CN112831513A - Fusion gene PAOX-MTG1 and application thereof - Google Patents

Fusion gene PAOX-MTG1 and application thereof Download PDF

Info

Publication number
CN112831513A
CN112831513A CN201911156300.8A CN201911156300A CN112831513A CN 112831513 A CN112831513 A CN 112831513A CN 201911156300 A CN201911156300 A CN 201911156300A CN 112831513 A CN112831513 A CN 112831513A
Authority
CN
China
Prior art keywords
paox
mtg1
fusion gene
chip
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201911156300.8A
Other languages
Chinese (zh)
Inventor
孙颖浩
许传亮
高旭
李晶
任善成
高小峰
王海峰
阳青松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Changhai Hospital
Original Assignee
Shanghai Changhai Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Changhai Hospital filed Critical Shanghai Changhai Hospital
Priority to CN201911156300.8A priority Critical patent/CN112831513A/en
Publication of CN112831513A publication Critical patent/CN112831513A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides an isolated fusion gene PAOX-MTG1 and application thereof. The fusion gene PAOX-MTG1 has the sequence shown in SEQ ID No.1 and its full length or its segment. The detection of the fusion gene PAOX-MTG1 can provide scientific basis for the diagnosis and treatment of the prostate cancer.

Description

Fusion gene PAOX-MTG1 and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a fusion gene PAOX-MTG1 and application thereof.
Background
Malignant tumors are one of the most important diseases that threaten human survival and affect health. Prostate cancer is currently the highest incidence of male malignancy in developed countries, with the second highest ranking among male cancer-related deaths. The occurrence of prostate cancer in our country differs from the world average level, and this difference may be caused by genetic differences between races. Prostate cancer is characterized by a natural history of long-term changes, extensive intratumoral and intratumoral heterogeneity. Each tumor has wide variation in tumor evolution and biological behavior (e.g., tumor dormancy, local growth, distant spread, response to therapy, and recurrence), resulting in a distinct clinical outcome for each patient.
Our understanding of the genomic definition and molecular complexity of prostate cancer has continued to be profound during the past decade due to the advent of next generation sequencing technologies. Many large databases, including the Cancer Genome Atlas, describe the molecular characteristics of the prostate, including single nucleotide variations, copy number variations, gene expression, and DNA methylation variations, and provide valuable resources and theoretical bases for the diagnosis and treatment of prostate Cancer. Comprehensive cancer genomics has become the cornerstone of modern medicine.
Disclosure of Invention
In view of the above-mentioned drawbacks of the prior art, the present invention aims to provide a fusion gene PAOX-MTG1 and its application for solving the problem of lack of effective diagnostic measures for prostate cancer in the prior art.
To achieve the above and other related objects, the first aspect of the present invention provides an isolated fusion gene PAOX-MTG1, the fusion gene PAOX-MTG1 having a full length of the sequence shown in SEQ ID NO.1 or a fragment thereof.
SEQ ID NO.1：
cgtacactagggggtcctacagctacgtggccgtgggcagtactgggggcgacctggacctgctggctcagcccctccctgcagacggcgccggcgcccagctccagatcctgtttgcgggggaagccacacatcgcacgttttactccacgacgcacggggctctgctgtcgggatggagggaggccgaccgcctcctcagtctgtgggccccgcag||ggctgaagaagatgcagagcagcctgaagctggtggactgtatcatcgaggtccacgatgcccggatcccactttcaggccgcaaccctctgtttcaggaaacccttgggcttaagcctcacttgctggtcctcaacaagatggacttggcggatcttacagagcagcagaaaattatgcaacacttagaaggagaaggcctaaaaaatgtcatttttaccaactgtgtaaagg
The fusion gene PAOX-MTG1 is formed by the specific conjunction of two genes, namely PAOX (genbank ID _196743) and MTG1(genbank ID _92170) in the transcription stage.
The fragment comprises any one PCR fragment of the fusion gene, and the any one PCR fragment is a PCR product. Different PCR products can be obtained by adopting different PCR primers.
Further, the fusion gene PAOX-MTG1 is from human prostate tissue.
In a second aspect the present invention provides an isolated polynucleotide capable of being transcribed into the fusion gene PAOX-MTG1 as described in the first aspect.
Further, the polynucleotide is capable of being transcribed by a human cell into the fusion gene PAOX-MTG1 of the first aspect.
Further, the polynucleotide has a structure represented by formula (I):
Seqforward direction-X-SeqReverse directionA compound of the formula (I),
in the formula (I), SeqForward directionA nucleotide sequence capable of expressing said fusion gene PAOX-MTG1 in human cells; seqForward directionAnd SeqReverse directionIs a substantially or fully complementary nucleotide sequence, wherein X is located in SeqForward directionAnd SeqReverse directionA spacer sequence therebetween, and the spacer sequence and SeqForward direction、SeqReverse directionAre not complementary, and the structure shown in the formula (I) forms a secondary structure shown in the formula (II) after being transferred into human cells:
Figure BDA0002284895160000021
seq in formula (II)Forward direction、SeqReverse directionAnd X is as defined above, SeqForward directionTo enable expression in human cellsThe nucleotide sequence of the fusion gene PAOX-MTG 1; seqForward directionAnd SeqReverse directionA substantially or fully complementary nucleotide sequence, wherein X is located in SeqForward directionAnd SeqReverse directionA spacer sequence therebetween, and the spacer sequence and SeqForward direction、SeqReverse directionAre not complementary, | | is expressed in SeqForward directionAnd SeqReverse directionThe base complementary pairing relationship is formed between the two.
In a third aspect the invention provides a polypeptide encoded by the fusion gene of the first aspect PAOX-MTG 1.
In a fourth aspect, the present invention provides a vector comprising the fusion gene of the first aspect PAOX-MTG1 or the polynucleotide of the second aspect.
In a fifth aspect, the invention provides a chip, preparation or kit comprising a detection reagent for the fusion gene PAOX-MTG1 of the first aspect or the polynucleotide of the second aspect.
Further, the detection reagent comprises an amplification primer and/or a probe.
For example, the amplification primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.
The chip and the preparation can be used for diagnosing the prostatic cancer.
The sixth aspect of the invention provides a kit for detecting the fusion gene PAOX-MTG1, which contains the chip or the preparation as described in the fifth aspect.
Further, the kit may be a qPCR detection kit.
The seventh aspect of the present invention provides the use of the chip or the formulation of the fifth aspect in the preparation of a prostate cancer detection kit.
The eighth aspect of the invention provides the use of a detection reagent, amplification primer or oligonucleotide probe directed against the fusion gene PAOX-MTG1 in the preparation of a product for the detection of prostate cancer.
Further, the product may be a chip/formulation or a kit.
As described above, the fusion gene PAOX-MTG1 of the present invention and its use have the following beneficial effects:
we found that the fusion gene PAOX-MTG1 has a close relation with the occurrence and the development of prostate cancer. By detecting the fusion gene PAOX-MTG1 in the prostate tissue section of a patient, scientific basis can be provided for the diagnosis and treatment of the prostate cancer.
Drawings
FIG. 1 shows a gel electrophoresis chart in example 2 of the present invention.
FIG. 2 is a diagram showing the sequencing result of sanger in a recovered sample by gel electrophoresis according to the present invention.
Detailed Description
The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention. It is to be understood that the processing equipment or apparatus not specifically identified in the following examples is conventional in the art. Furthermore, it is to be understood that one or more method steps mentioned in the present invention does not exclude that other method steps may also be present before or after the combined steps or that other method steps may also be inserted between these explicitly mentioned steps, unless otherwise indicated; it is also to be understood that a combined connection between one or more devices/apparatus as referred to in the present application does not exclude that further devices/apparatus may be present before or after the combined device/apparatus or that further devices/apparatus may be interposed between two devices/apparatus explicitly referred to, unless otherwise indicated. Moreover, unless otherwise indicated, the numbering of the various method steps is merely a convenient tool for identifying the various method steps, and is not intended to limit the order in which the method steps are arranged or the scope of the invention in which the invention may be practiced, and changes or modifications in the relative relationship may be made without substantially changing the technical content.
Aiming at the defects that the number of the current fusion genes is limited and the prostate cancer is difficult to accurately predict through detection, the application discovers a novel fusion gene PAOX-MTG1 from a large number of prostate cancer patients through intensive research. The detection of the fusion gene PAOX-MTG1 in the prostate tissue of a patient provides a basis for early diagnosis of prostate cancer.
Based on the above research, the applicant proposes a technical solution of the present application.
In one embodiment, the invention provides a fusion gene PAOX-MTG1 isolated from prostate tissue, the fusion gene PAOX-MTG1 having the full length of the sequence shown in SEQ ID No.1 or a fragment thereof.
On the basis of the fusion gene, the fusion gene can be used together with the existing reported prostatic cancer related marker gene according to the actual monitoring requirement, so that the disease progression state or the possibility of relapse of the prostatic cancer can be accurately predicted.
The fusion gene PAOX-MTG1 is formed by the specific conjunction of two genes, namely PAOX (genbank ID _196743) and UBE2E (genbank ID _92170) in the transcription stage.
The fragment comprises any one PCR fragment of the fusion gene, and the any one PCR fragment is a PCR product. Different PCR products can be obtained by adopting different PCR primers.
In one embodiment, the invention provides an isolated polynucleotide capable of being transcribed into the fusion gene PAOX-MTG1 as described above.
According to the fusion gene PAOX-MTG1 sequence provided by the invention, antisense oligonucleotides can be designed, and the antisense oligonucleotides can regulate the amount of the corresponding fusion gene or the expression of the fusion gene in vivo.
In one embodiment, the polynucleotide is capable of being transcribed by a human cell into the fusion gene PAOX-MTG1 as described above.
In one embodiment, the invention provides a polypeptide encoded by the fusion gene PAOX-MTG1 as described above.
In one embodiment, the invention provides a recombinant expression vector comprising the fusion gene PAOX-MTG1 as described above or a polynucleotide as described above.
The recombinant expression vector usually further contains a promoter, an origin of replication, and/or a marker gene, etc. Those skilled in the art can use well-known methods for constructing the expression vectors required by the present invention. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The recombinant expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as kanamycin, gentamicin, hygromycin, ampicillin resistance.
In one embodiment, the invention provides a chip/formulation containing a polynucleotide detection reagent for the fusion gene PAOX-MTG1 as described above or a polynucleotide as described above.
The chip can also be used for preparing a corresponding fusion gene detection chip by utilizing the fusion gene PAOX-MTG1 sequence, and further researching an expression profile and a regulation mode of fusion gene expression. The fusion gene chip of the invention comprises: a solid support; and oligonucleotide probes orderly fixed on the solid phase carrier, wherein the oligonucleotide probes specifically correspond to part or all of the sequence shown by the fusion gene. Specifically, a suitable probe can be designed according to the fusion gene of the invention, and the probe is immobilized on a solid phase carrier to form an oligonucleotide array. By "oligonucleotide array" is meant an array having addressable locations (i.e., locations characterized by distinct, accessible addresses), each addressable location containing a characteristic oligonucleotide attached thereto. The oligonucleotide array may be divided into a plurality of subarrays as desired. The solid phase carrier can adopt various common materials in the field of gene chips, such as but not limited to nylon membranes, glass slides or silicon wafers modified by active groups (such as aldehyde groups, amino groups and the like), unmodified glass slides, plastic sheets and the like.
The fusion gene PAOX-MTG1 chip can be prepared by conventional methods for manufacturing biochips known in the art. For example, if a modified glass slide or silicon wafer is used as the solid support and the 5' -end of the probe contains a poly-dT strand modified with an amino group, the oligonucleotide probe can be prepared as a solution, and then spotted on the modified glass slide or silicon wafer using a spotting apparatus, arranged in a predetermined sequence or array, and then fixed by standing overnight, to obtain the chip of the present invention. If the nucleic acid does not contain amino modifications, the preparation can also be referred to: the "Gene diagnostic technique-non-Radioactive operation Manual" edited by Wangshen five; l. lerisi, v.r.i yer, p.o.brown. Expanding the metabolic and genetic control of gene expression on a genetic scale. Science, 1997; 278:680 and maliren, Jiang Zhong Hua main edited. A biochip is provided. Beijing: chemical industry Press, 2000, 1-130.
In one embodiment, the present invention also provides a method for detecting the fusion gene PAOX-MTG1 in human prostate tissue by using the fusion gene PAOX-MTG1 chip, comprising the steps of:
(1) providing a sample of RNA isolated from human prostate tissue, and disposing a marker on said RNA;
(2) contacting the RNA in the step (1) with the chip to enable the RNA to perform hybridization reaction with the oligonucleotide probe on the solid phase carrier, thereby forming an 'oligonucleotide probe-RNA' binary complex on the solid phase carrier;
(3) detecting the marker of the binary complex formed in step (2) to determine the amount of the corresponding fusion gene PAOX-MTG1 in the human tissue.
Methods for extracting RNA from human tissue are well known to those skilled in the art, including Trizol.
More preferably, in step (1), after isolating the RNA sample from human prostate tissue, the RNA sample is suitably treated to enrich for RNA having a length, typically between 150 and 250 nt. After the treatment, the small fragment RNA is used for subsequent hybridization, so that the accuracy of the chip capture fusion gene PAOX-MTG1 can be improved.
RNA having a certain fragment length can be conveniently isolated by one skilled in the art, for example, by gel electrophoresis. Labeling of RNA is also well known to those skilled in the art and can be accomplished by the addition of a label, such as a labeling group, that specifically binds to the RNA during hybridization. Such labeling groups include, but are not limited to: digoxin molecules (DIG), biotin molecules (Bio), fluorescein and its derivative biomolecules (FITC, etc.), other fluorescent molecules (e.g., Cy3, Cy5, etc.), Alkaline Phosphatase (AP), horseradish peroxidase (HRP), etc. These labels and methods of labeling are well known in the art.
When the RNA is hybridized with the fusion gene PAOX-MTG1 chip, the fusion gene PAOX-MTG1 chip may be prehybridized with a prehybridization buffer.
The solid phase hybridization between the RNA of the present invention and the chip of fusion gene PAOX-MTG1 is performed according to the classical method in the art, and the optimal conditions for buffer, probe and sample concentration, prehybridization temperature, hybridization temperature and time, etc. can be easily determined by the ordinary person in the art based on experience, or the "molecular cloning test manual" can be referred to. And then obtaining information to be detected according to the position, strength and other information of the marking signal on the lncRNA chip. If the amplification product is labeled with a fluorescent group, the information to be detected can also be directly acquired by a fluorescence detection device (such as a confocal laser scanner Scanarray 3000).
Further, the detection reagent comprises an amplification primer and/or a probe.
In one embodiment, the invention provides a kit for detecting the fusion gene PAOX-MTG1, which contains the chip or the preparation. The kit can be used for detecting the expression of the fusion gene PAOX-MTG1 in prostate tissue.
Preferably, the preparation or the kit further comprises a marker for marking the RNA sample and a substrate corresponding to the marker.
In addition, the preparation or kit may further include various reagents required for RNA extraction, PCR, hybridization, color development, and the like, including but not limited to: an extraction solution, an amplification solution, a hybridization solution, an enzyme, a control solution, a color development solution, a washing solution, an antibody, and the like. In addition, the kit can also comprise an instruction book and/or chip image analysis software.
Further, the kit is a qPCR detection kit. Compared with other detection methods, the sensitivity of qPCR detection is high.
Preferably, the expression quantity of one or more fusion genes is detected by adopting a one-step method qPCR method, namely, the reverse transcription and real-time fluorescent quantitative PCR reaction are completed in one tube, no reagent is required to be added in the reaction process, the tube cover is not required to be opened, the detection time can be completed in only 90 minutes, and the operation is very simple. Since all first strand cDNA generated is used for real-time fluorescent quantitative PCR amplification, the sensitivity is higher than that of the two-step reaction. And the pipetting steps are reduced, the operation time is shortened to the maximum extent, the flux is improved, and the pollution is effectively prevented.
In one embodiment, the invention provides the use of the chip or the preparation in the preparation of a tumor detection kit.
Further, the detection kit is used for detecting the prostatic cancer.
In one embodiment, the invention provides the use of the fusion gene PAOX-MTG1 as a tumor marker for prostate cancer.
In one embodiment, the invention provides a prostate cancer detection kit, which contains a fusion gene PAOX-MTG1 specific recognition agent.
The fusion gene PAOX-MTG1 specific identifier can interact with the fusion gene PAOX-MTG1 gene, and the fusion gene PAOX-MTG1 identified by the specific identifier is used as a signal to be detected. For example, the specific recognition reagent may be a primer containing a specific for the full length or partial fragment of the fusion gene PAOX-MTG1 and an amplification reagent.
In one embodiment, the invention provides the use of a fusion gene PAOX-MTG1 specific identifier in the preparation of a prostate cancer detection kit.
EXAMPLE 1 sample Collection and preparation
1. Collecting prostate cancer patient samples
210 pairs of prostate cancer tissues and normal tissues for genetic testing were obtained from Shanghai Changhai Hospital. The procedures for detection of the relevant genes and their subsequent experiments were approved by the ethical committee of hospitals. All patients filled out written informed consent authorizing us to use their sample.
2. The frozen sections of the cancer tissue and normal tissue are examined by a pathologist to ensure quality
Frozen sections of cancerous and normal tissues were examined by the pathologist of the study after HE staining to ensure that the density of cancerous tissue in the selected tissues exceeded 80% while normal tissues were free of cancerous tissue. All pathological specimens were examined simultaneously by two pathologists. If the conclusion is inconsistent, two pathologists discuss together to decide the conclusion.
3. Preparation of sample (RNA extraction):
a. directly placing the tissue block into a mortar, adding a small amount of liquid nitrogen, quickly grinding, adding a small amount of liquid nitrogen when the tissue is softened, grinding again, and repeating for three times.
b. The tissue samples were added to 1ml Trizol at 50-100mg and transferred to centrifuge tubes. In addition, the tissue volume can not exceed 10 percent of the Trizol volume, and then the tissue is fully homogenized for 1-2min by using an electric homogenizer.
c. Centrifuging at 12000r/min for 5 min, discarding the precipitate, adding 200. mu.l of chloroform per ml of Trizol, tightly covering the centrifuge tube, shaking and mixing by hand for 15s, and standing at room temperature for ten minutes.
d. Centrifuging at 12000g at 4 deg.C for 15 min, sucking the upper water phase, transferring to another new centrifuge tube, adding 0.6ml isoamyl alcohol per ml Trizol, mixing well, and standing at room temperature for 5-10 min.
e. After centrifugation at 12000g for 10 minutes at 4 ℃ and discarding of the supernatant, 1ml of 75% ethanol per ml of Trizol was added, and the precipitate was suspended by gentle shaking.
f. Air drying or vacuum drying at room temperature for 5-10min, and measuring absorbance at 260nm to quantify RNA concentration.
Example 2 discovery and validation of fusion genes
When we compare short RNA reads to a reference genome, we found that some sequences were split into two segments to match the genome. Such readings need to satisfy the following conditions:
a. the length of the shorter fragment is not shorter than 8bp
b. Note that regardless of the position of the intron (from 5 'to 3', positive or negative strand)
For the two-stage alignment analysis, we allow no more than one mismatch and no empty alignment.
Transcriptome sequencing and database building method:
rRNA removal: after the total RNA detection is qualified, the RNA is detected by Ribo-ZeroTMrRNA Removal Kits (Human/Mouse/Rat), which bind to rRNA using DNA probes that pair complementarily to rRNA, remove rRNA.
cDNA Synthesis: fragmentation buffer was then added to break the RNA into 250-and 300-bp short fragments, and six-base random primers were used to synthesize a single-stranded cDNA. Then, a buffer, dNTPs (dUTP, dATP, dGTP and dCTP) and DNApolymerase I were added to synthesize a double-stranded cDNA, and the double-stranded cDNA was purified using AMPure XP beads.
3. End repair plus linker: and (3) carrying out end repair on the purified double-stranded cDNA, adding the A tail and connecting a sequencing joint, then carrying out fragment size selection by using AMPure XP beads, degrading the second strand of the cDNA containing U by using USER enzyme, and carrying out fragment size selection by using AMPure XP beads.
PCR amplification: and finally, carrying out PCR amplification to obtain a chain specificity cDNA library.
5. Sequencing analysis detection results: we detected 386 gene-to-gene fusions in 210 for prostate cancer and normal tissues, 25 of which were previously reported in other cancers, 4 in prostate cancer, and 304 were newly discovered fusion genes. Of these, 314 pairs are intrachromosomal fusion genes, while 72 pairs are transchromosomal. We verified these fusion genes by SV and PCR. Studies have shown that, in significant contrast to the western cohort, the gene fusion with the highest incidence in chinese prostate cancer is PAOX-MTG1, with an incidence of up to 10%.
Example 3 PCR amplification of fusion Gene
Based on the correlation between the fusion gene of the present invention and prostate cancer, primers were designed.
1. Designing a primer probe: primer sequences were designed for the fusion gene PAOX-MTG 1.
Forward primer SEQ ID NO.2: gtacactagggggtcctacagc;
the reverse primer SEQ ID NO.3: ctgaaacagagggttgcgg.
rtPCR and sequencing validation of gene fusion: we verified the RNA-seq gene fusion at the transcriptional level by the following specific procedures:
2.1 We performed PCR amplifications using the rtPCR primers specific above, and all rtPCR amplified fragments were recovered by tapping (Qiagen QIAquick Gel Extraction kit) and subjected to Sanger sequencing.
TABLE 1 RT-PCR reaction System
Figure BDA0002284895160000081
Figure BDA0002284895160000091
And (3) PCR reaction conditions: 10min at 95 deg.C- - [ 30s at 95 deg.C- -30 s at 64 deg.C- -30 s at 72 deg.C ] 40 cycles.
The results show that: the amplification efficiency of the primer probe in the PCR amplification system and under the conditions reaches 95.4 percent.
2.2. PCR product purification is carried out by using a PCR purification Kit PCR clean Kit 50-prep (AXYGEN, Cat No. AP-PCR-50, Lot No. KB10101204-G), 2% agarose gel electrophoresis is carried out on the PCR product, gel recovery is carried out by using a gel recovery Kit DNASELExtraction Kit 50-prep (AXYGEN, Cat No. AP-PCR-50, Lot No. KB10101204-G), a gel electrophoresis picture is shown in figure 1, Sanger sequencing is carried out on the recovered sample, and the result is shown in figure 2, which shows that the sequence of the amplified fragment is completely consistent with the target sequence (the fragment at the junction of the fusion gene), and the result shows that the target gene can be effectively amplified by using the primer.
The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.
Sequence listing
<110> Shanghai Changhai Hospital
<120> fusion gene PAOX-MTG1 and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 2
<211> 452
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgtacactag ggggtcctac agctacgtgg ccgtgggcag tactgggggc gacctggacc 60
tgctggctca gcccctccct gcagacggcg ccggcgccca gctccagatc ctgtttgcgg 120
gggaagccac acatcgcacg ttttactcca cgacgcacgg ggctctgctg tcgggatgga 180
gggaggccga ccgcctcctc agtctgtggg ccccgcaggg ctgaagaaga tgcagagcag 240
cctgaagctg gtggactgta tcatcgaggt ccacgatgcc cggatcccac tttcaggccg 300
caaccctctg tttcaggaaa cccttgggct taagcctcac ttgctggtcc tcaacaagat 360
ggacttggcg gatcttacag agcagcagaa aattatgcaa cacttagaag gagaaggcct 420
aaaaaatgtc atttttacca actgtgtaaa gg 452
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtacactagg gggtcctaca gc 22
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctgaaacaga gggttgcgg 19

Claims (10)

1. An isolated fusion gene PAOX-MTG1, wherein the fusion gene PAOX-MTG1 has the full length of the sequence shown in SEQ ID NO.1 or a fragment thereof.
2. The fusion gene PAOX-MTG1 according to claim 1, wherein: the fusion gene PAOX-MTG1 is derived from human prostate tissue.
3. An isolated polynucleotide capable of being transcribed into the fusion gene PAOX-MTG1 of claim 1.
4. A polypeptide, characterized by: the polypeptide is encoded by the fusion gene PAOX-MTG1 of claim 1.
5. A carrier, characterized by: the vector comprising the fusion gene PAOX-MTG1 of claim 1 or the polynucleotide of claim 3.
6. A chip/formulation/kit characterized by: the chip/preparation/kit contains detection reagents for the fusion gene PAOX-MTG1 of claim 1 or the polynucleotide of claim 3, preferably the detection reagents comprise amplification primers or oligonucleotide probes.
7. A fusion gene PAOX-MTG1 chip, wherein the fusion gene PAOX-MTG1 chip comprises: a solid support, and an oligonucleotide probe immobilized on the solid support in order, the oligonucleotide probe specifically corresponding to the fusion gene PAOX-MTG1 of claim 1.
8. A kit for detecting fusion gene PAOX-MTG1 is characterized in that: the detection kit contains the chip/preparation as claimed in claim 6.
9. Use of the chip/formulation of claim 6 for the preparation of prostate cancer detection kits.
10. Use of a detection reagent, amplification primer or oligonucleotide probe directed against the fusion gene PAOX-MTG1 according to claim 1 in the preparation of a product for the detection of prostate cancer.
CN201911156300.8A 2019-11-22 2019-11-22 Fusion gene PAOX-MTG1 and application thereof Pending CN112831513A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911156300.8A CN112831513A (en) 2019-11-22 2019-11-22 Fusion gene PAOX-MTG1 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911156300.8A CN112831513A (en) 2019-11-22 2019-11-22 Fusion gene PAOX-MTG1 and application thereof

Publications (1)

Publication Number Publication Date
CN112831513A true CN112831513A (en) 2021-05-25

Family

ID=75922513

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911156300.8A Pending CN112831513A (en) 2019-11-22 2019-11-22 Fusion gene PAOX-MTG1 and application thereof

Country Status (1)

Country Link
CN (1) CN112831513A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102533945A (en) * 2010-12-13 2012-07-04 江苏百帝生物科技有限公司 Detection method and correlated detection probe and kit for prostatic cancer related fusion gene Fish
US20130022974A1 (en) * 2011-06-17 2013-01-24 The Regents Of The University Of Michigan Dna methylation profiles in cancer
CN104611336A (en) * 2015-02-09 2015-05-13 上海长海医院 Fusion gene TTTY15-USP9Y and application of fusion gene as prostate cancer marker
US20180051340A1 (en) * 2013-06-28 2018-02-22 British Columbia Cancer Agency Branch Methods and uses for diagnosis and treatment of prostate cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102533945A (en) * 2010-12-13 2012-07-04 江苏百帝生物科技有限公司 Detection method and correlated detection probe and kit for prostatic cancer related fusion gene Fish
US20130022974A1 (en) * 2011-06-17 2013-01-24 The Regents Of The University Of Michigan Dna methylation profiles in cancer
US20180051340A1 (en) * 2013-06-28 2018-02-22 British Columbia Cancer Agency Branch Methods and uses for diagnosis and treatment of prostate cancer
CN104611336A (en) * 2015-02-09 2015-05-13 上海长海医院 Fusion gene TTTY15-USP9Y and application of fusion gene as prostate cancer marker

Similar Documents

Publication Publication Date Title
JP4435259B2 (en) Detection method of trace gastric cancer cells
CN106399546B (en) Capture probe and kit for detecting human circulating tumor DNA EGFR gene by high-throughput sequencing
CN106520963B (en) Capture probe and kit for detecting human circulating tumor DNA KRAS gene by high-throughput sequencing
WO2023060871A1 (en) Hla gene amplification primer, kit, sequencing library establishment method, and sequencing method
CN106498082B (en) Method for constructing ovarian cancer susceptibility gene variation library
CN106757379A (en) Lung cancer polygenic variation library constructing method
CN110853708B (en) Design method of nucleic acid capture probe for HLA typing
CN114958997A (en) Method for detecting chaperone gene
CN112662762A (en) Probe composition for detecting 5 tumors of digestive tract
CN108949969B (en) Application of long-chain non-coding RNA in colorectal cancer
CN106754878B (en) Method for constructing breast cancer susceptibility gene variation library
CN109337956B (en) Design method and kit for enriching multi-gene stem-loop probe based on NGS technology
JP4317854B2 (en) Detection method of trace gastric cancer cells
JP2001505428A (en) Detection of chromosomal abnormalities
CN112831513A (en) Fusion gene PAOX-MTG1 and application thereof
CN112266963B (en) Detection kit for combined detection of chronic granulocytic leukemia
CN112831514A (en) Fusion gene SCHLAP1-UBE2E3 and application thereof
CN110600082B (en) Nucleic acid capture probe for HLA typing and design method thereof
CN114196740A (en) Digital amplification detection method, detection product and detection kit for simultaneously identifying multiple gene types
KR101392970B1 (en) A Method for Detecting Target Nucleic Acid with Improved Sensitivity and Specificity
CN116445478B (en) Primer combination for constructing IGHV gene library and application thereof
JP4363561B2 (en) Discrimination method of pig type
KR101735762B1 (en) Prediction method for swine fecundity using gene expression profile
CN102199658B (en) Gene detection chip of common mutations of diphosphate glucuronyl transferase 1A and use method thereof
CN114369664B (en) Marker for pancreatic cancer screening, probe composition and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210525

RJ01 Rejection of invention patent application after publication