:
(1) constructing a backcross population: the parents Barbara and F58050 are breeding materials preserved in the laboratory. The BF145 filial generation of Barbara x F58050 shows disease resistance to PVA, and is backcrossed with BF145 and F58050 to construct a backcross population BC1F, 288 progeny in total. And (3) performing PVA inoculation on all the offspring, and determining the resistance of each offspring to PVA by ELISA detection, wherein the specific method refers to Nie-Bi-Hua, 2010.
(2)BC1Extraction of individual DNA from F population was performed by CTAB method (Dellaporta et al, 1983).
(3) As a result of identifying PVA resistance of all the progeny of the backcross population BC1F, 30 resistant individuals were selected from 288 individuals, and DNAs of the 60 individuals were collected. After equal mass mixing, 2 mixing pools, namely an R pool and an S pool, are constructed. And (3) sending the constructed R pool and S pool to a Nordhea provenance company for whole genome sequencing by using an Illumina sequencer, constructing a 350bp library for each pool, wherein the reading length is 150bp, the sequencing depth is 50 x (the library construction type is an animal and plant whole genome small fragment library (350bp), and the sequencing strategy is Hiseq-PE 150).
(4) The sequencing data were analyzed to obtain the differences Indel between the anti-sense pools, as shown in fig. 1. The specific analysis steps are as follows: comparing sequencing data of an anti-sense mixing pool with a reference genome by using an MEM (minimum essential medium) algorithm of BWA (version0.7015-r1140) to obtain an alignment result in an SAM (sample access architecture) format; converting the SAM format file into a BAM format by using samtools software (version 1.3.1); thirdly, sorting reads in the BAM file by using SortSam in a Picard tool (version1.91), and enabling the obtained BAM file to be used for counting Indel differences among the anti-sense mixing pools.
(5) Polymorphic Indel marker screening: PGSC _ DM _ v4.03 genome sequence is downloaded from http:// potato. plant biology. msu.edu/PGSC _ download. shtml, DNA sequence of Indel site on No. 4 chromosome is searched, 150bp sequence before and after the site is selected, and primer is designed according to default parameters on NCBI (https:// www.ncbi.nlm.nih.gov/tools/primer/index. cgilink _ LOC ═ BlastHome). A total of 120 primers were designed and polymorphism screening was performed between the parents BF145 and F58050, yielding a total of 20 primers with polymorphisms.
(6) All individuals in the BC1F population were PCR amplified using the polymorphic primers between the parents BF145 and F58050 obtained by the screening. The PCR reaction system is 20 μ l, which is as follows: 1. mu.l of DNA template (50 ng/. mu.l), 0.5. mu.l of each of upstream and downstream primers (10. mu.M), 10. mu.l of Utaq PCR Mix (2X), ddH2O8. mu.l. The reaction program adopts a Touchdown PCR program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out. The gel was electrophoresed with 9% native polyacrylamide gel and developed with silver stain. The results are recorded. The results were recorded in the manner that "1" was recorded with the occurrence of a differential band and "0" was recorded with the occurrence of a non-differential band. A total of 20 differential bands were obtained.
(7) According to BC1Phenotype data for F, progeny were 1/0 transformed for phenotypic resistance (1 ═ R, 0 ═ S). The linkage relationship between the marker and the phenotype was analyzed using 4-ploid genetic analysis software tetraploid map, and it was found that Ra was closely linked to marker M10-8, and the genetic distance was only 0.4 cM.
(8) The primer sequence labeled M10-8 is as follows: F-ATCGGGCTTAACAGACCGC, R-GACTGACCTGCTCTTTTTGGC; the product size was 197 bp.
3. The application of the potato A virus extreme resistance gene Ra linked Indel molecular marker comprises:
(1) 58 high generation materials from the laboratory were inoculated with PVA and ELISA tested for resistance to PVA.
(2) 58 parts of material DNA is extracted by a CTAB method.
(3) The method is characterized in that 58 parts of high-generation materials are detected by using a marker M10-8, and the method comprises the following specific steps: 1 ul of DNA template (50 ng/. mu.l), 0.5 ul of upstream and downstream primers (10 uM) respectively, 10 ul of Utaq PCR Mix (2X), and 8 ul of ddH2O 8 for PCR amplification reaction system; secondly, adopting a Touchdown PCR program as a reaction program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out; and thirdly, detecting by using 3 percent agarose gel.
(4) As a result, it was found that 34 parts of the 58 high-generation materials exhibited extreme resistance to PVA, and 26 parts exhibited extreme feeling to PVA. The detection of 58 parts of high-generation materials by using the marker M10-8 shows that the coincidence rate of the phenotype identification result of 58 parts of materials and the detection result of the marker reaches 65.5 percent. Correlation analysis was performed between the phenotypic identification and the marker detection with a correlation coefficient of 0.278 and significant correlation at the 0.05 level. The above results indicate that the marker is closely related to the resistance of potato to PVA, and the marker can be used to better distinguish the resistance of high-generation potato lines to PVA.
Has the advantages that:
(1) the invention takes potato common cultivar Barbara as a parent to be hybridized with F58050 to construct a backcross population. The Indel marker linked with the extreme resistance gene Ra of the potato virus A is obtained by utilizing the NGS-BSA technology and combining the development of molecular markers, and a foundation is laid for the cloning of the resistance gene Ra.
(2) The invention utilizes Indel marker linked with extreme resistance gene Ra of potato virus A to detect the breeding high-generation line in the laboratory, and finds that the coincidence rate is as high as 65.5 percent, which indicates that the marker can be applied to auxiliary selection in potato antiviral breeding.
Drawings
FIG. 1BC1Population F pedigree.
FIG. 2 is a map of the differences between the pools of influenza, Indel, on the chromosome;
the abscissa represents the physical position, and the ordinate represents the number of indels within 1 Mb.
FIG. 3 is a genetic linkage map;
wherein, the left side number represents the genetic distance, the right side is the mark, the red font is the disease-resistant gene, and the green font is the mark closest to the genetic distance of the disease-resistant gene.
FIG. 4 is a partial result after electrophoresis of a 9% native polyacrylamide gel;
wherein, the lane 3 and the lane 26 are both Marker, and the size is 1353bp, 1078bp, 872bp, 603bp, 310 bp, 281bp, 271bp, 234bp, 194bp, 118bp and 72bp in sequence; lane 48 is parental F58050, lane 49 is parental barbarbarba, lane 50 is BF 145.
Detailed description of the preferred embodiment
The methods and devices used in the following examples of the present invention are conventional methods and devices unless otherwise specified; the equipment and the reagent are all conventional equipment and reagents purchased by a reagent company. In order to make the objects, technical solutions and advantages of the present invention more apparent, the following detailed description of the embodiments of the present invention is provided in connection with the specific embodiments. Examples of these preferred embodiments are illustrated in the specific examples. It should be noted that, in order to avoid obscuring the technical solutions of the present invention with unnecessary details, only the technical solutions and/or processing steps closely related to the technical solutions of the present invention are shown in the embodiments, and other details that are not relevant are omitted.
Example 1
The present example provides the full-length sequence of Indel molecular markers linked with the extreme resistance gene Ra of potato virus a, as follows:
an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC, respectively;
a downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided.
Example 2
The present example provides a method for screening Indel molecular markers linked with the extreme resistance gene Ra of potato virus a, which comprises the following steps:
(1) constructing backcross population: as shown in fig. 1, both parents barbarbara and F58050 are breeding materials kept in this laboratory. The BF145 filial generation of Barbara x F58050 shows disease resistance to PVA, and is backcrossed with BF145 and F58050 to construct a backcross population BC1F, 288 progeny in total. All progeny were inoculated with PVA and ELISA assays determined the PVA contribution of each progenyThe specific method for resistance refers to neymphyr, 2010.
(2)BC1Extraction of individual DNA from F population was performed by CTAB method (Dellaporta et al, 1983).
(3) By crossing backcross populations BC1All F progeny were subjected to PVA resistance identification, 30 resistant individuals were selected from 288 individuals, and DNAs of the 60 individuals were collected. After equal mass mixing, 2 mixing pools, namely an R pool and an S pool, are constructed. And (3) sending the constructed R pool and S pool to a Nordhea provenance company for whole genome sequencing by using an Illumina sequencer, constructing a 350bp library for each pool, wherein the reading length is 150bp, the sequencing depth is 50 x (the library construction type is an animal and plant whole genome small fragment library (350bp), and the sequencing strategy is Hiseq-PE 150).
(4) The sequencing data were analyzed to obtain the differences Indel between the anti-sense pools, as shown in fig. 2. The specific analysis steps are as follows: comparing sequencing data of an anti-sense mixing pool with a reference genome by using an MEM (minimum essential medium) algorithm of BWA (version0.7015-r1140) to obtain an alignment result in an SAM (sample access architecture) format; converting the SAM format file into a BAM format by using samtools software (version 1.3.1); thirdly, sorting reads in the BAM file by using SortSam in a Picard tool (version1.91), and enabling the obtained BAM file to be used for counting Indel differences among the anti-sense mixing pools.
(5) Polymorphic Indel marker screening: PGSC _ DM _ v4.03 genome sequence is downloaded from http:// potato. plant biology. msu.edu/PGSC _ download. shtml, DNA sequence of Indel site on No. 4 chromosome is searched, 150bp sequence before and after the site is selected, and primer is designed according to default parameters on NCBI (https:// www.ncbi.nlm.nih.gov/tools/primer/index. cgilink _ LOC ═ BlastHome). A total of 120 primers were designed and polymorphism screening was performed between the parents BF145 and F58050, yielding a total of 20 primers with polymorphisms.
(6) Using the polymorphic primers between parents BF145 and F58050 obtained by screening to pair BC1All individuals in the F population were PCR amplified. The PCR reaction system is 20 μ l, which is as follows: 1. mu.l of DNA template (50 ng/. mu.l), 0.5. mu.l of each of the upstream and downstream primers (10. mu.M), 10. mu.l of Utaq PCR Mix (2X), ddH2O8 μ l. The reaction program adopts touch downPCR procedure: pre-denaturation at 95 ℃ for 3min, then 12-cycle sequentially carrying out denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23-cycle sequentially carrying out denaturation at 95 ℃ for 30s, Ta-6 ℃ for 1min, extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out. The gel was electrophoresed with 9% native polyacrylamide gel and developed with silver stain. The results are recorded. The results were recorded in the manner that "1" was recorded with the occurrence of a differential band and "0" was recorded with the occurrence of a non-differential band. A total of 20 differential bands were obtained.
(7) According to BC1Phenotype data for F, progeny were 1/0 transformed for phenotypic resistance (1 ═ R, 0 ═ S). The linkage relationship between the marker and the phenotype was analyzed using 4-ploid genetic analysis software tetraploid map, and as a result, as shown in fig. 3, the marker M10-8 was closely linked to the extreme resistance gene Ra, and the genetic distance was only 0.4 cM.
(8) The primer sequence labeled M10-8 is as follows: F-ATCGGGCTTAACAGACCGC, R-GACTGACCTGCTCTTTTTGGC; the product size was 197 bp.
Example 3
The embodiment provides an application of Indel molecular markers linked with an extreme resistance gene Ra of a potato virus A, which comprises the following specific steps:
(1) 58 high generation materials from the laboratory were inoculated with PVA and ELISA tested for resistance to PVA.
(2) 58 parts of material DNA is extracted by a CTAB method.
(3) The method is characterized in that 58 parts of high-generation materials are detected by using a marker M10-8, and the method comprises the following specific steps: the PCR amplification reaction system is that 1 ul of DNA template (50 ng/. mu.l), 0.5 ul of upstream and downstream primers (10 mu.M) respectively, 10 ul of Utaq PCR Mix (2X), ddH2O8 μ l; secondly, adopting a Touchdown PCR program as a reaction program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out; and thirdly, detecting by using 3 percent agarose gel.
(4) As a result, it was found that 34 parts of the 58 parts of the high-generation material exhibited extreme resistance to PVA, and 26 parts of the material exhibited extreme feeling to PVA. As shown in FIG. 4, the detection of 58 high-generation materials by using the marker M10-8 shows that the coincidence rate of the phenotype identification result of 58 materials and the detection result of the marker reaches 65.5%. The correlation analysis is carried out on the phenotype identification result and the marker detection result, and the correlation coefficient is 0.278*Significantly correlated at the 0.05 level. The above results indicate that the marker is closely related to the resistance of potato to PVA, and the marker can be used to better distinguish the resistance of high-generation potato lines to PVA.
The foregoing is directed to embodiments of the present application and it is noted that numerous modifications and adaptations may be made by those skilled in the art without departing from the principles of the present application and are intended to be within the scope of the present application.
References and cited experimental methods:
[1] the research on the new mutant strain of the Nie-Bi-Hua-potato virus Y and the research on the potato-virus interaction mechanism, doctor research student of university of agriculture in Huazhong, 2018.
[2] Molecular marker-assisted screening of multi-resistance parents of Baileyi, Guo Hua Chun and potatoes, molecular plant breeding, 2017, 15:200-212.
[3] Neibawa, Xie Yue Hua, Neei Huzhou, progress on the antiviral mechanism research of potato, Horticulture journal 2012, 39:1703-1714.
[4] Wangxiang, Jinliping, Yi Jiang, progress of the research on the breeding of potato virus resistance, China potato, 2005, 19:285-289.
[5] Xujianfei, Jinliping, potato genetic breeding research, current situation and prospect, Chinese agricultural science, 2017, 50: 990-.
[6] The application of Lijia, Li Ming, Wang Fang, Ye Guang, Zhou Yun, Wang warship, RYSC3 and Rxsp molecular markers in potato disease-resistant breeding, molecular plant breeding, 2017, 15: 4040-.
[7]Palukaitis P.Resistance to viruses of potato and their vectors.Plant Pathol J，2012，28:248-258.
[8]Valkonen JPT et al.Resistance to Potato virus Y in Potato.In:Lacomme C，Glais L，Bellstedt D，Dupuis B，Karasev A，Jacquot E.(eds)Potato virus Y:biodiversity，pathogenicity，epidemiology and management.Springer，Cham，2017.
[9]Ronde DD，Butterbach P，and elink R.Dominant resistance against plant viruses.Frontiers in Plant Science，2014，5:307-323.
[10]Valkonen JPT.Novel resistances to four potyviruses in tuber-bearing potato species，and temperature-sensitive expression of hypersensitive resistance to potato virus Y.Annals of Applied Biology，1997，130:91-104.
[11]
Figure BDA0002927839820000071
JH，Sorri VA，Watanabe KN，Gebhardt C，Valkonen JPT.Molecular examination of a chromosome region that controls resistance to potato Y and A potyviruses in potato.Theor Appl Genet，1998，96:1036-1043
[12]Dellaporta，S.L.，Jonathan，W.，and Hicks，J.B.(1983).A Plant DNAminipreparation:version II.Plant Mol.Biol.Rep.1983.1:19–21.
<110> university of agriculture in Huazhong
<120> Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application
<160> 2
<210> 1
<211> 19
<212> DNA
<213> Potato (Solanum tuberosum L.)
<400> 1
ATCGGGCTTAACAGACCGC
<210> 2
<211> 21
<212> DNA
<213> Potato (Solanum tuberosum L.)
<400> 2
GACTGACCTGCTCTTTTTGGC

Claims (1)

1. The application of the potato A virus extreme resistance gene Ra linked Indel molecular marker is characterized in that the application of the potato A virus extreme resistance gene Ra linked Indel molecular marker is the application of differentiating the resistance of a high-generation potato system to A virus; the molecular marker is obtained by cloning the following primers: an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC, downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided.
CN202110138307.8A 2021-02-01 2021-02-01 Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof Active CN112831586B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110138307.8A CN112831586B (en) 2021-02-01 2021-02-01 Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110138307.8A CN112831586B (en) 2021-02-01 2021-02-01 Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof

Publications (2)

Publication Number Publication Date
CN112831586A CN112831586A (en) 2021-05-25
CN112831586B true CN112831586B (en) 2022-05-03

Family

ID=75931281

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110138307.8A Active CN112831586B (en) 2021-02-01 2021-02-01 Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof

Country Status (1)

Country Link
CN (1) CN112831586B (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101294161B (en) * 2008-04-22 2011-05-04 中国水稻研究所 Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof
CN110628941B (en) * 2019-11-13 2021-04-02 山东农业大学 Linkage molecular marker of maize rough dwarf disease resistant main effect QTL and application
CN111944920B (en) * 2020-08-25 2022-08-02 中国农业科学院郑州果树研究所 InDel marker closely linked with melon epidemic disease resistance gene and application thereof

Also Published As

Publication number Publication date
CN112831586A (en) 2021-05-25

Similar Documents

Publication Publication Date Title
Das et al. Insight into MAS: a molecular tool for development of stress resistant and quality of rice through gene stacking
Chen et al. Identification of the novel bacterial blight resistance gene Xa46 (t) by mapping and expression analysis of the rice mutant H120
Acevedo‐Garcia et al. mlo‐based powdery mildew resistance in hexaploid bread wheat generated by a non‐transgenic TILLING approach
Zhang et al. The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS-LRR protein conferring resistance to Phytophthora infestans
Hayashi et al. Identification of the blast resistance gene Pit in rice cultivars using functional markers
Busungu et al. Identification and linkage analysis of a new rice bacterial blight resistance gene from XM14, a mutant line from IR24
Miah et al. Recurrent parent genome recovery analysis in a marker-assisted backcrossing program of rice (Oryza sativa L.)
Zhang et al. Fine mapping of the Ph-3 gene conferring resistance to late blight (Phytophthora infestans) in tomato
Hart et al. A series of eIF4E alleles at the Bc-3 locus are associated with recessive resistance to Clover yellow vein virus in common bean
Galli et al. High-resolution genetic map of the Rvi15 (Vr2) apple scab resistance locus
Ahmadvand et al. Development of molecular tools for distinguishing between the highly similar Rx1 and Rx2 PVX extreme resistance genes in tetraploid potato
Devran et al. Development of molecular markers tightly linked to Pvr4 gene in pepper using next-generation sequencing
Djedatin et al. Identification of novel major and minor QTLs associated with Xanthomonas oryzae pv. oryzae (African strains) resistance in rice (Oryza sativa L.)
Park et al. Development of the gene-based SCARs for the Ph-3 locus, which confers late blight resistance in tomato
Bhardwaj et al. Efficiency and reliability of marker assisted selection for resistance to major biotic stresses in potato
Mihovilovich et al. An RGA-derived SCAR marker linked to PLRV resistance from Solanum tuberosum ssp. andigena
Korinsak et al. Changing allele frequencies associated with specific resistance genes to leaf blast in backcross introgression lines of Khao Dawk Mali 105 developed from a conventional selection program
CN107201395B (en) Molecular marker of major gene Bph30 for resisting brown planthopper of rice and application thereof
CN108103239B (en) SNP molecular marker A045736268C/T for identifying Chinese cabbage turnip mosaic virus disease resistance and application thereof
Zhao et al. Mapping and characterization of a novel adult-plant leaf rust resistance gene LrYang16G216 via bulked segregant analysis and conventional linkage method
Liu et al. Introgression of sharp eyespot resistance from Dasypyrum villosum chromosome 2VL into bread wheat
CN110628935B (en) Molecular marking method and application of salt-tolerant gene LOC _ Os02g49700 of rice in adult stage
Verzaux et al. High resolution mapping of a novel late blight resistance gene Rpi-avl1, from the wild Bolivian species Solanum avilesii
CN112831586B (en) Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof
Ramkumar et al. Identification and validation of novel alleles of rice blast resistant gene Pi54, and analysis of their nucleotide diversity in landraces and wild Oryza species

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant