CN112831469B - Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof - Google Patents

Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof Download PDF

Info

Publication number
CN112831469B
CN112831469B CN201911164594.9A CN201911164594A CN112831469B CN 112831469 B CN112831469 B CN 112831469B CN 201911164594 A CN201911164594 A CN 201911164594A CN 112831469 B CN112831469 B CN 112831469B
Authority
CN
China
Prior art keywords
cells
cell
sult
microenvironment
amount
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911164594.9A
Other languages
Chinese (zh)
Other versions
CN112831469A (en
Inventor
王�锋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University School of Medicine
Original Assignee
Shanghai Jiaotong University School of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University School of Medicine filed Critical Shanghai Jiaotong University School of Medicine
Priority to CN201911164594.9A priority Critical patent/CN112831469B/en
Publication of CN112831469A publication Critical patent/CN112831469A/en
Application granted granted Critical
Publication of CN112831469B publication Critical patent/CN112831469B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/02—Sulfotransferases (2.8.2)
    • C12Y208/02002—Alcohol sulfotransferase (2.8.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Abstract

The invention provides an application of a reagent for regulating the amount of membrane lipid in a microenvironment of a T cell in preparing a product for improving the activity of the T cell, improving the number of the T cell, inhibiting the combination effect of CD3CD and a cell membrane, controlling the titer of the membrane Ca 2+, enhancing the production of GzmB, IFNgamma and TNF alpha or resisting tumors, wherein the amount of the membrane lipid in the microenvironment of the T cell is preferably reduced by CS in the microenvironment of the T cell, more preferably reduced by CS in the tumor microenvironment of the T cell, and most preferably the Sult b1 gene in the tumor cell genome around the T cell is knocked out.

Description

Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof
Technical Field
The invention relates to the technical field of tumor immunity and genetic engineering, in particular to application of an agent for regulating the amount of membrane lipid in a microenvironment where T cells are located in preparation of products for improving the activity of the T cells, improving the number of the T cells, inhibiting the binding effect of CD3CD and cell membranes, controlling the titer of membrane Ca 2+, enhancing the production of GzmB, IFN gamma and TNF alpha or resisting tumors, wherein the amount of membrane lipid in the microenvironment where the T cells are preferably reduced, more preferably the amount of CS in the microenvironment where the T cells are located is reduced, and most preferably the Sult b1 gene in the genome of tumor cells around the T cells is knocked out.
Background
TCRs are a multi-subunit T cell surface membrane receptor that includes antigen-recognizing heterodimers, i.e., tcrαβ or tcrγδ. TCR formation of complex with CD3 involved in T cell signaling: (CD 3 εγ, CD3 εδ, and CD3 ζζ). When TCR binds to a specific MHC-antigen peptide complex, transmembrane signals are triggered to cause phosphorylation of the Immunoreceptor Tyrosine Activation Sequence (ITAMs) of the intracellular CD3 subunit, which then triggers a series of signal gradients including adaptor protein phosphorylation, formation of signal complexes, intracellular calcium efflux, formation of immune synapses, cytokine secretion and cell proliferation.
Since TCR signaling is critical for T cell activation and function, including T cell selection at the thymus and killing of viral infection and development of cancer cells, the sophisticated regulatory mechanisms that reveal TCR signaling are critical. The prior art data shows that membrane lipids can modulate TCR signaling. Both references ：Cholesterol and sphingomyelin drive ligand-independent T-cell antigen receptornanoclustering(Molnar E,et al.,J Biol Chem,287,42664-42674,2012) and Acholesterol-based allostery model of T cell receptor phosphorylation(Swamy M,et al.,Immunity,44,1091-1101,2016) show that cholesterol, as the major sterol lipid in mammalian cells, specifically binds to TCR β chains and induces TCR clustering, triggering TCR signaling. Reference ：Inhibition of T cell receptor signaling by cholesterol sulfate,a naturally occurring derivative of membrane cholesterol(Wang et al.,Nat Immunol,17,844-850,2016) discloses that cholesterol sulfate (Cholesterol sulfate, CS) is a natural derivative of membrane cholesterol, which can disrupt TCR aggregation, inhibit TCR signaling, and play an important regulatory role in thymus selection. At the same time, phosphatidic acid on the inner leaflet of the cell membrane can influence the charged CD3 epsilon/zeta cytoplasmic domain (CD 3 CD) and induce conformational change through the interaction positively correlated with ion interaction, and in the resting state, the key tyrosine residue bilayer membrane on the membrane is detained, thereby preventing spontaneous TCR signals. Under antigen stimulation, the calcium ion flux can regulate dissociation of CD3CD from the membrane, further amplifying the signal. However, whether CS can regulate TCR signals by modulating conformational changes of CD3CD in addition to TCR clustering is still unknown, nor is there any document disclosing the use of agents that modulate the amount of membrane lipids in the microenvironment in which T cells are located in the preparation of products that increase T cell activity, increase T cell numbers, inhibit the binding of CD3CD to cell membranes, control membrane Ca 2+ titers, enhance GzmB, ifnγ, tnfα production or anti-tumor.
Disclosure of Invention
To make up for the blank of the prior art, the present inventors creatively regulated TCR signaling by modulating the amount of membrane lipids in the microenvironment in which the T cells are located. Firstly, the inventor prepares a tumor cell for knocking out Sult b1 genes, the tumor cell is a tumor cell around a T cell, and after Sult b1 genes are knocked out, the content of membrane lipid in a microenvironment where the T cell is located is low. Experiments prove that the T cells are low in membrane lipid in the microenvironment, so that the activity of the T cells is higher, the proliferation quantity is more, the binding effect of CD3CD and cell membranes is inhibited, the titer of the membrane Ca 2+ is controlled, the production of GzmB, IFN gamma and TNF alpha is more important, the capability of killing tumor cells is strong, and the survival time of tumor patients is prolonged.
In particular, in a first aspect of the invention, there is provided the use of an agent for modulating the amount of membrane lipids in the microenvironment in which T cells are located in the preparation of a product selected from any one or a combination of any two or more of the following:
a) Improving T cell activity;
B) Increasing the number of T cells;
c) Inhibiting the binding of CD3CD to cell membranes;
D) Controlling the titer of the membrane Ca 2+;
e) Enhancing production of GzmB, ifnγ, tnfα; or (b)
F) Anti-tumor.
Wherein the membrane lipid comprises one or more than two of phosphatidylcholine (phosphatidyl choline, POPC), phosphatidylserine (phosphatidyl serine, POPS), phosphatidylethanolamine (phosphatidyl ethanolamine, PE), phosphatidylinositol (phosphatidyl inositol, PI), biphospholipid glycerol (dpp), sphingomyelin (sphingomyelin, SM), galactocerebroside, ganglioside, cholesterol or cholesterol sulfate (Cholesterol sulfate, CS).
In one embodiment of the invention, the membrane lipid is cholesterol and the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is an amount that increases the cholesterol in the microenvironment in which the T cells are located.
In one embodiment of the invention, the membrane lipid is cholesterol sulfate and the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is an amount that reduces CS in the microenvironment in which the T cells are located. Preferably, the amount of CS is reduced to 30. Mu.M or less. It is further preferable to reduce the amount of CS to 20. Mu.M or less.
In one embodiment of the invention, the membrane lipid is phosphatidylserine (POPS), and the modulating the amount of membrane lipid in the microenvironment of the T cells is reducing the amount of POPS in the microenvironment of the T cells.
In a second aspect of the invention there is provided the use of an agent for reducing the amount of CS in a microenvironment in which a T cell is located in the preparation of a product selected from any one or a combination of any two or more of the following:
a) Improving T cell activity;
B) Increasing the number of T cells;
c) Inhibiting the binding of CD3CD to cell membranes;
D) Controlling the titer of the membrane Ca 2+;
e) Enhancing production of GzmB, ifnγ, tnfα; or (b)
F) Anti-tumor.
Preferably, the amount of CS is reduced to 30. Mu.M or less. It is further preferable to reduce the amount of CS to 20. Mu.M or less.
Preferably, the reduction of CS in the microenvironment of the T cells can be achieved by using CS inhibitors or by knocking out the genes of key enzymes in the synthesis of CS by genetic engineering means. Further preferred, the CS inhibitor comprises inhibition of a key enzyme of the CS synthesis pathway, e.g. Sult b1, PASS 2.
In one embodiment of the invention, the amount of CS in the microenvironment of the T-cells is an amount of CS in the tumor microenvironment of the T-cells, and the amount of CS in the tumor microenvironment of the T-cells is a amount of Sult b1 gene in the tumor cell genome surrounding the T-cells.
Preferably, the agent that reduces the amount of CS in the microenvironment of the T cell may be a CS inhibitor or an agent comprising a Sult b1 gene knocked out in the genome of the tumor cell surrounding the T cell.
In one embodiment of the present invention, the Sult b1 gene in the tumor cell genome surrounding the T cell is knocked out by designing a pair of guide RNA sites for Crispr knockout, knocking out the Sult b1 gene in the tumor cell by using the Crispr knockout method, and detecting and obtaining the Sult b1 gene knocked out tumor cell line.
In a third aspect of the invention there is provided the use of an agent for knocking out Sult b1 genes in the genome of a tumour cell surrounding a T cell in the manufacture of a product selected from any one or a combination of any two or more of:
a) Reducing the amount of CS in the microenvironment in which the T cells are located;
b) Improving T cell activity;
c) Increasing the number of T cells;
d) Inhibiting the binding of CD3CD to cell membranes;
e) Controlling the titer of the membrane Ca 2+;
f) Enhancing production of GzmB, ifnγ, tnfα; or (b)
G) Anti-tumor.
Preferably, the CD3CD is CD3 epsilon CD or CD3 zeta CD.
Preferably, the T cell is a Car-T cell or a TCR-T cell.
Preferably, the T cells are cd8+ T cells.
In a fourth aspect of the invention, there is provided a method of reducing the amount of CS in a microenvironment in a T cell, said method comprising knocking out the Sult b1 gene in the genome of a tumor cell surrounding the T cell. Preferably, the amount of CS in the microenvironment where the T cells are located will be reduced to 30. Mu.M or less. Further preferably, the amount of CS in the microenvironment in which the T cells are located is reduced to 20. Mu.M or less.
In a fifth aspect of the invention, there is provided a method of increasing T cell activity, increasing T cell number, inhibiting CD3CD binding to cell membranes, controlling membrane Ca 2+ titer, or enhancing production of GzmB, ifnγ, tnfα, said method comprising modulating the amount of membrane lipids in the microenvironment in which the T cells are located.
Preferably, the membrane lipid comprises one or more of phosphatidylcholine (phosphatidyl choline, POPC), phosphatidylserine (phosphatidyl serine, POPS), phosphatidylethanolamine (phosphatidyl ethanolamine, PE), phosphatidylinositol (phosphatidyl inositol, PI), biphospholipid glycerol (dpp), sphingomyelin (sphingomyelin, SM), galactocerebroside, ganglioside, cholesterol or cholesterol sulfate.
In one embodiment of the invention, the membrane lipid is cholesterol and the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is an amount that increases the cholesterol in the microenvironment in which the T cells are located.
In one embodiment of the invention, the membrane lipid is phosphatidylserine (POPS), and the modulating the amount of membrane lipid in the microenvironment of the T cells is reducing the amount of POPS in the microenvironment of the T cells.
In one embodiment of the invention, the membrane lipid is Cholesterol Sulfate (CS), and the amount of membrane lipid in the microenvironment of the regulatory T cells is a CS-lowering amount.
Preferably, the amount of CS is reduced to 30. Mu.M or less. It is further preferable to reduce the amount of CS to 20. Mu.M or less.
Preferably, the CS-reducing amount may be reduced by using a CS inhibitor or by knocking out the gene of a key enzyme during synthesis of CS by genetic engineering means. Further preferred, the CS inhibitor comprises inhibition of a key enzyme of its synthetic pathway, e.g., sult b1, PASS 2.
In one embodiment of the present invention, the gene of the key enzyme in the synthesis of CS is Sult b1 gene. The method comprises the steps of regulating the amount of membrane lipid in the microenvironment of T cells to reduce the amount of CS in the microenvironment of the T cells, reducing the amount of CS in the microenvironment of tumors of the T cells to reduce the amount of CS in the microenvironment of tumors of the T cells, and knocking out Sult b1 genes in the genome of tumor cells around the T cells.
Preferably, the CD3CD is CD3 epsilon CD or CD3 zeta CD.
Preferably, the T cell is a Car-T cell or a TCR-T cell.
Preferably, the T cells are cd8+ T cells.
In a sixth aspect of the present invention, a Sult b1 knockout tumor cell is provided, the tumor cell is a tumor cell around a T cell, and after Sult b1 knockout, the CS content of the microenvironment in which the T cell is located is low.
Preferably, the T cell is a Car-T cell or a TCR-T cell.
Preferably, the T cells are cd8+ T cells.
In a seventh aspect, the present invention provides a method for constructing the Sult b1 gene-knocked-out tumor cell, wherein the Sult b1 gene-knocked-out tumor cell is constructed by using a gene editing technology, and the gene editing technology comprises a DNA homologous recombination technology, a CRISPR/Cas9 technology, a zinc finger nuclease technology, a transcription activator-like effector nuclease technology or a homing endonuclease.
Preferably, the CRISPR/Cas9 technology is used to target the knockout of all or part of the Sult b1 gene in the tumor cell genome, so that the Sult b1 protein is not expressed or the Sult b1 protein expressed is not functional, thereby reducing the CS content in the cell membrane of the tumor cell, i.e., reducing the CS content in the microenvironment in which the T cell is located.
Further preferred, the whole or part of the sequence of Sult b 2b1 gene is knocked out by introducing into tumor cells plasmid DNA expressing Cas9 and sgrnas, cas9 protein or sgRNA-Cas9 protein complex.
In an eighth aspect of the invention, there is provided a method of enhancing tumor immunity comprising reducing the content of CS in the microenvironment in which T cells are located. Preferably, the CS content in the microenvironment where the T cells are located is reduced to less than or equal to 30 mu M. Further preferably, the CS content of the microenvironment in which the T cells are located is reduced to 20. Mu.M or less.
In a ninth aspect of the invention, there is provided a method of enhancing tumor immunity comprising knocking out Sult b1 genes in the genome of tumor cells surrounding T cells.
In a tenth aspect of the invention, there is provided a method of killing tumor cells comprising reducing the CS content of a microenvironment in which T cells are located. Preferably, the CS content in the microenvironment where the T cells are located is reduced to less than or equal to 30 mu M. Further preferably, the CS content of the microenvironment in which the T cells are located is reduced to 20. Mu.M or less.
In an eleventh aspect of the invention, there is provided a method of killing a tumor cell by knocking out Sult b1 gene from the genome of the tumor cell surrounding the T cell.
In a twelfth aspect of the invention, there is provided a method of prolonging survival of a patient with a tumor comprising reducing the level of CS in the microenvironment in which the T cells are located. Preferably, the CS content in the microenvironment where the T cells are located is reduced to less than or equal to 30 mu M. Further preferably, the CS content of the microenvironment in which the T cells are located is reduced to 20. Mu.M or less.
In a thirteenth aspect of the invention, there is provided a method of prolonging survival of a patient with a tumor by knocking out Sult b1 gene from the genome of the tumor cells surrounding the T cells.
The "product" according to the invention may be a medicament or a kit comprising an agent for regulating the amount of membrane lipids in the microenvironment in which the T cells are located. Preferably, the amount of membrane lipids in the microenvironment of the regulatory T cells is such that the amount of CS in the microenvironment of the T cells is reduced. More preferably, the amount of CS in the microenvironment of the T cells is the amount of CS in the microenvironment of the tumor of the T cells, and the amount of CS in the microenvironment of the tumor of the T cells is reduced by knocking out Sult b1 genes in the genome of the tumor cells around the T cells. In one embodiment of the invention, the agent that modulates the amount of membrane lipids in the microenvironment in which the T cells are located is an agent that knocks out the Sult b1 gene in the tumor cell genome surrounding the T cells.
"T cells" as described herein include, but are not limited to, CD8+ T, CD4+ T cells, CD25+ T cells, memory T cells. In one embodiment of the invention, the T cells are cd8+ T cells. The TCR of the T cell is TCRαβ or TCRγδ. Preferably, the T cells are Car-T cells. Further preferred, the Car-T cells include, but are not limited to, CD133 Car-T, CD19 Car-T, CD Car-T, BMSA Car-T, MSLNCar-T, EGFRVIII CAR-T, her2 Car-T, GD2 Car-T, or CEA Car-T.
The invention relates to a method for inhibiting the binding effect of CD3CD and a cell membrane, which changes the conformation of a CD3CD secondary structure by reducing or increasing the amount of membrane lipid in the microenvironment where a T cell is positioned, thereby inhibiting the binding effect of CD3CD and the cell membrane. Preferably, the amount of membrane lipids in the microenvironment in which the T cells are located is reduced or increased by reducing the amount of CS in the tumor microenvironment in which the T cells are located.
The control membrane Ca 2+ titer disclosed by the invention changes the conformation of a CD3CD secondary structure by reducing or increasing the amount of membrane lipid in the microenvironment where the T cells are positioned, so that the flux of Ca 2+ in a cell membrane is enabled, and the effect of controlling the Ca 2+ titer is achieved.
"Homology" as used herein refers to the use of protein sequences or nucleotide sequences, which can be adjusted by those skilled in the art according to the actual working requirements, such that the sequences used have (including but not limited to )1％,2％,3％,4％,5％,6％,7％,8％,9％,10％,11％,12％,13％,14％,15％,16％,17％,18％,19％,20％,21％,22％,23％,24％,25％,26％,27％,28％,29％,30％,31％,32％,33％,34％,35％,36％,37％,38％,39％,40％,41％,42％,43％,44％,45％,46％,47％,48％,49％,50％,51％,52％,53％,54％,55％,56％,57％,58％,59％,60％,70％,80％,81％,82％,83％,84％,85％,86％,87％,88％,89％,90％,91％,92％,93％,94％,95％,96％,97％,98％,99％,99.1％,99.2％,99.3％,99.4％,99.5％,99.6％,99.7％,99.8％,99.9％ homology to sequences obtained in the prior art).
The "tumor" according to the present invention is selected from the group consisting of lymphoma, non-small cell lung cancer, leukemia, ovarian cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, renal cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein the leukemia is selected from acute lymphoblastic (lymphoblastic) leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia; the lymphoma is selected from hodgkin's lymphoma and non-hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and waldenstrom's macroglobulinemia; the sarcoma is selected from osteosarcoma, ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In one embodiment of the invention, the tumor is melanoma or colon cancer.
Drawings
Embodiments of the present invention are described in detail below with reference to the attached drawing figures, wherein:
fig. 1A: the efficacy of quenching when CS interacts with CD3 epsilon CD was assessed by FRET method using CS pretreatment Jurkat cells at concentrations of 10 μm, 20 μm, 30 μm, respectively, wherein the control group was Mock, the ordinate was efficacy of quenching, the scale bar was 5 μm, n.s. was no significance, P <0.0001, P <0.01.
Fig. 1B: CS pretreatment Jurkat cells at concentrations of 10 μΜ, 20 μΜ, and 30 μΜ were used, respectively, and FRET method was used to evaluate the CS interaction with CD3 epsilon CD, with the control group being Mock, the ordinate being mTFP (donor) fluorescence intensity after photobleaching, the scale bar being 5 μm, n.s. being insignificant, P <0.0001, P <0.01.
Fig. 1C: CS pretreatment Jurkat cells at concentrations of 10 μm, 20 μm, and 30 μm, respectively, were used to evaluate the R18 (receptor) fluorescence intensity values prior to photobleaching treatment by FRET method when CS interacted with CD3 epsilon CD, wherein the control group was Mock, the ordinate was the R18 (receptor) fluorescence intensity values prior to photobleaching treatment, the scale bar was 5 μm, and n.s. was no significance, P <0.0001, P <0.01.
Fig. 1D: CS pretreatment Jurkat cells at concentrations of 10 μm, 20 μm, and 30 μm, respectively, were used to evaluate the light fade efficacy upon CS interaction with CD3 epsilon CD by FRET method, wherein the control group was Mock, the ordinate was light fade efficacy, the scale bar was 5 μm, n.s. was no significance, P <0.0001, P <0.01.
Fig. 1E: when CS interacts with CD3 epsilon CD, the fluorescence intensity before and after photobleaching is compared, and the reference scale is 5 mu m.
Fig. 2A: the efficacy of quenching when CS interacts with cd3ζcd was assessed by FRET method using CS pretreatment Jurkat cells at concentrations of 10 μΜ, 20 μΜ, 30 μΜ, respectively, wherein the control group is Mock, the ordinate is efficacy of quenching, the scale bar is 5 μm, n.s. is no significance, P <0.0001, P <0.01.
Fig. 2B: CS pretreatment Jurkat cells at concentrations of 10 μm, 20 μm, and 30 μm were used, respectively, and FRET method was used to evaluate fluorescence intensity of mTFP after photobleaching treatment when CS interacted with cd3ζcd, wherein control group was Mock, ordinate was fluorescence intensity of mTFP after photobleaching treatment, reference ruler was 5 μm, n.s. was no significance, P <0.0001, P <0.01.
Fig. 2C: CS pretreatment Jurkat cells at concentrations of 10 μm, 20 μm, and 30 μm, respectively, were used to evaluate the R18 (receptor) fluorescence intensity values prior to photofading treatment by FRET method, wherein the control group was Mock, the ordinate was the R18 (receptor) fluorescence intensity values prior to photofading treatment, the scale bar was 5 μm, and n.s. was no significance, P <0.0001, P <0.01.
Fig. 2D: CS pretreatment Jurkat cells at concentrations of 10 μm, 20 μm, and 30 μm, respectively, were used to evaluate the photobleaching efficacy of CS in interaction with cd3ζcd by FRET method, wherein the control group is Mock, the ordinate is photobleaching efficacy, the scale bar is 5 μm, n.s. is no significance, P <0.0001, P <0.01.
Fig. 2E: when CS interacts with CD3 zeta CD, the fluorescence intensity before and after photobleaching is compared, and the reference scale is 5 μm.
Fig. 3: the efficacy of quenching effect upon CS interaction with cd3ζcd was evaluated by FRET in a 3 amino acid structure between KIR2DL3 transmembrane domain and mTFP using 30 μm CS pretreatment cells, wherein the control group was Mock, n.s. was no significance, P <0.0001, P <0.01.
Fig. 4: TFE (305 nm) method detects binding of CS or POPS to CD3 epsilon CD at concentrations of 10%, 20% or 30%, where q=0.8, q is the molar ratio of long chain lipids (POPS, CS and POPC) to short chain lipids (DHPC), TFE values are calculated from the difference in fluorescence intensity of TFE spectra of F (+lipid) -F (-lipid) at 305nm, n.s. is no significance, P <0.0001, P <0.01, P <0.05.
Fig. 5A: TFE (305 nm) method detects binding of CS or POPS to CD3 ζcd at concentrations of 10%, 20% or 30%, where q=0.8, q is the molar ratio of long chain lipids (POPS, CS and POPC) to short chain lipids (DHPC), TFE values are calculated from the difference in fluorescence intensity of TFE spectra of F (+lipid) -F (-lipid) at 305nm, n.s. is no significance, P <0.0001, P <0.01.
Fig. 5B: TFE (305 nm) curves after CS or POPS treatment of cells at 20% or 30% concentration with increasing Ca 2+ titer, where q=0.8, q is the molar ratio of long chain lipids (POPS, CS and POPC) to short chain lipids (DHPC), and TFE values are calculated from the difference in fluorescence intensity of the TFE spectrum at 305nm for F (+lipid) -F (-lipid).
Fig. 5C: luo Numei (5 mM) Ca 2+ in, wherein the ordinate is FRET quenching efficacy, the scale bar is 5 μm, n.s. is no significance, P <0.0001, P <0.01, P <0.05.
Fig. 6A: round dichroism spectrum of 30% CS and 30% POPS on CD3 epsilon CD secondary structure fold or fold, POPC is phosphatidylcholine as positive control.
Fig. 6B: round dichroism spectrum of 20% CS and 20% POPS on CD3 epsilon CD secondary structure fold or fold, POPC is phosphatidylcholine as positive control.
Fig. 7A: ca 2+ titer of acid lipid after 20% CS-induced secondary structure change of CD3 εCD.
Fig. 7B: ca 2+ titer of acid lipid after 20% POPS-induced secondary structure change of CD3 εCD.
Fig. 7C: TFE (305 nm) profile of CD epsilon CD after treatment of cells with 20% CS and 20% POPS during Ca 2+ titration, where q=0.8, q is the molar ratio of long chain lipids (POPS, CS and POPC) to short chain lipids (DHPC), TFE values are calculated from the difference in fluorescence intensity of TFE spectra of F (+lipid) -F (-lipid) at 305 nm.
Fig. 8A: ca 2+ titer of acid lipid after 30% CS-induced secondary structure change of CD3 εCD.
Fig. 8B:30% post-pops induced secondary structural change in CD3 epsilon CD Ca 2+ titer of the acid lipids.
Fig. 9: after cells were treated with CS, cs+5mM Luo Numei, mock control, 5mM Luo Numei (inducing calcium influx) control, respectively, FRET method was evaluated for quenching efficacy, where the ordinate is quenching efficacy and n.s. is no significance, P <0.0001, P <0.01.
Fig. 10: the binding strength of 30% POPS or 30% CS to CD3 εCD was measured at different Ca 2+ titers and showed that the binding was weaker with increasing Ca 2+ titers, where CS bound more strongly to CD3 εCD than POPS bound to CD3 εCD.
Fig. 11A: circular dichroism spectrum of Ca 2+ titer of acid lipid after 30% cs-induced secondary structure change of CD3 ζcd.
Fig. 11B: circular dichroism spectrum of Ca 2+ titer of acid lipid after 30% pops induced secondary structural change of CD3 ζcd.
Fig. 12: the peak value of proliferation of OT1 cells was compared with that of cells after 2 days of co-culture of wild-type (WT) melanoma cells and of melanoma cells from which Sult b 2b1 gene (Sult b 1-ko) had been knocked out, respectively, with initial OT1T cells expressing OVA. OT1T cells were stained with CELL TRACER prior to co-culture, at the ratio of melanoma cells: t cell = 1:8..
Fig. 13A: wild Type (WT) melanoma cells produced more GzmB, ifnγ, tnfα than melanoma cells from which Sult b 2b1 gene (Sult b 1-ko) was knocked out, sult b1-ko, wherein the co-culture ratio was that of melanoma cells: t cells = 1:2, co-culture time 3 days.
Fig. 13B: comparison of the amounts of GzmB, ifnγ, tnfα produced by wild-type (WT) melanoma cells and by knockout Sult b1 gene (Sult b 1-ko) after co-culture with initial OT1T cells expressing OVA for 3 days, respectively, wherein the co-culture ratio is that of melanoma cells: t cells = 1:2, n.s. is of no significance, P <0.0001, P <0.01.
Fig. 13C: comparison of cell death rates after 3 days of co-culture of wild-type (WT) melanoma cells and melanoma cells knocked out of Sult b1 gene (Sult b 1-ko) with initial OT1T cells expressing OVA, respectively, wherein the co-culture ratio is that of melanoma cells: t cells = 1:2, n.s. is of no significance, P <0.0001, P <0.01.
Fig. 13D: the survival numbers of Wild Type (WT) melanoma cells and melanoma cells after knocking out Sult b1 gene (Sult b 1-ko) were compared with the survival numbers of OT1T cells collected after 3 days of co-culture of initial OT1T cells expressing OVA, respectively, wherein the co-culture ratio was that of melanoma cells: t cells = 1:2, n.s. is of no significance, P <0.0001, P <0.01.
Fig. 13E: the peak value of proliferation of OT1 cells was compared with that of cells after 3 days of co-culture of wild-type (WT) melanoma cells and of melanoma cells from which Sult b1 gene (Sult b 1-ko) had been knocked out, respectively, with initial OT1T cells expressing OVA. OT1T cells were stained with CELL TRACER prior to co-culture, at the ratio of melanoma cells: t cell = 1:2.
Fig. 13F: after 3 days of co-culture of wild-type (WT) melanoma cells and melanoma cells knocked out of Sult b1 gene (Sult b 1-ko) with initial OT1T cells expressing OVA, respectively, MFI values were compared, wherein the co-culture ratio was that of melanoma cells: t cells = 1:2, n.s. is of no significance, P <0.0001, P <0.01.
Fig. 14A: melanoma cells of Wild Type (WT) and those from which Sult b1 gene (Sult b 1-ko) had been knocked out were co-cultured at 3:1 (melanoma cells: T cells), 2:1 (melanoma cells: T cells) with pre-activated OT1T cells expressing OVA for 40h, respectively, for comparison of cell mortality.
Fig. 14B: melanoma cells after wild-type (WT) melanoma cells and Sult b1 gene knocked out (Sult b 1-ko) were co-cultured with pre-activated OT1T cells expressing OVA at 3:1 (melanoma cells: T cells), 2:1 (melanoma cells: T cells), respectively, with no significant cell killing ratio, n.s. P <0.0001, P <0.01.
Fig. 14C: when wild-type (WT) melanoma cells and melanoma cells after knockout of Sult b1 gene (Sult b 1-ko) were co-cultured with pre-activated OT1T cells expressing OVA at 3:1 (melanoma cells: T cells), 2:1 (melanoma cells: T cells), OT1 cells/thousand melanoma cells, n.s. was no significance, P <0.0001, P <0.01, respectively.
Fig. 15A: tumor volume size comparison of Wild Type (WT) melanoma cells compared to melanoma cells after knockdown of Sult b 2b1 gene (Sult b 1-ko).
Fig. 15B: the mice were injected with melanoma cells (WT) or with the Sult b1 gene knocked out (Sult b 2b 1-ko) respectively, and the tumor volume was varied with increasing days after injection, wherein the tumor volume was in mm 3, the ordinate was tumor volume, the abscissa was days after injection, and n.s. was insignificant, P <0.0001, P <0.01.
Fig. 15C: tumor weight size in wild-type (WT) melanoma cells compared to melanoma cells after knockout of Sult b 2b1 gene (Sult b 1-ko), wherein the ordinate is tumor weight (mg) and n.s. is no significance, P <0.0001, P <0.01, P <0.05.
Fig. 15D: the number of cd8+ T cells per mg tumor compared to wild-type (WT) melanoma cells after knockdown of Sult b 2b1 gene (Sult b 1-ko) was no significant, n.s. P <0.0001, P <0.01, P <0.05.
Fig. 15E: the percentage of PD-1 expression in cd8+ T cells compared to wild-type (WT) melanoma cells and melanoma cells after knockout of Sult b1 gene (Sult b 1-ko) was less significant, n.s. P <0.0001, P <0.01.
Fig. 16: comparison of survival time for melanoma patients with low Sult b1 protein compared to melanoma patients with high Sult b1 protein, where the ordinate is survival value.
Fig. 17: effect on melanoma cell growth after knock-out Sult b1 gene.
Fig. 18: effect on CS content in melanoma cells after knock-out Sult B1 gene, where n.s. is no significance, P <0.0001, P <0.01, P <0.05, and the ordinate in fig. 18B is the CS-containing area (×10 4).
Fig. 19: wild-type (WT) melanoma cells produced more GzmB, ifnγ, tnfα than melanoma cells from which Sult B2B 1 gene (Sult B1-ko) was knocked out, sult B1-ko, wherein figure 19A is a bar graph and figure 19B is a flow cytometry graph, wherein co-culture ratios were melanoma cells: t cells = 1:8, co-culture time was 2 days.
Fig. 20: the Wild Type (WT) melanoma cells and the melanoma cells after knockdown of Sult b1 gene (Sult b 1-ko) were co-cultured with initial OT1T cells expressing OVA for 2 days, respectively, with MFI values compared, wherein the co-culture ratio was that of the melanoma cells: t cells = 1:8, n.s. is of no significance, P <0.0001, P <0.01.
Fig. 21: cell killing comparisons were examined when wild-type (WT) melanoma cells and melanoma cells knocked out of Sult b1 gene (Sult b 1-ko) were co-cultured with pre-activated OT1T cells expressing OVA at 8:1 (melanoma cells: T cells), 4:1 (melanoma cells: T cells) for 3 days, respectively, where the ordinate is percent (%) cell killing, n.s. is no significance, P <0.0001, P <0.01.
Detailed Description
The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
EXAMPLE 1 preparation of Sult b1 Gene knockout T cells
The oligomeric sequences of the three guides RNA(GATGCTCTCGAGCGAGTAC(SEQ IDNO：1)、GTCGTCGTCCCGCACATCT(SEQ ID NO：2)、GATCCGCTCCGTGCCCATC(SEQ ID NO：3)) positioned at Sult b1 genes are respectively constructed on vectors of pHAGE-crispr-zsgreen, then the constructed vectors and packaging plasmids (PMD 2 and PSPX 2) are transferred into 293FT cells to obtain slow viruses, infected T cells (JukartT cells) and the T cell clones of Sult b1 gene knockout are sorted and cultured.
Example 2 CS modification of CD3CD conformation
To determine if CS can interact with CD3CD and change its conformation, fluorescence-based energy resonance transfer was usedResonance ENERGY TRANSFER, FRET). Specifically, monomeric blue-green fluorescent protein (mTFP 1) is used as a FRET donor and is connected to the C end of CD3CD, fused to the extracellular/TM domain of KIR2DL3 protein, and a red fluorescent dye octadecyl rhodamine B (R18) staining film is used as a FRET acceptor.
CD3CD binds to the Plasma Membrane (PM) due to the phosphatidic acid contained on the lipid membrane leaflet. The cells were pretreated with different molar concentrations of CS (10. Mu.M, 20. Mu.M, 30. Mu.M) to determine the interaction of CS with CD3 CD.
The results show that as the molar amount of CS in the pretreated cells increases, the FRET value increases progressively, wherein the results of CS interaction with CD3 εCD are shown in FIGS. 1A-E, and the results of CS interaction with CD3 ζCD are shown in FIGS. 2A-E, the CS interaction with CD3 εCD increases significantly when the cells are pretreated with a CS amount of ≡20. Mu.M, and the CS interaction with CD3 ζCD increases significantly when the cells are pretreated with a CS amount of ≡30. Mu.M. However, in the control structure containing 3 amino acids between KIR2DL3 transmembrane domain and mTFP a 1, CS treatment failed to alter FRET values (see figure 3). In conclusion, CS can significantly enhance the binding of CD3 epsilon CD or CD3 zeta CD to the membrane, thereby preventing TCR signaling.
This example further compares the binding of CS, POPS to CD3 epsilon CD or CD3 zeta CD to the membrane and determines the interaction of CD3CD with CS, POPS by in vitro detection of Tyrosine Fluorescence Emission (TFE).
TFE specific steps:
The experiments with TFE were carried out on VARIAN CARY ECLIPSE machines, the wavelength of the excitation light being set to 275nm and the wavelength of the emission light being set between 290 and 340 nm. Reaction conditions for sample measurement: 2mM CD3CD protein, 0.3-0.8mM bilayer membrane vesicles Bicelles (q=0.8, 10-30% POPS, 10-30% CS), and 10mM Tri-HCl (pH 7.4). The measuring process comprises the following steps: the increased TFE value was calculated by measuring the TFE value of the protein in the absence of bilayer membrane vesicles and the background value of the bilayer membrane vesicles themselves, and then measuring the TFE value of the bilayer membrane vesicles added. If calcium ion titration is performed, the amount of calcium ions will be increased continuously, and the change in TFE value will be measured.
The results show that CS has a stronger effect than POPS in terms of interaction with CD3CD (see fig. 4, 5A, 5B, 5C). Moreover, this interaction is evident in the conformational change of CD3 epsilon CD, and fig. 6A, B shows that both 30% and 20% CS contribute to a secondary structure with more CD3 epsilon CD folds. Meanwhile, the secondary structure change of CD3 epsilon CD by CS is different from POPS, and the calcium titer remains within a certain range after the secondary structure change of CD3 epsilon CD by CS (see fig. 7A, B, C, fig. 8, A, B). TFE results showed that Ca 2+ only partially exposed the tyrosine of CD3 epsilon CD from the CS bilayer membrane vesicles, because of the different content of CS in the bilayer membrane vesicles, TFE values were maintained at a stable high Ca 2+ concentration level (fig. 9, 10).
Meanwhile, FRET results also confirm that even CD3 epsilon CD induced calcium influx by Luo Numei element treatment remains within the high limit of the cell membrane when the cells are pre-treated with CS (see fig. 9). The interaction of CD3 epsilon CD and CS reduces the sensitivity of Ca 2+ on the cell membrane. However, for CD3 ζcd, the continuous titration TFE value of Ca 2+ gradually decreased, the Ca 2+ value was not high and the secondary structure was soon lost (see fig. 11A, B).
Example 3 CS action with tumors
1. Preparation of melanoma model and melanoma model with Sult b1 Gene knocked out
Transferring the OVA gene into a murine melanoma B16-F10 cell line to obtain a B16-OVA cell line.
The oligomeric sequences of two guide RNAs (TTATGATGGTCTCGCACCA (SEQ ID NO: 4) and GGTGCGAGACCATCATAAGC (SEQ ID NO: 5)) positioned on Sult B1 genes are respectively constructed on pHAGE-crispr-zsgreen vectors, the constructed vectors and packaging plasmids (PMD 2 and PSPX 2) are transferred into 293FT cells to obtain lentivirus, infected melanoma cells B16-OVA, B16-OVA monoclonal cells with Sult B1 knocked out are sorted and cultured, the Sult B1 knocked-out condition of the monoclonal cells is detected by PCR, and meanwhile, whether the CS content in the monoclonal cells is reduced is detected by mass spectrometry. 2. Verifying the growth status of melanoma cells after Sult b1 gene knockout
The results showed that the melanoma cells (Sult B1-ko B16F10 cells) after knocking out Sult B1 gene were substantially identical to the growth status of the melanoma cells without knocking out Sult B1 gene, i.e. knocking out Sult B1 gene did not affect the growth of the cells (see fig. 12) and also had no effect on inducing TCR in vitro colonization (see fig. 17, 18A, 18B).
3. Experiments to verify the effect of melanoma cells after the Sult b1 Gene was knocked out
When Sult B1-ko B16F10 cells expressing OVA and the original OT 1T cells were co-cultured, sult B1-koB F10 cells produced more GzmB, ifnγ, tnfα and showed more effects of proliferation and killing of tumor cells (see fig. 19A, B, 13A, B, C, D, E, F, fig. 20). Meanwhile, preactivated T cells showed Sult B1-ko B16F10 cells killing more strongly than before knocking out Sult B1 gene at different ratios of B16 to T cells (see fig. 14, A, B, C, fig. 21).
3. Detection of tumor killing
The mice with Sult B1-ko B16F10 melanoma had smaller tumor volume and weight, lower CS content, and analysis of tumor infiltrating cd8+ T cells showed increased cell numbers and enhanced activity (see figure 15). Meanwhile, studies showed that melanoma patients expressing lower Sult b1 survived longer (see figure 16). That is, decreasing the cell membrane surface CS in the tumor environment may increase the activity of tumor infiltrating cd8+ T cells.
The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the specific details of the above embodiments, and various simple modifications can be made to the technical solution of the present invention within the scope of the technical concept of the present invention, and all the simple modifications belong to the protection scope of the present invention.
In addition, the specific features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations are not described further.
Sequence listing
<110> Shanghai university of transportation medical college
<120> Modulating the amount of CS in the microenvironment where T cells are located and uses
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 1
gatgctctcg agcgagtac 19
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 2
gtcgtcgtcc cgcacatct 19
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 3
gatccgctcc gtgcccatc 19
<210> 4
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 4
ttatgatggt ctcgcacca 19
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 5
ggtgcgagac catcataagc 20

Claims (4)

1. Use of a reagent for knocking out Sult b1 genes in the genome of a tumor cell surrounding a T cell, wherein the reagent is two guide RNAs located at Sult b1, the sequences of the guide RNAs are SEQ ID NOs: 4 and SEQ ID NO:5, a step of; the product is an anti-tumor product;
The tumor is melanoma.
2. The use of claim 1, wherein the Sult b1 gene is knocked out to reduce the amount of membrane lipid in the microenvironment in which the T cells are located.
3. The use according to claim 2, wherein the membrane lipid is CS.
4. The use of claim 1, wherein said T cells are cd8+ T cells.
CN201911164594.9A 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof Active CN112831469B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911164594.9A CN112831469B (en) 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911164594.9A CN112831469B (en) 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof

Publications (2)

Publication Number Publication Date
CN112831469A CN112831469A (en) 2021-05-25
CN112831469B true CN112831469B (en) 2024-04-19

Family

ID=75922813

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911164594.9A Active CN112831469B (en) 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof

Country Status (1)

Country Link
CN (1) CN112831469B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106955353A (en) * 2016-01-11 2017-07-18 中国科学院上海生命科学研究院 Acyl-CoA：The new application of cholesterol acyltransferase ACAT1 inhibitor
CN108392633A (en) * 2017-12-28 2018-08-14 中国人民解放军第二军医大学东方肝胆外科医院 Application of the PCSK9 inhibitor in malignant tumour immunization therapy

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106955353A (en) * 2016-01-11 2017-07-18 中国科学院上海生命科学研究院 Acyl-CoA：The new application of cholesterol acyltransferase ACAT1 inhibitor
CN108392633A (en) * 2017-12-28 2018-08-14 中国人民解放军第二军医大学东方肝胆外科医院 Application of the PCSK9 inhibitor in malignant tumour immunization therapy

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Hydroxysteroid sulfotransferase 2B1 affects gastric epithelial function and carcinogenesis induced by a carcinogenic agent;Wenting Hong et al.;《Lipids in Health and Disease》;第18卷;第2页右栏最后1段，第3页左栏第3段，第4页右栏最后1段-第5页左栏第1段 *
硫酸胆固醇的生理功能及其在相关疾病中的作用;蒋悦庭等;《上海交通大学学报（医学版）》;第43卷(第3期);371-375 *

Also Published As

Publication number Publication date
CN112831469A (en) 2021-05-25

Similar Documents

Publication Publication Date Title
Yang et al. MiR-146b-5p overexpression attenuates stemness and radioresistance of glioma stem cells by targeting HuR/lincRNA-p21/β-catenin pathway
Elhassan et al. Homo sapiens systemic RNA interference-defective-1 transmembrane family member 1 (SIDT1) protein mediates contact-dependent small RNA transfer and microRNA-21-driven chemoresistance
Riese et al. Enhanced effector responses in activated CD8+ T cells deficient in diacylglycerol kinases
Johnston et al. HSP90 protein stabilizes unloaded argonaute complexes and microscopic P-bodies in human cells
Moreira et al. TLR9 signaling through NF-κB/RELA and STAT3 promotes tumor-propagating potential of prostate cancer cells
CN110381963A (en) It is related to the immunotherapy method and composition of tryptophan metabolic pathway regulator
US20190077856A1 (en) Method of treating diseases using kinase modulators
US11624068B2 (en) Compositions and methods for improving immune system function
WO2005097189A1 (en) Carcinoma cell-specific apoptosis inducing agent targeting gene relevant to chromosome stabilization
BR112021007360A2 (en) methods for activating/proliferating t cells, for delivering a nucleic acid to t cells and for producing a drug, t cell, drug, cell culture, composition, and kit for delivering a nucleic acid to t cells
Ciaglia et al. Recognition by natural killer cells of N6‐isopentenyladenosine‐treated human glioma cell lines
Heise et al. The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2
CN112831469B (en) Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof
Liang et al. Enhancing the antitumor immunity of T cells by engineering the lipid-regulatory site of the TCR/CD3 complex
Xu et al. Xanthine oxidoreductase is required for genotoxic stress-induced NKG2D ligand expression and gemcitabine-mediated antitumor activity
Miyazaki et al. The liposome‐incorporating cell wall skeleton of Mycobacterium bovis bacillus Calmette‐Guéin can directly enhance the susceptibility of cancer cells to lymphokine‐activated killer cells through up‐regulation of natural‐killer group 2, member D ligands
Barzan et al. Overexpression of caveolin-1 in lymphoblastoid TK6 cells enhances proliferation after irradiation with clinically relevant doses
Pastorino et al. Targeted Delivery of Oncogene‐Selective Antisense Oligonucleotides in Neuroectodermal Tumors: Therapeutic Implications
EP4103198A1 (en) Therapy of ras-dependent cancers
Wang et al. Suppression of growth of pancreatic cancer cell and expression of vascular endothelial growth factor by gene silencing with RNA interference
US8722641B2 (en) Oligonucleotides which inhibit p53 induction in response to cellular stress
Xiang et al. Graded function of CD80 and CD86 in initiation of T‐cell immune response and cardiac allograft survival
Uziel et al. Conventional anticancer therapeutics and telomere maintenance mechanisms
US20190169620A1 (en) Treatment of HER2-Dependent Cancers by SORL1 Inhibition
Michels A high-throughput RNAi screening identifies olfactory receptor signaling as a novel immune checkpoint in solid tumors

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant