CN112831469A - Modulating the amount of CS in the microenvironment of T cells and uses thereof - Google Patents

Modulating the amount of CS in the microenvironment of T cells and uses thereof Download PDF

Info

Publication number
CN112831469A
CN112831469A CN201911164594.9A CN201911164594A CN112831469A CN 112831469 A CN112831469 A CN 112831469A CN 201911164594 A CN201911164594 A CN 201911164594A CN 112831469 A CN112831469 A CN 112831469A
Authority
CN
China
Prior art keywords
cell
cells
microenvironment
amount
sult2b1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201911164594.9A
Other languages
Chinese (zh)
Other versions
CN112831469B (en
Inventor
王�锋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University School of Medicine
Original Assignee
Shanghai Jiaotong University School of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University School of Medicine filed Critical Shanghai Jiaotong University School of Medicine
Priority to CN201911164594.9A priority Critical patent/CN112831469B/en
Publication of CN112831469A publication Critical patent/CN112831469A/en
Application granted granted Critical
Publication of CN112831469B publication Critical patent/CN112831469B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/02—Sulfotransferases (2.8.2)
    • C12Y208/02002—Alcohol sulfotransferase (2.8.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention provides a reagent for regulating the amount of membrane lipid in a microenvironment where T cells are located, and the reagent can be used for preparing a reagent for improving the activity of the T cells, increasing the number of the T cells, inhibiting the combination effect of CD3CD and cell membranes and controlling membrane Ca2+The titer, the production of GzmB, IFN gamma and TNF alpha or the application of the product for resisting tumor, wherein the regulation of the amount of membrane lipid in the microenvironment of T cells preferably reduces the amount of CS in the microenvironment of T cells, and further preferably reduces the amount of CS in the microenvironment of T cellsMost preferably, the Sult2b1 gene in the genome of the tumor cell surrounding the T cell is knocked out.

Description

Modulating the amount of CS in the microenvironment of T cells and uses thereof
Technical Field
The invention relates to the technical field of tumor immunity and genetic engineering, in particular to a method for preparing a reagent for regulating the amount of membrane lipid in a microenvironment where T cells are positioned, improving the activity of the T cells, increasing the number of the T cells, inhibiting the combination effect of CD3CD and cell membranes and controlling membrane Ca2+The titer, the enhancement of the generation of GzmB, IFN gamma and TNF alpha or the application in the anti-tumor products,the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is preferably reduced, more preferably reduced, and most preferably the knockdown of Sult2b1 gene in the tumor cell genome around the T cells.
Background
The TCR is a multi-subunit T cell surface membrane receptor, comprising antigen-recognizing heterodimers, i.e. TCR α β or TCR γ δ. The TCR forms a complex with CD3 involved in T cell signaling: (CD3 ε γ, CD3 ε δ, and CD3 ζ ζ ζ). When the TCR binds to a specific MHC-antigenic peptide complex, a transmembrane signal is triggered to cause phosphorylation of the Immunoreceptor Tyrosine Activation Sequences (ITAMs) of the intracellular CD3 subunit, which in turn, triggers a cascade of signal gradients including adaptor protein phosphorylation, formation of signaling complexes, intracellular calcium efflux, formation of immune synapses, cytokine secretion, and cell proliferation.
Since TCR signaling is critical for T cell activation and function, including T cell thymic selection and killing of viral infections and cancer cell development, it is critical to reveal the complex regulatory mechanisms of TCR signaling. Prior art data show that membrane lipids can modulate TCR signaling. Reference documents: cholesterol and sphingomyelin drive ligand-independent T-cell amplification (Molnar E, et al, J Biol Chem, 287, 42664-. Reference documents: the Inhibition of T cell receptor signaling by Cholesterol sulfate, a natural encapsulation derivative of membrane Cholesterol (Wang et al, Nat Immunol, 17, 844-850, 2016) discloses that Cholesterol Sulfate (CS) is a natural derivative of membrane Cholesterol, which can disrupt TCR aggregation, inhibit TCR signal transduction, and play an important regulatory role in thymus selection. Meanwhile, phosphatidic acid of lobule in cell membrane can affect charged CD3 epsilon/zeta by the interaction positively correlated with ionic interactionThe cytoplasmic domain (CD3CD) and induces conformational changes that, at rest, sequester the membrane bilayer membrane of key tyrosine residues, thereby preventing spontaneous TCR signaling. Under antigen stimulation, calcium ion flux can regulate the dissociation of CD3CD from the membrane, and further amplify the signal. However, it is not known whether CS can also regulate TCR signals by modulating conformational changes of CD3CD, in addition to inhibiting TCR clustering, nor is there any document disclosing the use of agents that regulate the amount of membrane lipids in the microenvironment of T cells in the preparation of agents that increase T cell activity, increase T cell number, inhibit the binding of CD3CD to cell membranes, and control membrane Ca2+Titer, enhancement of GzmB, IFN gamma, TNF alpha production or anti-tumor products.
Disclosure of Invention
To fill the gap in the prior art, the inventors creatively regulated the signal of TCR by regulating the content of membrane lipids in the microenvironment of T cells. Firstly, the inventor prepares a tumor cell with a Sult2b1 gene knocked out, wherein the tumor cell is a tumor cell around a T cell, and the content of membrane lipid in a microenvironment where the T cell is located is low after the Sult2b1 gene is knocked out. Experiments prove that the amount of membrane lipid in the microenvironment of the T cells is low, so that the activity of the T cells is higher, the proliferation quantity is more, the combination effect of CD3CD and the cell membrane is inhibited, and the membrane Ca is used2+The titer is controlled, the generation of GzmB, IFN gamma and TNF alpha is more, more importantly, the capability of killing tumor cells is strong, and the survival time of tumor patients is prolonged.
Specifically, the first aspect of the present invention provides the use of an agent which modulates the amount of membrane lipids in the microenvironment in which T cells are located, in the manufacture of a product selected from any one or a combination of any two or more of:
A) increasing T cell activity;
B) increasing the number of T cells;
C) inhibiting the binding of CD3CD to cell membrane;
D) control film Ca2+The titer;
E) enhancing the production of GzmB, IFN γ, TNF α; or
F) And (3) resisting tumors.
Wherein the membrane lipid comprises one or more of phosphatidylcholine (POPC), phosphatidylserine (POPS), Phosphatidylethanolamine (PE), Phosphatidylinositol (PI), Diphosphatidylglycerol (DPG), Sphingomyelin (SM), galactocerebroside, ganglioside, Cholesterol, or Cholesterol Sulfate (CS).
In one embodiment of the invention, the membrane lipid is cholesterol, and the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is an amount that increases the amount of cholesterol in the microenvironment in which the T cells are located.
In one embodiment of the invention, the membrane lipid is cholesterol sulfate, and the amount of the membrane lipid in the microenvironment in which the regulatory T cells are located is such as to reduce the amount of CS in the microenvironment in which the T cells are located. Preferably, the amount of CS is reduced to ≦ 30. mu.M. It is further preferred that the amount of CS is reduced to 20. mu.M or less.
In one embodiment of the invention, the membrane lipid is phosphatidylserine (POPS), and the modulating the amount of membrane lipid in the microenvironment of the T cell reduces the amount of POPS in the microenvironment of the T cell.
In a second aspect of the invention, there is provided the use of an agent which reduces the amount of CS in the microenvironment in which T cells are located, in the manufacture of a product selected from any one or a combination of any two or more of:
A) increasing T cell activity;
B) increasing the number of T cells;
C) inhibiting the binding of CD3CD to cell membrane;
D) control film Ca2+The titer;
E) enhancing the production of GzmB, IFN γ, TNF α; or
F) And (3) resisting tumors.
Preferably, the amount of CS is reduced to ≦ 30. mu.M. It is further preferred that the amount of CS is reduced to 20. mu.M or less.
Preferably, the reduction of the amount of CS in the microenvironment of the T cell may be achieved by reducing the amount of CS by a CS inhibitor or by knocking out genes of key enzymes in the synthesis of CS by genetic engineering means. Further preferably, the CS inhibitor comprises inhibition of a key enzyme of the CS synthetic pathway, such as Sult2b1, PASS1, PASS 2.
In a specific embodiment of the invention, the reduction of the amount of CS in the microenvironment of the T cell is the reduction of the amount of CS in the tumor microenvironment of the T cell, and the reduction of the amount of CS in the tumor microenvironment of the T cell is the knock-out of Sult2b1 gene in the tumor cell genome surrounding the T cell.
Preferably, the agent that reduces the amount of CS in the microenvironment of the T cell may be a CS inhibitor or an agent that comprises a knock-out of the Sult2b1 gene in the genome of the tumor cell surrounding the T cell.
In a specific embodiment of the invention, the Sult2b1 gene in the tumor cell genome surrounding the T cell is knocked out by designing a pair of guiding RNA sites knocked out by criprpr, knocking out the Sult2b1 gene in the tumor cell by using a criprpr knocking out method, and detecting and obtaining a Sult2b1 gene knocked out tumor cell line.
In a third aspect of the invention, there is provided use of an agent for knocking out the Sult2b1 gene in the genome of a tumor cell surrounding a T cell, in the manufacture of a product selected from any one or a combination of any two or more of:
a) reducing the amount of CS in the microenvironment of the T cells;
b) increasing T cell activity;
c) increasing the number of T cells;
d) inhibiting the binding of CD3CD to cell membrane;
e) control film Ca2+The titer;
f) enhancing the production of GzmB, IFN γ, TNF α; or
g) And (3) resisting tumors.
Preferably, the CD3CD is CD3 epsilon CD or CD3 zeta CD.
Preferably, the T cell is a Car-T cell or a TCR-T cell.
Preferably, the T cell is a CD8+ T cell.
In a fourth aspect of the invention, there is provided a method of reducing the amount of CS in the microenvironment of a T cell, said method comprising knocking out the Sult2b1 gene in the genome of a tumour cell surrounding the T cell. Preferably, the amount of CS in the microenvironment in which the T cells are located will be reduced to ≦ 30. mu.M. It is further preferred that the amount of CS in the microenvironment in which the T-cells are located is reduced to ≤ 20 μ M.
In the fifth aspect of the invention, the invention provides a method for improving the activity of T cells, increasing the number of T cells, inhibiting the combination of CD3CD and cell membranes and controlling the membrane Ca2+A method of titer, or enhancement of production of GzmB, IFN γ, TNF α, comprising modulating the amount of membrane lipids in the microenvironment of the T cell.
Preferably, the membrane lipid includes one or a combination of two or more of phosphatidylcholine (POPC), phosphatidylserine (POPS), Phosphatidylethanolamine (PE), Phosphatidylinositol (PI), Diphosphatidylglycerol (DPG), Sphingomyelin (SM), galactocerebroside, ganglioside, cholesterol, or cholesterol sulfate.
In one embodiment of the invention, the membrane lipid is cholesterol, and the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is an increase in the amount of cholesterol in the microenvironment in which the T cells are located.
In one embodiment of the invention, the membrane lipid is phosphatidylserine (POPS), and the modulating the amount of membrane lipid in the microenvironment of the T cell reduces the amount of POPS in the microenvironment of the T cell.
In one embodiment of the invention, the membrane lipid is Cholesterol Sulfate (CS), and the amount of membrane lipid in the microenvironment of the regulatory T cells is such that the amount of CS is reduced.
Preferably, the amount of CS is reduced to ≦ 30. mu.M. It is further preferred that the amount of CS is reduced to 20. mu.M or less.
Preferably, the CS-reducing amount can be reduced by using a CS inhibitor or knocking out a gene of a key enzyme in the synthesis of CS by genetic engineering means. Further preferably, the CS inhibitor comprises inhibition of a key enzyme in its synthetic pathway, such as Sult2b1, PASS1, PASS 2.
In a specific embodiment of the present invention, the gene of the key enzyme in the process of synthesizing CS is Sult2b1 gene. Namely, the amount of membrane lipid in the microenvironment in which the regulatory T cells are located is the amount of CS in the microenvironment in which the regulatory T cells are located, the amount of CS in the microenvironment in which the regulatory T cells are located is the amount of CS in the tumor microenvironment in which the regulatory T cells are located, and the amount of CS in the tumor microenvironment in which the regulatory T cells are located is the amount of knocking out Sult2b1 gene in the tumor cell genome around the T cells.
Preferably, the CD3CD is CD3 epsilon CD or CD3 zeta CD.
Preferably, the T cell is a Car-T cell or a TCR-T cell.
Preferably, the T cell is a CD8+ T cell.
The sixth aspect of the invention provides a tumor cell with a Sult2b1 gene knocked out, wherein the tumor cell is a tumor cell around a T cell, and the content of CS in a microenvironment where the T cell is located is low after the Sult2b1 gene is knocked out.
Preferably, the T cell is a Car-T cell or a TCR-T cell.
Preferably, the T cell is a CD8+ T cell.
The seventh aspect of the invention provides a construction method of the Sult2b1 gene knockout tumor cell, wherein a gene editing technology is used for constructing the Sult2b1 gene knockout tumor cell, and the gene editing technology comprises a DNA homologous recombination technology, a CRISPR/Cas9 technology, a zinc finger nuclease technology, a transcription activator-like effector nuclease technology or a homing endonuclease.
Preferably, the CRISPR/Cas9 technology is used for targeting and knocking out all or part of the Sult2b1 gene in the tumor cell genome, so that the Sult2b1 protein is not expressed or the expressed Sult2b1 protein has no function, and the content of CS in the cell membrane of the tumor cell, namely the content of CS in the microenvironment where the T cell is located, is reduced.
Further preferably, a plasmid DNA expressing Cas9 and sgRNA, a Cas9 protein or a sgRNA-Cas9 protein complex is introduced into the tumor cell to knock out all or part of the sequence of the Sult2b1 gene.
In an eighth aspect of the invention, there is provided a method of enhancing tumor immunity comprising reducing the CS content of the microenvironment in which the T cells are located. Preferably, the CS content of the microenvironment in which the T cells are located is reduced to less than or equal to 30. mu.M. Further preferably, the content of CS in the microenvironment where the T cells are located is reduced to less than or equal to 20 mu M.
In a ninth aspect of the invention, there is provided a method for enhancing tumor immunity, comprising knocking out the Sult2b1 gene in the genome of a tumor cell surrounding a T cell.
In a tenth aspect of the invention, there is provided a method of killing a tumour cell, comprising reducing the amount of CS in the microenvironment of the T cell. Preferably, the CS content of the microenvironment in which the T cells are located is reduced to less than or equal to 30. mu.M. Further preferably, the content of CS in the microenvironment where the T cells are located is reduced to less than or equal to 20 mu M.
In the eleventh aspect of the invention, a method for killing a tumor cell is provided, wherein the Sult2b1 gene in the tumor cell genome around the T cell is knocked out.
In a twelfth aspect of the invention, there is provided a method of prolonging survival of a patient having a tumour, comprising reducing the level of CS in the microenvironment of the T cells. Preferably, the CS content of the microenvironment in which the T cells are located is reduced to less than or equal to 30. mu.M. Further preferably, the content of CS in the microenvironment where the T cells are located is reduced to less than or equal to 20 mu M.
In a thirteenth aspect of the invention, a method for prolonging the survival time of a patient with a tumor is provided, wherein the Sult2b1 gene in the genome of the tumor cell surrounding the T cell is knocked out.
The "product" of the invention may be a medicament or kit comprising an agent which modulates the amount of membrane lipids in the microenvironment of the T cells. Preferably, the amount of membrane lipid in the microenvironment in which the T cells are regulated is such as to reduce the amount of CS in the microenvironment in which the T cells are located. More preferably, the reduction of the amount of CS in the microenvironment of the T cell is the reduction of the amount of CS in the tumor microenvironment of the T cell by knocking out the Sult2b1 gene in the tumor cell genome surrounding the T cell. In a specific embodiment of the invention, the agent for regulating the amount of membrane lipids in the microenvironment of the T cell is an agent for knocking out the Sult2b1 gene in the genome of a tumor cell surrounding the T cell.
The "T cell" of the invention includes but is not limited to CD8+ T, CD4+ T cell, CD25+ T cell and memory T cell. In one embodiment of the invention, the T cell is a CD8+ T cell. The TCR of the T cell is TCR α β or TCR γ δ. Preferably, the T cell is a Car-T cell. Further preferably, the Car-T cell includes, but is not limited to, CD133 Car-T, CD19 Car-T, CD20 Car-T, BMSA Car-T, MSLNCar-T, EGFRKII Car-T, Her2 Car-T, GD2 Car-T or CEA Car-T.
The invention relates to a method for inhibiting the binding effect of CD3CD and cell membranes, which changes the conformation of the secondary structure of CD3CD by reducing or increasing the amount of membrane lipid in the microenvironment of T cells, thereby inhibiting the binding effect of CD3CD and cell membranes. Preferably, decreasing or increasing the amount of membrane lipids in the microenvironment of the T cell is decreasing the amount of CS in the tumor microenvironment of the T cell.
The "control film Ca" of the present invention2+Titre "by decreasing or increasing the amount of membrane lipids in the microenvironment of the T cell, the conformation of the secondary structure of CD3CD is altered, thereby allowing Ca in the cell membrane2+The flux of (2) is controlled to control Ca2+Effect of titer.
"homology" as used herein means that in the context of using a protein sequence or a nucleotide sequence, one skilled in the art can adjust the sequence as needed to obtain a sequence having (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% homology.
The "tumor" according to the present invention is selected from lymphoma, non-small cell lung cancer, leukemia, ovarian cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia; said lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom's macroglobulinemia; the sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In one embodiment of the invention, the tumor is melanoma or colon cancer.
Drawings
Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:
FIG. 1A: jurkat cells were pretreated with CS at concentrations of 10. mu.M, 20. mu.M, and 30. mu.M, respectively, and the efficiency of quenching was evaluated by FRET method when CS interacted with CD 3. epsilon. CD, wherein the control group was Mock, the ordinate was the efficiency of quenching, the scale bar was 5. mu.m, and n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 1B: jurkat cells were pretreated with CS at concentrations of 10. mu.M, 20. mu.M, and 30. mu.M, respectively, and the fluorescence intensity values of mTFP (donor) after photobleaching treatment were evaluated by FRET method when CS interacted with CD3 ε CD, wherein the control group was Mock, the ordinate was the fluorescence intensity value of mTFP (donor) after photobleaching treatment, the scale bar was 5 μ M, n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 1C: the FRET method was used to evaluate the R18 (acceptor) fluorescence intensity values before photobleaching treatment when CS interacted with CD3 ∈ CD using CS pre-treated Jurkat cells at concentrations of 10 μ M, 20 μ M, and 30 μ M, respectively, wherein the control group was Mock, the ordinate was the R18 (acceptor) fluorescence intensity value before photobleaching treatment, the scale bar was 5 μ M, n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 1D: jurkat cells were pretreated with CS at concentrations of 10. mu.M, 20. mu.M, and 30. mu.M, respectively, and the light fading efficacy was evaluated by FRET method when CS interacted with CD 3. epsilon. CD, wherein the control group was Mock, the ordinate was the light fading efficacy, the scale bar was 5. mu.m, and n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 1E: the fluorescence intensity before and after photobleaching was compared with a standard scale of 5 μm when CS interacted with CD3 ε CD.
FIG. 2A: jurkat cells were pretreated with CS at concentrations of 10. mu.M, 20. mu.M, and 30. mu.M, respectively, and the FRET method was used to evaluate the quenching efficiency when CS interacted with CD3 ζ CD, wherein the control group was Mock, the ordinate was the quenching efficiency, the scale bar was 5 μ M, and n.s. was no significance,. about.. P <0.0001,. about.P < 0.01.
FIG. 2B: jurkat cells were pretreated with CS at concentrations of 10. mu.M, 20. mu.M, and 30. mu.M, respectively, and the fluorescence intensity of mTFP after photobleaching treatment was evaluated by FRET method when CS interacted with CD3 ζ CD, wherein the control group was Mock, the ordinate was the fluorescence intensity of mTFP after photobleaching treatment, the scale bar was 5 μ M, n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 2C: the FRET method was used to evaluate the R18 (acceptor) fluorescence intensity values before photobleaching treatment when CS interacted with CD3 ζ CD using CS pretreated Jurkat cells at concentrations of 10 μ M, 20 μ M, and 30 μ M, respectively, wherein the control group was Mock, the ordinate was the R18 (acceptor) fluorescence intensity value before photobleaching treatment, the scale bar was 5 μ M, n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 2D: jurkat cells were pretreated with CS at concentrations of 10. mu.M, 20. mu.M, and 30. mu.M, respectively, and the light fading efficacy was evaluated by FRET method when CS interacted with CD3 ζ CD, wherein the control group was Mock, the ordinate was the light fading efficacy, the scale bar was 5 μ M, and n.s. was no significance,. times.P <0.0001, and. times.P < 0.01.
FIG. 2E: the fluorescence intensity before and after photobleaching was compared with a standard scale of 5 μm when CS interacted with CD3 ζ CD.
FIG. 3: cells were pretreated with 30 μ M CS, and the efficiency of quenching upon interaction of CS with CD3 ζ CD was evaluated by FRET in a structure containing 3 amino acids between KIR2DL3 transmembrane domain and mTFP1, where control group was Mock, n.s. was no significance,. P <0.0001,. P < 0.01.
FIG. 4: the TFE (305nm) method measures CS or POPS binding to CD3 ∈ CD at 10%, 20%, or 30% concentration, where q is 0.8, q is the molar ratio of long-chain lipids (POPS, CS, and POPC) to short-chain lipids (DHPC), TFE values are calculated by the difference in fluorescence intensity of TFE spectra at 305nm for F (+ lipid) -F (-lipid), n.s. is insignificant, ± P <0.0001, ± P <0.01,/P < 0.05.
FIG. 5A: the TFE (305nm) method measures CS or POPS binding to CD3 ζ CD at 10%, 20%, or 30% concentration, where q is 0.8, q is the molar ratio of long chain lipids (POPS, CS, and POPC) to short chain lipids (DHPC), TFE values are calculated by the difference in fluorescence intensity of TFE spectra at 305nm for F (+ lipid) -F (-lipid), n.s. is insignificant, ± P <0.0001, × P < 0.01.
FIG. 5B: with Ca2+Increase in titer, TFE (305nm) curve after CS or POPS treatment of cells at 20% or 30% concentration, where q is 0.8, q is the molar ratio of long-chain lipids (POPS, CS and POPC) to short-chain lipids (DHPC), and TFE value is calculated by difference in fluorescence intensity of TFE spectra at 305nm for F (+ lipid) -F (-lipid).
FIG. 5C: rotunicin (5mM) Ca2+After the influx treatment, FRET quenching potency, where the ordinate is FRET quenching potency, the scale bar is 5 μm, n.s. is insignificant<0.0001，**P<0.01，*P<0.05。
FIG. 6A: circular dichroism chromatogram of secondary structure folding or folding condition of CD3 epsilon CD by 30% CS and 30% POPS, and POPC is phosphatidylcholine as positive control.
FIG. 6B: circular dichroism chromatogram of secondary structure folding or folding condition of CD3 epsilon CD by 20% CS and 20% POPS, and POPC is phosphatidylcholine as positive control.
FIG. 7A: ca of acid lipid after 20% CS-induced secondary structure change of CD3 ε CD2+The titration rate.
FIG. 7B: ca of acid lipid after 20% POPS-induced secondary structure change of CD3 ε CD2+The titration rate.
FIG. 7C: in Ca2+During titration, CD ε was observed after 20% CS and 20% POPS treatment of cellsCDThe TFE (305nm) graph of (a), wherein q is 0.8, q is the molar ratio of long-chain lipids (POPS, CS, and POPC) to short-chain lipids (DHPC), and the TFE value is calculated by the difference in fluorescence intensity of TFE spectra at 305nm for F (+ lipid) -F (-lipid).
FIG. 8A: ca of acid lipid after 30% CS-induced secondary structure change of CD3 ε CD2+The titration rate.
FIG. 8B: ca of acid lipid after 30% POPS-induced secondary structure change of CD3 ε CD2+The titration rate.
FIG. 9: after cells were treated with CS, CS +5mM renomycin, Mock control, and 5mM renomycin (induced calcium influx) controls, the quenching efficiency was evaluated by FRET, where the ordinate is the quenching efficiency, n.s. is no significance, P <0.0001, P < 0.01.
FIG. 10: different Ca2+At titer, 30% POPS or 30% CS was assayed to bind CD3 ε CD strongly and weakly, showing that with Ca2+The binding effect is weakened when the titer is increased, wherein the binding effect of CS and CD3 epsilon CD is stronger than that of POPS and CD3 epsilon CD.
FIG. 11A: method for 30% CS-induced CD3 ζ CDCa of acid lipid after secondary structure change2+Circular dichroism plot of titration rate.
FIG. 11B: ca of acid lipid after 30% POPS-induced secondary structure change of CD3 ζ CD2+Circular dichroism plot of titration rate.
FIG. 12: peak comparison of OT1 cell proliferation with cell proliferation after 2 days co-culture of Wild Type (WT) melanoma cells and melanoma cells with a knockout of Sult2b1 gene (Sult2b1-ko), respectively, with OVA expressing initial OT1T cells. OT1T cells were stained with cell tracer prior to co-culture in the ratio melanoma cells: t cells were 1: 8. .
FIG. 13A: compared with melanoma cells after the Sult2b1 gene (Sult2b1-ko) is knocked out, Sult2b1-ko produces more GzmB, IFN gamma and TNF alpha by Wild Type (WT) melanoma cells, wherein the co-culture ratio of the melanoma cells is: t cells were 1:2, with a 3 day co-culture time.
FIG. 13B: comparative results of the amounts of GzmB, IFN γ, TNF α produced after 3 days co-culture of wild-type (WT) melanoma cells and melanoma cells with a knockout of Sult2b1 gene (Sult2b1-ko) with OVA-expressing initial OT1T cells, respectively, are shown, wherein the co-culture ratio is that of melanoma cells: t cells are no significance 1:2, n.s. P <0.0001, P < 0.01.
FIG. 13C: cell death rates of wild-type (WT) melanoma cells and melanoma cells after knockout of Sult2b1 gene (Sult2b1-ko) were compared with the cell death rates of the OVA-expressing initial OT1T cells after 3 days of co-culture, wherein the co-culture ratio is that of the melanoma cells: t cells are no significance 1:2, n.s. P <0.0001, P < 0.01.
FIG. 13D: melanoma cells after wild-type (WT) and knockout of Sult2b1 gene (Sult2b1-ko) were compared to the number of surviving OT1T cells harvested after 3 days of OVA expressing initial OT1T cells, respectively, wherein the co-culture ratio was melanoma cells: t cells are no significance 1:2, n.s. P <0.0001, P < 0.01.
FIG. 13E: peak comparison of OT1 cell proliferation with cell proliferation after 3 days co-culture of Wild Type (WT) melanoma cells and melanoma cells after knock-out of Sult2b1 gene (Sult2b1-ko), respectively, with OVA-expressing initial OT1T cells. OT1T cells were stained with cell tracer prior to co-culture in the ratio melanoma cells: t cells were 1: 2.
FIG. 13F: the MFI values of wild-type (WT) melanoma cells and melanoma cells after knock-out of Sult2b1 gene (Sult2b1-ko) were compared with the MFI values of OVA-expressing primary OT1T cells after 3 days of co-culture, wherein the co-culture ratio is that of melanoma cells: t cells are no significance 1:2, n.s. P <0.0001, P < 0.01.
FIG. 14A: the melanoma cells after Wild Type (WT) melanoma cells and the Sult2b1 gene (Sult2b1-ko) knock-out are cultured for 40h respectively in a mode of 3:1 (melanoma cells: T cells) and 2:1 (melanoma cells: T cells) and OVA-expressing pre-activated OT1T cells, and the cell death rate is compared.
FIG. 14B: melanoma cells after Wild Type (WT) melanoma cells and knockout of Sult2b1 gene (Sult2b1-ko) were co-cultured with OVA expressing pre-activated OT1T cells at 3:1 (melanoma cells: T cells) and 2:1 (melanoma cells: T cells), respectively, and cell killing rates were comparable, n.s. was not significant, P <0.0001, P < 0.01.
FIG. 14C: when melanoma cells after wild-type (WT) melanoma cells and knockout of Sult2b1 gene (Sult2b1-ko) were co-cultured with OVA-expressing preactivated OT1T cells at 3:1 (melanoma cells: T cells) and 2:1 (melanoma cells: T cells), respectively, OT1 cells/one thousand melanoma cells were not significant, n.s.. P <0.0001,. P < 0.01.
FIG. 15A: tumor volume size comparison of Wild Type (WT) melanoma cells and melanoma cells after knock-out of the Sult2b1 gene (Sult2b 1-ko).
FIG. 15B: the melanoma cells after injecting melanoma cells (WT) or knocking out Sult2b1 gene (Sult2b1-ko) into mice respectively change the tumor volume along with the increase of days after injection, wherein the tumor volume is mm3Ordinate is tumor volume, abscissa is days after injection, n.s. is no significance<0.0001，**P<0.01。
FIG. 15C: tumor weight in wild-type (WT) melanoma cells compared to melanoma cells after deletion of Sult2b1 gene (Sult2b1-ko), where the ordinate is tumor weight (mg), n.s. is no significance, P <0.0001, P <0.01, P < 0.05.
FIG. 15D: the number of CD8+ T cells per mg of tumor was n.s. insignificant compared to melanoma cells after deletion of the Sult2b1 gene (Sult2b1-ko) in Wild Type (WT) melanoma cells and after deletion of P <0.0001, > P <0.01, > P < 0.05.
FIG. 15E: the percentage of PD-1 expression in CD8+ T cells, n.s., was insignificant in wild-type (WT) melanoma cells versus melanoma cells after deletion of the Sult2b1 gene (Sult2b1-ko), P <0.0001, P < 0.01.
FIG. 16: comparison of survival time for melanoma patients with low Sult2b1 protein compared to melanoma patients with high Sult2b1 protein, where the ordinate is survival value.
FIG. 17: the influence on the growth of melanoma cells after knocking out the Sult2b1 gene.
FIG. 18: effect on CS content in melanoma cells after knock-out of Sult2b1 gene, wherein n.s. is not significant<0.0001，**P<0.01，*P<0.05, and the ordinate in FIG. 18B shows the area containing CS (. times.10)4)。
FIG. 19: wild-type (WT) melanoma cells produced more GzmB, IFN γ, TNF α in Sult2B1-ko than melanoma cells after knockout of Sult2B1 gene (Sult2B1-ko), where fig. 19A is a bar graph and fig. 19B is a flow cytogram, where the co-culture ratio is melanoma cells: t cells were 1:8 with a co-culture time of 2 days.
FIG. 20: melanoma cells after Wild Type (WT) melanoma cells and knockout of Sult2b1 gene (Sult2b1-ko) were co-cultured for 2 days with OVA expressing primary OT1T cells, respectively, and the MFI values were compared, where the co-culture ratio was melanoma cells: t cells are no significance 1:8, n.s. P <0.0001, P < 0.01.
FIG. 21: cell killing comparisons were examined for melanoma cells after wild-type (WT) melanoma cells and knockout of Sult2b1 gene (Sult2b1-ko) co-cultured for 3 days with 8:1 (melanoma cells: T cells), 4:1 (melanoma cells: T cells) and OVA-expressing preactivated OT1T cells, respectively, where the ordinate is percent (%) cell killing, n.s. is insignificant,. P <0.0001,. P < 0.01.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 preparation of Sult2b1 Gene knockout T cells
Three guide RNA (GATGCTCTCGAGCGAGTAC (SEQ ID NO: 1), GTCGTCGTCCCGCACATCT (SEQ ID NO: 2) and GATCCGCTCCGTGCCCATC (SEQ ID NO: 3)) oligomeric sequences positioned in Sult2b1 gene are respectively constructed on a pHAGE-crispr-zsgreen vector, then the constructed vector and packaging plasmids (PMD2 and PSPX2) are transferred into 293FT cells to obtain lentiviruses, T cells (Jukrart T cells) are infected, and Sult2b1 gene knockout T cell clones are sorted and cultured.
Example 2 CS alteration of CD3CD conformation
To determine whether CS interacts with CD3CD and changes its conformation, fluorescence-based resonance energy transfer (I) was used
Figure BDA0002287080930000141
resonance energy transfer, FRET). Specifically, monomeric blue-green fluorescent protein (mTFP1) was linked to the C-terminus of CD3CD as a donor for FRET, fused to the extracellular/TM domain of KIR2DL3 protein, and stained with the red fluorescent dye octadecyl rhodamine B (R18) as an acceptor for FRET.
Since phosphatidic acid is contained on the lipid membrane leaflet, CD3CD is bound to the Plasma Membrane (PM). The interaction of CS with CD3CD was determined by pre-treating cells with different molar concentrations of CS (10. mu.M, 20. mu.M, 30. mu.M).
The results showed that the FRET value gradually increased as the molar amount of CS of the pretreated cells increased, wherein the results of the interaction of CS with CD3 ε CD are shown in FIGS. 1A-E, and the results of the interaction of CS with CD3 ζ CD are shown in FIGS. 2A-E, and that the interaction of CS with CD3 ε CD significantly increased when the cells were pretreated at a CS amount of 20 μ M or more, and that the interaction of CS with CD3 ζ CD significantly increased when the cells were pretreated at a CS amount of 30 μ M or more. However, in a control structure containing 3 amino acids between KIR2DL3 transmembrane domain and mTFP1, CS treatment did not change FRET values (see fig. 3). Taken together, CS can significantly enhance the binding of CD3 ∈ CD or CD3 ζ CD to membranes, thereby preventing TCR signaling.
This example further contrasts the binding of CS, POPS to CD3 ∈ CD or CD3 ζ CD to membranes and determines the interaction of CD3CD with CS, POPS by Tyrosine Fluorescence Emission (TFE) in vitro assays.
TFE specific steps:
the TFE experiments were performed on a Varian Cary Eclipse machine with excitation light set at 275nm and emission light set at between 290 and 340 nm. Reaction conditions for sample measurement: 2mM CD3CD protein, 0.3-0.8mM bilayer membrane vesicles bicells (q ═ 0.8, 10-30% POPS, 10-30% CS), and 10mM Tri-HCl (ph 7.4). The measurement process comprises the following steps: the increased TFE value was calculated by measuring the TFE value for proteins without the presence of the bilayer membrane vesicles and the background value for the bilayer membrane vesicles themselves, and then measuring the TFE value added to the bilayer membrane vesicles. If calcium titration is performed, the amount of calcium is increased and the change in TFE value is measured.
The results show that CS has a stronger effect than POPS in interacting with CD3CD (see fig. 4, 5A, 5B, 5C). Also, this interaction was evident for the conformational change of CD3 ∈ CD, and fig. 6A, B shows that 30% and 20% of CS each contribute to more secondary structure of CD3 ∈ CD wrinkles. Meanwhile, the secondary structure change of CD3 epsilon CD caused by CS is different from that of POPS, and the calcium titer is still kept within a certain range after the secondary structure change of CD3 epsilon CD caused by CS (see figure 7A, B, C and figure 8A, B). TFE result shows that Ca2+From only CS bilayer membrane vesiclesTyrosine partially exposing CD3 epsilon CD, because of the different content of CS in the bilayer membrane vesicle, TFE value is maintained at a stable high Ca2+Concentration levels (fig. 9, 10).
Meanwhile, FRET results also confirmed that when cells were pretreated with CS, even though treatment of CD3 ∈ CD with renomycin induced influx of calcium ions, it was still within high bounds of cell membrane (see fig. 9). Interaction of CD3 epsilon CD and CS reduces Ca on cell membranes2+The sensitivity of (2). However, for CD3 ζ CD, Ca2+Continuous titration of TFE values of (1) gradually decrease, Ca2+The value is not high and the secondary structure disappears soon (see figure 11A, B).
Example 3 Effect of CS on tumors
Preparation of melanoma model and melanoma model with Sult2b1 gene knocked out
The OVA gene is transferred into a murine melanoma B16-F10 cell line to obtain a B16-OVA cell line.
Respectively constructing an oligomeric sequence of two guide RNAs (TTATGATGGTCTCGCACCA (SEQ ID NO: 4) and GGTGCGAGACCATCATAAGC (SEQ ID NO: 5)) positioned in a Sult2B1 gene onto a pHAGE-criispr-zsgreen vector, then transferring the constructed vector and packaging plasmids (PMD2 and PSPX2) into 293FT cells to obtain lentiviruses, infecting melanoma cells B16-OVA, sorting and culturing Sult2B1 gene knockout B16-OVA monoclonal cells, detecting the Sult2B1 gene knockout condition of the monoclonal cells by PCR, and simultaneously detecting whether the CS content in the monoclonal cells is reduced by mass spectrometry. Secondly, verifying the growth condition of melanoma cells after knocking out Sult2b1 gene
The results show that the growth of melanoma cells (Sult2B1-ko B16F10 cells) with the Sult2B1 gene knocked out is basically consistent with that of melanoma cells without the Sult2B1 gene knocked out, i.e. the Sult2B1 gene knocked out does not affect the growth of cells (see FIG. 12), and has no effect on inducing TCR colonization in vitro (see FIG. 17, FIG. 18A and FIG. 18B).
Experiment for verifying effect of melanoma cells after knockout of Sult2b1 gene
Sult2B1-koB16F10 cells produced more GzmB, IFN γ, TNF α and showed more effects of proliferation and killing of tumor cells when OVA-expressing Sult2B1-ko B16F10 cells and naive OT1T cells were co-cultured (see FIGS. 19A, B, 13A, B, C, D, E, F, FIG. 20). Meanwhile, pre-activated T cells showed stronger killing effect of Sult2B1-ko B16F10 cells than before knocking out Sult2B1 gene at different ratios of B16 to T cells (see fig. 14A, B, C, fig. 21).
Third, detecting the tumor killing effect
Mice with small tumor volumes and weights and low CS content of Sult2B1-ko B16F10 melanoma showed increased cell numbers and increased activity when analyzed for tumor infiltrating CD8+ T cells (see fig. 15). Meanwhile, studies have shown that melanoma patients expressing lower Sult2b1 survive longer (see fig. 16). That is, decreasing the CS on the cell membrane surface in the tumor environment increases the activity of tumor infiltrating CD8+ T cells.
The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are within the protective scope of the present invention.
It should be noted that the various technical features described in the above embodiments can be combined in any suitable manner without contradiction, and the invention is not described in any way for the possible combinations in order to avoid unnecessary repetition.
Sequence listing
<110> Shanghai college of medicine of transportation university
<120> modulation of the amount of CS in the microenvironment of T cells and uses thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gatgctctcg agcgagtac 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcgtcgtcc cgcacatct 19
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gatccgctcc gtgcccatc 19
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttatgatggt ctcgcacca 19
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggtgcgagac catcataagc 20

Claims (10)

1. Use of an agent that modulates the amount of membrane lipids in the microenvironment of T cells in the manufacture of a product selected from any one or a combination of any two or more of:
A) increasing T cell activity;
B) increasing the number of T cells;
C) inhibiting the binding of CD3CD to cell membrane;
D) control film Ca2+The titer;
E) enhancing the production of GzmB, IFN γ, TNF α; or
F) And (3) resisting tumors.
2. The use of claim 1, wherein the membrane lipid comprises one or a combination of more than two of phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, diphosphatidylglycerol, sphingomyelin, galactocerebroside, ganglioside, cholesterol, or cholesterol sulfate.
3. Use of an agent which reduces the amount of CS in the microenvironment of a T cell in the manufacture of a product selected from any one or a combination of any two or more of:
A) increasing T cell activity;
B) increasing the number of T cells;
C) inhibiting the binding of CD3CD to cell membrane;
D) control film Ca2+The titer;
E) enhancing the production of GzmB, IFN γ, TNF α; or
F) And (3) resisting tumors.
4. The use of claim 3, wherein the agent that reduces the amount of CS in the microenvironment of the T cell is an agent that reduces the amount of CS in the tumor microenvironment of the T cell, wherein the agent that reduces the amount of CS in the tumor microenvironment of the T cell is a knock-out of the Sult2b1 gene in the genome of the tumor cell surrounding the T cell, and wherein the agent that reduces the amount of CS in the microenvironment of the T cell comprises an agent that knocks out of the Sult2b1 gene in the genome of the tumor cell surrounding the T cell.
5. Use of an agent for knocking out the Sult2b1 gene in the genome of a tumor cell surrounding a T cell in the manufacture of a product, wherein the product is selected from any one or a combination of any two or more of:
a) reducing the amount of CS in the microenvironment of the T cells;
b) increasing T cell activity;
c) increasing the number of T cells;
d) inhibiting the binding of CD3CD to cell membrane;
e) control film Ca2+The titer;
f) enhancing the production of GzmB, IFN γ, TNF α; or
g) And (3) resisting tumors.
6. The use of any one of claims 1-5, wherein said CD3CD is CD3 ε CD or CD3 ζ CD.
7. A Ca-controlling membrane for increasing the activity and number of T cells, inhibiting the binding of CD3CD to cell membrane2+A method of titer, or enhancement of production of GzmB, IFN γ, TNF α, comprising modulating the amount of membrane lipids in the microenvironment of the T cell.
8. The method of claim 7, wherein modulating the amount of membrane lipids in the microenvironment of the T cell reduces the amount of CS in the microenvironment of the T cell, wherein reducing the amount of CS in the tumor microenvironment of the T cell reduces the amount of CS in the tumor microenvironment of the T cell, and wherein reducing the amount of CS in the tumor microenvironment of the T cell knockdown a Sult2b1 gene in the genome of the tumor cell surrounding the T cell.
9. A tumor cell with a Sult2b1 gene knockout function is a tumor cell around a T cell, and the content of CS in a microenvironment where the T cell is located is low after the Sult2b1 gene knockout function.
10. A method for constructing a Sult2b1 gene knockout tumor cell of claim 9, wherein the Sult2b1 gene knockout tumor cell is constructed by using gene editing technology, wherein the gene editing technology comprises DNA homologous recombination technology, CRISPR/Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology or homing endonuclease.
CN201911164594.9A 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof Active CN112831469B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911164594.9A CN112831469B (en) 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911164594.9A CN112831469B (en) 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof

Publications (2)

Publication Number Publication Date
CN112831469A true CN112831469A (en) 2021-05-25
CN112831469B CN112831469B (en) 2024-04-19

Family

ID=75922813

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911164594.9A Active CN112831469B (en) 2019-11-25 2019-11-25 Modulating the amount of CS in the microenvironment in which T cells are located and uses thereof

Country Status (1)

Country Link
CN (1) CN112831469B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106955353A (en) * 2016-01-11 2017-07-18 中国科学院上海生命科学研究院 Acyl-CoA：The new application of cholesterol acyltransferase ACAT1 inhibitor
CN108392633A (en) * 2017-12-28 2018-08-14 中国人民解放军第二军医大学东方肝胆外科医院 Application of the PCSK9 inhibitor in malignant tumour immunization therapy

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106955353A (en) * 2016-01-11 2017-07-18 中国科学院上海生命科学研究院 Acyl-CoA：The new application of cholesterol acyltransferase ACAT1 inhibitor
CN108392633A (en) * 2017-12-28 2018-08-14 中国人民解放军第二军医大学东方肝胆外科医院 Application of the PCSK9 inhibitor in malignant tumour immunization therapy

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
WENTING HONG ET AL.: "Hydroxysteroid sulfotransferase 2B1 affects gastric epithelial function and carcinogenesis induced by a carcinogenic agent", 《LIPIDS IN HEALTH AND DISEASE》, vol. 18, pages 2 *
蒋悦庭等: "硫酸胆固醇的生理功能及其在相关疾病中的作用", 《上海交通大学学报（医学版）》, vol. 43, no. 3, pages 371 - 375 *

Also Published As

Publication number Publication date
CN112831469B (en) 2024-04-19

Similar Documents

Publication Publication Date Title
Riese et al. Enhanced effector responses in activated CD8+ T cells deficient in diacylglycerol kinases
Lanzardo et al. Immunotargeting of antigen xCT attenuates stem-like cell behavior and metastatic progression in breast cancer
CN105177031B (en) T cell of Chimeric antigen receptor modification and application thereof
CN110381963A (en) It is related to the immunotherapy method and composition of tryptophan metabolic pathway regulator
Elhassan et al. Homo sapiens systemic RNA interference-defective-1 transmembrane family member 1 (SIDT1) protein mediates contact-dependent small RNA transfer and microRNA-21-driven chemoresistance
Li et al. High-performance multiplex drug-gated CAR circuits
AU2019203170A1 (en) Comprehensive monoclonal antibody generation
US20240093200A1 (en) Compositions and methods for improving immune system function
Zarling et al. MHC-restricted phosphopeptides from insulin receptor substrate-2 and CDC25b offer broad-based immunotherapeutic agents for cancer
WO2017160717A2 (en) Method of treating diseases using kinase modulators
Yoshida et al. VEGF-A/NRP1 stimulates GIPC1 and Syx complex formation to promote RhoA activation and proliferation in skin cancer cells
Beyer et al. Nucleolar trafficking of the mouse mammary tumor virus gag protein induced by interaction with ribosomal protein L9
US8586553B2 (en) Therapies for cancer using RLIP76
Vauchy et al. CD20 alternative splicing isoform generates immunogenic CD 4 helper T epitopes
Hara et al. Anti‐tumor effects of an antagonistic mAb against the ASCT2 amino acid transporter on KRAS‐mutated human colorectal cancer cells
BR112021007360A2 (en) methods for activating/proliferating t cells, for delivering a nucleic acid to t cells and for producing a drug, t cell, drug, cell culture, composition, and kit for delivering a nucleic acid to t cells
Sun et al. T-cell receptor gene therapy targeting melanoma-associated antigen-A4 by silencing of endogenous TCR inhibits tumor growth in mice and human
Ma et al. EGFRvIII-specific CAR-T cells produced by piggyBac transposon exhibit efficient growth suppression against hepatocellular carcinoma
Hussein et al. GPI-AP: unraveling a new class of malignancy mediators and potential immunotherapy targets
Liang et al. Enhancing the antitumor immunity of T cells by engineering the lipid-regulatory site of the TCR/CD3 complex
van Elsas et al. Invasive margin tissue-resident macrophages of high CD163 expression impede responses to T cell-based immunotherapy
EP3377086A1 (en) Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity
CN112831469A (en) Modulating the amount of CS in the microenvironment of T cells and uses thereof
Li et al. TNFR2 deficiency impairs the growth of mouse colon cancer
Kuroda et al. Identification of ribosomal protein L19 as a novel tumor antigen recognized by autologous cytotoxic T lymphocytes in lung adenocarcinoma

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant