CN112831586A - Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof - Google Patents
Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof Download PDFInfo
- Publication number
- CN112831586A CN112831586A CN202110138307.8A CN202110138307A CN112831586A CN 112831586 A CN112831586 A CN 112831586A CN 202110138307 A CN202110138307 A CN 202110138307A CN 112831586 A CN112831586 A CN 112831586A
- Authority
- CN
- China
- Prior art keywords
- potato
- marker
- pva
- indel
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A and application thereof. The A virus extreme resistance gene Ra linked Indel molecular marker comprises: an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC and the downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided. The invention takes potato common cultivar Barbara as a parent to be hybridized with F58050 to construct a backcross population. And (3) utilizing an NGS-BSA technology and combining molecular marker development to obtain an Indel marker linked with the extreme resistance gene Ra of the potato A virus. The invention utilizes Indel marker linked with extreme resistance gene Ra of potato virus A to detect the breeding high-generation line in the laboratory, and finds that the coincidence rate is as high as 65.5 percent, which indicates that the marker can be applied to auxiliary selection in potato antiviral breeding.
Description
Technical Field
The invention relates to the field of plant genetic engineering, in particular to an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A and application thereof. The Indel marker linked to the potato extreme resistance gene Ra is located on chromosome 4 of potato and is designated as M10-8.
Background
Potatoes (Solanum tuberosum L.) are used as the fourth major food crop in the world and are also important agricultural economic crops in China. With the promotion of the main grain deployment of potatoes in China, the potatoes which are used as both food and vegetables are more and more valued. However, in the past 20 years, potato virus disease and potato virus-induced seed potato degeneration have become one of the important problems affecting potato production. As many as 40 or more viruses and viroids can infect potatoes under field conditions, wherein six viruses such as Potato Virus Y (PVY), Potato Leaf Roll Virus (PLRV), Potato Virus A (PVA), Potato Virus X (PVX), Potato Virus M (PVM), Potato Virus S (PVS) and the like and one potato spindle tuber viroid (PSTVd) are the most harmful in China. These viruses not only cause physiological metabolic disorders and reduced viability of plants, but also cause various degrees of yield and quality reduction. The yield reduction caused by PVY and PLRV can reach more than 40% (Neibahua, et al, 2012; Palukaitis, 2012), and although the PVA has a slight infection symptom and a small influence, the PVA also causes more serious yield reduction when being infected with other viruses in a compound way.
PVA and PVY viruses infect potato plants at the cellular level, so that chemical agents are difficult to control, and the cultivation of disease-resistant varieties is the most effective, economic and environment-friendly virus control strategy. There are two main types of known potato host resistance, Extreme Resistance (ER) and Hypersensitive Resistance (HR), respectively. Extreme resistance refers to the absence of any symptoms resulting from the virus infecting the potato, whereas allergic resistance refers to the occurrence of necrotic symptoms resulting from the virus infecting the potato. However, during the course of continued infection with the virus, allergic resistance is overcome by the virus, but extreme resistance is not. The extreme resistance genes controlling PVA and PVY were previously reported as Ra and Ry, respectively. There are many reports on Ry, and three main sources of 4 Extreme Resistance (ER) genes have been reported, including sourcesRy in solanum. chacoensechcRy from S.tuberosum Group andigenadgAnd Ry derived from sstoAnd Ry-fstoThey map to potato chromosomes 9, 11 and 12, respectively (Valkonen et al, 2017). In addition, there are several Ny genes that mediate PVY allergic Resistance (HR) located (Valkonen et al, 2017). Meanwhile, related molecular markers are also developed for main resistance genes, such as molecular markers RY186, RYSC3 and YES3-3A and Ry respectivelychc、RyadgAnd RystoLinked and successfully applied in the breeding process of potatoes to help improve the selection efficiency (Ramakrishnan et al, 2015; Baileyi and Guohuachun, 2017; Lijia et al, 2017; Xujiafei and Jinliping, 2017).
However, the research on the resistance of PVA viruses belonging to the same genus of Y virus is relatively rare. Valkenon (1997) performed resistance identification of 4 potyviruses (TEV, PVY, PVA, PVV) in partially potato bearing wild species and cultivars, and the results showed that wild species S.stoloniferum, S.sucrense and cultivars King Edward, Pentland Dell produced symptoms of allergic necrosis on the inoculated leaves and apical leaves, respectively, after inoculation with PVA virus, and that the wild species S.ployadenum was asymptomatic after rubbing and grafting with PVA, and was not detectable for the presence of virus and could contain the Ra gene controlling extreme resistance (Valkenon, 1997). Studies showed that potato 2x (v-2)7 from s.tuberosum subsp.andigen was asymptomatic after rubbing inoculation with PVA and no virus was detected by ELISA. After grafting inoculation, the top leaf is necrotic, but low content of PVA is detected only in the part with necrosis symptoms, the asymptomatic part does not contain PVA virus, and the material also has an extreme resistance gene Ry to the PVY virusadg. The genetic analysis according to the linkage map of potato and tomato shows that RaadgLocated on chromosome 11 by the distance RyadgOnly 6.8cM (et al.,1998)。This is the first time that the extreme resistance gene of PVA is mapped in potato, however, the molecular marker studies related to the extreme resistance gene associated with potaavirus on the remaining chromosomes have not been reported.
The problems existing in the prior art are as follows: at present, Indel molecular markers linked with the extreme resistance gene Ra of the potato virus A are not reported; at present, no ideal marker capable of being used for molecular marker-assisted selection of the extreme resistance gene Ra of the potato virus A has been developed. Although the ELISA detection technology is accurate, the resistance needs to be identified after the material is inoculated, the breeding period is increased, and a large amount of manpower, material resources and financial resources are consumed.
Disclosure of Invention
The key technical problem to be solved by the invention is to provide an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A and application thereof.
In order to solve the technical problems, the invention adopts the following technical scheme:
1. the full-length sequence of the Indel molecular marker linked with the extreme resistance gene Ra of the potato A virus is as follows:
an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC, respectively;
a downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided.
2. The screening method of the potato A virus extreme resistance gene Ra linked Indel molecular marker comprises the following steps:
(1) constructing backcross population: the parents Barbara and F58050 are breeding materials preserved in the laboratory. The BF145 filial generation of Barbara x F58050 shows disease resistance to PVA, and is backcrossed with BF145 and F58050 to construct a backcross population BC1F, 288 progeny in total. And (3) performing PVA inoculation on all the offspring, and determining the resistance of each offspring to PVA by ELISA detection, wherein the specific method refers to Nie-Bi-Hua, 2010.
(2)BC1Extraction of individual DNA from F population was performed by CTAB method (Dellaporta et al, 1983).
(3) As a result of identifying PVA resistance of all the progeny of the backcross population BC1F, 30 resistant individuals were selected from 288 individuals, and DNAs of the 60 individuals were collected. After equal mass mixing, 2 mixing pools, namely an R pool and an S pool, are constructed. And (3) sending the constructed R pool and S pool to a Nordhea provenance company for whole genome sequencing by using an Illumina sequencer, constructing a 350bp library for each pool, wherein the reading length is 150bp, the sequencing depth is 50 x (the library construction type is an animal and plant whole genome small fragment library (350bp), and the sequencing strategy is Hiseq-PE 150).
(4) The sequencing data were analyzed to obtain the differences Indel between the anti-sense pools, as shown in fig. 1. The specific analysis steps are as follows: comparing sequencing data of an anti-sense mixing pool with a reference genome by using an MEM (minimum essential medium) algorithm of BWA (version0.7015-r1140) to obtain an alignment result in an SAM (sample access architecture) format; converting the SAM format file into a BAM format by using samtools software (version 1.3.1); thirdly, sorting reads in the BAM file by using SortSam in a Picard tool (version1.91), and enabling the obtained BAM file to be used for counting Indel differences among the anti-sense mixing pools.
(5) Polymorphic Indel marker screening: PGSC _ DM _ v4.03 genome sequence is downloaded from http:// potato. plant biology. msu.edu/PGSC _ download. shtml, DNA sequence of Indel site on No. 4 chromosome is searched, 150bp sequence before and after the site is selected, and primer is designed according to default parameters on NCBI (https:// www.ncbi.nlm.nih.gov/tools/primer/index. cgilink _ LOC ═ BlastHome). A total of 120 primers were designed and polymorphism screening was performed between the parents BF145 and F58050, yielding a total of 20 primers with polymorphisms.
(6) All individuals in the BC1F population were PCR amplified using the polymorphic primers between the parents BF145 and F58050 obtained by the screening. The PCR reaction system is 20 μ l, which is as follows: 1. mu.l of DNA template (50 ng/. mu.l), 0.5. mu.l of each of upstream and downstream primers (10. mu.M), 10. mu.l of Utaq PCR Mix (2X), ddH2O8. mu.l. The reaction program adopts a Touchdown PCR program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out. The gel was electrophoresed with 9% native polyacrylamide gel and developed with silver stain. The results are recorded. Means of recording results, differential bandsOccurrences are recorded as "1" and non-differential bands as "0". A total of 20 differential bands were obtained.
(7) According to BC1Phenotype data for F, progeny were 1/0 transformed for phenotypic resistance (1 ═ R, 0 ═ S). The linkage relationship between the marker and the phenotype was analyzed using 4-ploid genetic analysis software tetraploid map, and it was found that Ra was closely linked to marker M10-8, and the genetic distance was only 0.4 cM.
(8) The primer sequence labeled M10-8 is as follows: F-ATCGGGCTTAACAGACCGC, R-GACTGACCTGCTCTTTTTGGC; the product size was 197 bp.
3. The application of the potato A virus extreme resistance gene Ra linked Indel molecular marker comprises:
(1) 58 high generation materials from the laboratory were inoculated with PVA and ELISA tested for resistance to PVA.
(2) 58 parts of material DNA is extracted by a CTAB method.
(3) The method is characterized in that 58 parts of high-generation materials are detected by using a marker M10-8, and the method comprises the following specific steps: 1 ul of DNA template (50 ng/. mu.l), 0.5 ul of upstream and downstream primers (10 uM) respectively, 10 ul of Utaq PCR Mix (2X), and 8 ul of ddH2O 8 for PCR amplification reaction system; secondly, adopting a Touchdown PCR program as a reaction program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out; and thirdly, detecting by using 3 percent agarose gel.
(4) As a result, it was found that 34 parts of the 58 high-generation materials exhibited extreme resistance to PVA, and 26 parts exhibited extreme feeling to PVA. The detection of 58 parts of high-generation materials by using the marker M10-8 shows that the coincidence rate of the phenotype identification result of 58 parts of materials and the detection result of the marker reaches 65.5 percent. Correlation analysis was performed between the phenotypic identification and the marker detection with a correlation coefficient of 0.278 and significant correlation at the 0.05 level. The above results indicate that the marker is closely related to the resistance of potato to PVA, and the marker can be used to better distinguish the resistance of high-generation potato lines to PVA.
Has the advantages that:
(1) the invention takes potato common cultivar Barbara as a parent to be hybridized with F58050 to construct a backcross population. The Indel marker linked with the extreme resistance gene Ra of the potato virus A is obtained by utilizing the NGS-BSA technology and combining the development of molecular markers, and a foundation is laid for the cloning of the resistance gene Ra.
(2) The invention utilizes Indel marker linked with extreme resistance gene Ra of potato virus A to detect the breeding high-generation line in the laboratory, and finds that the coincidence rate is as high as 65.5 percent, which indicates that the marker can be applied to auxiliary selection in potato antiviral breeding.
Drawings
FIG. 1BC1Population F pedigree.
FIG. 2 is a map of the differences between the influenza pools, Indel, on chromosomes;
the abscissa represents the physical position, and the ordinate represents the number of indels within 1 Mb.
FIG. 3 is a genetic linkage map;
wherein, the left side number represents the genetic distance, the right side is the mark, the red font is the disease-resistant gene, and the green font is the mark closest to the genetic distance of the disease-resistant gene.
FIG. 4 is a partial result after electrophoresis of a 9% native polyacrylamide gel;
wherein, the lane 3 and the lane 26 are both Marker, and the size is 1353bp, 1078bp, 872bp, 603bp, 310 bp, 281bp, 271bp, 234bp, 194bp, 118bp and 72bp in sequence; lane 48 is parental F58050, lane 49 is parental barbarbarba, lane 50 is BF 145.
Detailed description of the invention
The methods and devices used in the following examples of the present invention are conventional methods and devices unless otherwise specified; the equipment and the reagent are all conventional equipment and reagents purchased by a reagent company. In order to make the objects, technical solutions and advantages of the present invention more apparent, the following detailed description of the embodiments of the present invention is provided in connection with the specific embodiments. Examples of these preferred embodiments are illustrated in the specific examples. It should be noted that, in order to avoid obscuring the technical solutions of the present invention with unnecessary details, only the technical solutions and/or processing steps closely related to the technical solutions of the present invention are shown in the embodiments, and other details that are not relevant are omitted.
Example 1
The present example provides the full-length sequence of Indel molecular markers linked with the extreme resistance gene Ra of potato virus a, as follows:
an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC, respectively;
a downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided.
Example 2
The present example provides a method for screening Indel molecular markers linked with the extreme resistance gene Ra of potato virus a, which comprises the following steps:
(1) constructing backcross population: as shown in fig. 1, the parents Barbara and F58050 are breeding materials preserved in this laboratory. The BF145 filial generation of Barbara x F58050 shows disease resistance to PVA, and is backcrossed with BF145 and F58050 to construct a backcross population BC1F, 288 progeny in total. And (3) performing PVA inoculation on all the offspring, and determining the resistance of each offspring to PVA by ELISA detection, wherein the specific method refers to Nie-Bi-Hua, 2010.
(2)BC1Extraction of individual DNA from F population was performed by CTAB method (Dellaporta et al, 1983).
(3) By crossing backcross populations BC1All F progeny were subjected to PVA resistance identification, 30 resistant individuals were selected from 288 individuals, and DNAs of the 60 individuals were collected. After equal mass mixing, 2 mixing pools, namely an R pool and an S pool, are constructed. And (3) sending the constructed R pool and S pool to a Nordhea provenance company for whole genome sequencing by using an Illumina sequencer, constructing a 350bp library for each pool, wherein the reading length is 150bp, the sequencing depth is 50 x (the library construction type is a small fragment library (350bp) of the whole genome of the animal and plant, and the sequencing strategy is Hiseq-PE 150).
(4) The sequencing data were analyzed to obtain the differences Indel between the anti-sense pools, as shown in fig. 2. The specific analysis steps are as follows: comparing sequencing data of an anti-sense mixing pool with a reference genome by using an MEM (minimum essential medium) algorithm of BWA (version0.7015-r1140) to obtain an alignment result in an SAM (sample access architecture) format; converting the SAM format file into a BAM format by using samtools software (version 1.3.1); thirdly, sorting reads in the BAM file by using SortSam in a Picard tool (version1.91), and enabling the obtained BAM file to be used for counting Indel differences among the anti-sense mixing pools.
(5) Polymorphic Indel marker screening: PGSC _ DM _ v4.03 genome sequence is downloaded from http:// potato. plant biology. msu.edu/PGSC _ download. shtml, DNA sequence of Indel site on No. 4 chromosome is searched, 150bp sequence before and after the site is selected, and primer is designed according to default parameters on NCBI (https:// www.ncbi.nlm.nih.gov/tools/primer/index. cgilink _ LOC ═ BlastHome). A total of 120 primers were designed and polymorphism screening was performed between the parents BF145 and F58050, yielding a total of 20 primers with polymorphisms.
(6) Using the polymorphic primers between parents BF145 and F58050 obtained by screening to pair BC1All individuals in the F population were PCR amplified. The PCR reaction system is 20 μ l, which is as follows: 1. mu.l of DNA template (50 ng/. mu.l), 0.5. mu.l of each of the upstream and downstream primers (10. mu.M), 10. mu.l of Utaq PCR Mix (2X), ddH2O8 μ l. The reaction program adopts a Touchdown PCR program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out. The gel was electrophoresed with 9% native polyacrylamide gel and developed with silver stain. The results are recorded. The results were recorded in the manner that "1" was recorded with the occurrence of a differential band and "0" was recorded with the occurrence of a non-differential band. A total of 20 differential bands were obtained.
(7) According to BC1Phenotype data for F, progeny were 1/0 transformed for phenotypic resistance (1 ═ R, 0 ═ S). The linkage relationship between the marker and the phenotype was analyzed using 4-ploid genetic analysis software tetraploid map, and as a result, as shown in fig. 3, the marker M10-8 was closely linked to the extreme resistance gene Ra, and the genetic distance was only 0.4 cM.
(8) The primer sequence labeled M10-8 is as follows: F-ATCGGGCTTAACAGACCGC, R-GACTGACCTGCTCTTTTTGGC; the product size was 197 bp.
Example 3
The embodiment provides an application of Indel molecular markers linked with an extreme resistance gene Ra of a potato virus A, which comprises the following specific steps:
(1) 58 high generation materials from the laboratory were inoculated with PVA and ELISA tested for resistance to PVA.
(2) 58 parts of material DNA is extracted by a CTAB method.
(3) The method is characterized in that 58 parts of high-generation materials are detected by using a marker M10-8, and the method comprises the following specific steps: the PCR amplification reaction system is that 1 ul of DNA template (50 ng/. mu.l), 0.5 ul of upstream and downstream primers (10 mu.M) respectively, 10 ul of Utaq PCR Mix (2X), ddH2O8 μ l; secondly, adopting a Touchdown PCR program as a reaction program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out; and thirdly, detecting by using 3 percent agarose gel.
(4) As a result, it was found that 34 parts of the 58 high-generation materials exhibited extreme resistance to PVA, and 26 parts exhibited extreme feeling to PVA. As shown in FIG. 4, the detection of 58 high-generation materials by using the marker M10-8 shows that the coincidence rate of the phenotype identification result of 58 materials and the detection result of the marker reaches 65.5%. The correlation analysis is carried out on the phenotype identification result and the marker detection result, and the correlation coefficient is 0.278*Significantly correlated at the 0.05 level. The above results indicate that the marker is closely related to the resistance of potato to PVA, and the marker can be used to better distinguish the resistance of high-generation potato lines to PVA.
The foregoing is directed to embodiments of the present application and it is noted that numerous modifications and adaptations may be made by those skilled in the art without departing from the principles of the present application and are intended to be within the scope of the present application.
References and cited experimental methods:
[1] the research on the new mutant strain of the Nie-Bi-Hua-potato virus Y and the research on the potato-virus interaction mechanism, doctor research student of university of agriculture in Huazhong, 2018.
[2] Molecular marker-assisted screening of multi-resistance parents of Baileyi, Guo Hua Chun and potatoes, molecular plant breeding, 2017, 15:200-212.
[3] Neibawa, Xie Yue Hua, Neei Huzhou, progress on the antiviral mechanism research of potato, Horticulture journal 2012, 39:1703-1714.
[4] Wangxiang, Jinliping, Yi Jiang, progress of the research on the breeding of potato virus resistance, China potato, 2005, 19:285-289.
[5] Xujianfei, Jinliping, potato genetic breeding research, current situation and prospect, Chinese agricultural science, 2017, 50: 990-.
[6] The application of Lijia, Li Ming, Wang Fang, Ye Guang, Zhou Yun, Wang warship, RYSC3 and Rxsp molecular markers in potato disease-resistant breeding, molecular plant breeding, 2017, 15: 4040-.
[7]Palukaitis P.Resistance to viruses of potato and their vectors.Plant Pathol J,2012,28: 248-258.
[8]Valkonen JPT et al.Resistance to Potato virus Y in Potato.In:Lacomme C,Glais L, Bellstedt D,Dupuis B,Karasev A,Jacquot E.(eds)Potato virus Y:biodiversity,pathogenicity, epidemiology and management.Springer,Cham,2017.
[9]Ronde DD,Butterbach P,and elink R.Dominant resistance against plant viruses.Frontiers in Plant Science,2014,5:307-323.
[10]Valkonen JPT.Novel resistances to four potyviruses in tuber-bearing potato species,and temperature-sensitive expression of hypersensitive resistance to potato virus Y.Annals of Applied Biology,1997,130:91-104.
[11]JH,Sorri VA,Watanabe KN,Gebhardt C,Valkonen JPT.Molecular examination of a chromosome region that controls resistance to potato Y and A potyviruses in potato.Theor Appl Genet,1998,96:1036-1043
[12]Dellaporta,S.L.,Jonathan,W.,and Hicks,J.B.(1983).A Plant DNAminipreparation: version II.Plant Mol.Biol.Rep.1983.1:19–21。
<110> university of agriculture in Huazhong
<120> Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application
<160> 2
<210> 1
<211> 19
<212> DNA
<213> Potato (Solanum tuberosum L.)
<400> 1
ATCGGGCTTAACAGACCGC
<210> 2
<211> 21
<212> DNA
<213> Potato (Solanum tuberosum L.)
<400> 2
GACTGACCTGCTCTTTTTGGC
Claims (4)
1. An Indel molecular marker linked with an extreme resistance gene Ra of potato virus A, which is characterized in that the molecular marker comprises: an upstream primer: M10-8-F: ATCGGGCTTAACAGACCGC, downstream primer: M10-8-R: GACTGACCTGCTCTTTTTGGC are provided.
2. A screening method of an Indel molecular marker linked with an extreme resistance gene Ra of a potato virus A, which is characterized by comprising the following steps:
(1) constructing backcross population: the parents Barbara and F58050 are breeding materials preserved in the laboratory; the BF145 filial generation of Barbara x F58050 shows disease resistance to PVA, and is backcrossed with BF145 and F58050 to construct a backcross population BC1F comprises 288 total progeny, all progeny were inoculated with PVA and the ELISA test determined the resistance of each progeny to PVA;
(2)BC1extracting DNA of a single plant of the F group by adopting a CTAB method;
(3) by crossing backcross populations BC1F all progeny were subjected to the identification of PVA resistance inSelecting 30 resistant plants from 288 single plants, collecting DNA of the 60 single plants, mixing the DNA with equal mass, and constructing 2 mixing pools which are respectively an R pool and an S pool; sending the constructed R pool and S pool to a Nordhea provenance company for whole genome sequencing by using an Illumina sequencer, constructing a 350bp library for each pool, wherein the reading length is 150bp, the sequencing depth is 50 x (the library construction type is an animal and plant whole genome small fragment library (350bp), and the sequencing strategy is Hiseq-PE 150);
(4) analyzing the sequencing data to obtain the difference Indel between the anti-influenza mixed pools, wherein the specific analysis steps are as follows: comparing sequencing data of an anti-sense mixing pool with a reference genome by using an MEM (minimum essential medium) algorithm of BWA (version0.7015-r1140) to obtain an alignment result in an SAM (sample access architecture) format; converting the SAM format file into a BAM format by using samtools software (version 1.3.1); thirdly, sorting reads in the BAM file by using SortSam in a Picard tool (version1.91), wherein the obtained BAM file can be used for counting Indel differences among the anti-sense mixing pools;
(5) polymorphic Indel marker screening: downloading PGSC _ DM _ v4.03 genome sequence from http:// potato. plant biology. msu.edu/PGSC _ download. shtml, searching DNA sequence of Indel site on No. 4 chromosome, selecting 150bp sequence before and after the site, designing primers on NCBI (https:// www.ncbi.nlm.nih.gov/tools/primer/index. cgilink _ LOC ═ BlastHome) according to default parameters, designing 120 pairs of primers in total, carrying out polymorphism screening between parents BF145 and F58050, and obtaining 20 pairs of primers with polymorphism in total;
(6) using the polymorphic primers between parents BF145 and F58050 obtained by screening to pair BC1All individuals in the F group are subjected to PCR amplification, and the PCR reaction system is 20 mu l, and the details are as follows: DNA template (50 ng/. mu.l) 1. mu.l, upstream and downstream primers (10. mu.M) 0.5. mu.l each, Utaq PCR Mix (2X) 10. mu.l, ddH2O 8. mu.l, reaction program Touchdown PCR program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C, performing electrophoresis on 9% native polyacrylamide gel, and silver staining;
(7) According to BC1F, 1/0 transformation of the phenotype resistance of the offspring (1 ═ R, 0 ═ S), and the linkage relationship between the marker and the phenotype is analyzed by using 4-ploid genetic analysis software tetraploid map, and Ra is found to be closely linked with the marker M10-8, and the genetic distance is only 0.4 cM;
(8) the primer sequence labeled M10-8 is as follows: F-ATCGGGCTTAACAGACCGC, R-GACTGACCTGCTCTTTTTGGC; the product size was 197 bp.
3. The application of the potato A virus extreme resistance gene Ra linked Indel molecular marker comprises:
(1) carrying out PVA inoculation on 58 parts of high-generation materials in a laboratory, and detecting the resistance of the materials to PVA by ELISA;
(2) extracting 58 parts of material DNA by adopting a CTAB method;
(3) the method is characterized in that 58 parts of high-generation materials are detected by using a marker M10-8, and the method comprises the following specific steps: 1 ul of DNA template (50 ng/. mu.l), 0.5 ul of upstream and downstream primers (10 uM) respectively, 10 ul of Utaq PCR Mix (2X), and 8 ul of ddH2O 8 for PCR amplification reaction system; secondly, adopting a Touchdown PCR program as a reaction program: pre-denaturation at 95 ℃ for 3min, then 12 cycles of denaturation at 95 ℃ for 30s, Ta (reduced by 0.5 ℃ per cycle) for 1min, and extension at 72 ℃ for 1min30s, then 23 cycles of denaturation at 95 ℃ for 30s, annealing at Ta-6 ℃ for 1min, and extension at 72 ℃ for 1min30s, and finally extension at 72 ℃ for 5 min; storing at 4 deg.C and taking out; thirdly, detecting by using 3 percent agarose gel;
(4) the results show that 34 parts of 58 high-generation materials have extreme resistance to PVA, and 26 parts of materials have extreme feeling to PVA; the detection of 58 parts of high-generation materials by using the marker M10-8 shows that the coincidence rate of the phenotype identification result of 58 parts of materials and the detection result of the marker reaches 65.5 percent; performing correlation analysis on the phenotype identification result and the marker detection result, wherein the correlation coefficient is 0.278, and the phenotype identification result and the marker detection result are obviously correlated at the level of 0.05; the above results indicate that the marker is closely related to the resistance of potato to PVA, and the marker can be used to better distinguish the resistance of high-generation potato lines to PVA.
4. The use of the Ra-linked Indel molecular marker of the extreme resistance gene of potato A virus as claimed in claim 3, wherein the use of the Ra-linked Indel molecular marker of the extreme resistance gene of potato A virus is used for differentiating the resistance of high-generation potato lines to PVA.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110138307.8A CN112831586B (en) | 2021-02-01 | 2021-02-01 | Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110138307.8A CN112831586B (en) | 2021-02-01 | 2021-02-01 | Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112831586A true CN112831586A (en) | 2021-05-25 |
CN112831586B CN112831586B (en) | 2022-05-03 |
Family
ID=75931281
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110138307.8A Active CN112831586B (en) | 2021-02-01 | 2021-02-01 | Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112831586B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101294161A (en) * | 2008-04-22 | 2008-10-29 | 中国水稻研究所 | Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof |
CN110628941A (en) * | 2019-11-13 | 2019-12-31 | 山东农业大学 | Linkage molecular marker of maize rough dwarf disease resistant main effect QTL and application |
CN111944920A (en) * | 2020-08-25 | 2020-11-17 | 中国农业科学院郑州果树研究所 | InDel marker closely linked with melon epidemic disease resistance gene and application thereof |
-
2021
- 2021-02-01 CN CN202110138307.8A patent/CN112831586B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101294161A (en) * | 2008-04-22 | 2008-10-29 | 中国水稻研究所 | Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof |
CN110628941A (en) * | 2019-11-13 | 2019-12-31 | 山东农业大学 | Linkage molecular marker of maize rough dwarf disease resistant main effect QTL and application |
CN111944920A (en) * | 2020-08-25 | 2020-11-17 | 中国农业科学院郑州果树研究所 | InDel marker closely linked with melon epidemic disease resistance gene and application thereof |
Non-Patent Citations (1)
Title |
---|
ARINAITWE ABEL BYARUGABA ET AL.: "Prevalence of R Genes for Resistance to Potato Viruses in Uganda Germplasm", 《POTATO RESEARCH》 * |
Also Published As
Publication number | Publication date |
---|---|
CN112831586B (en) | 2022-05-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Das et al. | Insight into MAS: a molecular tool for development of stress resistant and quality of rice through gene stacking | |
Chen et al. | Identification of the novel bacterial blight resistance gene Xa46 (t) by mapping and expression analysis of the rice mutant H120 | |
Hayashi et al. | Identification of the blast resistance gene Pit in rice cultivars using functional markers | |
Zhang et al. | The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS-LRR protein conferring resistance to Phytophthora infestans | |
Wanchana et al. | A rapid construction of a physical contig across a 4.5 cM region for rice grain aroma facilitates marker enrichment for positional cloning | |
Tanweer et al. | Introgression of blast resistance genes (putative Pi-b and Pi-kh) into elite rice cultivar MR219 through marker-assisted selection | |
Galli et al. | High-resolution genetic map of the Rvi15 (Vr2) apple scab resistance locus | |
Ahmadvand et al. | Development of molecular tools for distinguishing between the highly similar Rx1 and Rx2 PVX extreme resistance genes in tetraploid potato | |
Djedatin et al. | Identification of novel major and minor QTLs associated with Xanthomonas oryzae pv. oryzae (African strains) resistance in rice (Oryza sativa L.) | |
Devran et al. | Development of molecular markers tightly linked to Pvr4 gene in pepper using next-generation sequencing | |
Lin et al. | Genetic diversity of rice germplasm used in Taiwan breeding programs. | |
Park et al. | Development of the gene-based SCARs for the Ph-3 locus, which confers late blight resistance in tomato | |
Mihovilovich et al. | An RGA-derived SCAR marker linked to PLRV resistance from Solanum tuberosum ssp. andigena | |
Tehseen et al. | QTL mapping of adult plant resistance to stripe rust in a doubled haploid wheat population | |
CN107201395B (en) | Molecular marker of major gene Bph30 for resisting brown planthopper of rice and application thereof | |
Lo et al. | Two genomic regions of a sodium azide induced rice mutant confer broad-spectrum and durable resistance to blast disease | |
CN108103239B (en) | SNP molecular marker A045736268C/T for identifying Chinese cabbage turnip mosaic virus disease resistance and application thereof | |
Korinsak et al. | Changing allele frequencies associated with specific resistance genes to leaf blast in backcross introgression lines of Khao Dawk Mali 105 developed from a conventional selection program | |
CN110628935B (en) | Molecular marking method and application of salt-tolerant gene LOC _ Os02g49700 of rice in adult stage | |
Verzaux et al. | High resolution mapping of a novel late blight resistance gene Rpi-avl1, from the wild Bolivian species Solanum avilesii | |
CN110257546B (en) | New salt-tolerant gene cluster qST12 in rice seedling stage Pokkali And applications | |
CN112831586B (en) | Indel molecular marker linked with extreme resistance gene Ra of potato virus A and application thereof | |
Adillah Tan et al. | GpaXI tar l originating from Solanum tarijense is a major resistance locus to Globodera pallida and is localised on chromosome 11 of potato | |
Truong et al. | Development of a co-dominant SCAR marker linked to the Ph-3 gene for Phytophthora infestans resistance in tomato (Solanum lycopersicum) | |
Sharon et al. | A single NLR gene confers resistance to leaf and stripe rust in wheat |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |