CN112813072A

CN112813072A - Application of annexin gene in plant water stress

Info

Publication number: CN112813072A
Application number: CN202110145639.9A
Authority: CN
Inventors: 刘婷; 蒋红军; 李秋石; 李宁; 刘安琪
Original assignee: Institute Of Geography Hebei Academy Of Sciences; Hebei Normal University
Current assignee: Institute Of Geography Hebei Academy Of Sciences; Hebei Normal University
Priority date: 2021-02-02
Filing date: 2021-02-02
Publication date: 2021-05-18

Abstract

The invention discloses application of an annexin gene in plant water stress, researches the effect of the annexin gene in plant water stress, and provides a basis for further researching the effect of the annexin gene.

Description

Application of annexin gene in plant water stress

Technical Field

The invention relates to the technical field of bioengineering, in particular to application of an annexin gene in plant water stress.

Background

Annexin, the english name Annexin, a class of multifunctional calcium-dependent phospholipid binding proteins, is named Annexin (Annexin) because the spatial structure of Annexin can be significantly changed after the Annexin is combined with calcium ions, so that cytoplasmic soluble protein is converted into membrane-bound protein, and the Annexin can be used as a receptor to sense an early calcium signal of an environmental signal transduction pathway and can trigger the generation of a downstream specific calcium signal.

Researches find that some annexins Annexin participate in the stress resistance process of plants, but no clear literature and related reports in the prior art clearly show that the expression of the Annexin brings about the phenotypic improvement of the plants; it is unknown how the protein can induce the expression of calcium signals in plants and further induce the expression of downstream stress-resistant genes in the process of participating in plant stress.

Therefore, how to improve the stress resistance of plants by utilizing the stress resistance of annexin is a problem to be solved urgently by the technical personnel in the field.

Disclosure of Invention

In view of the above, the invention provides an application of an annexin gene in plant water stress, researches the effect of the annexin gene AtAnn1 in plant water stress, and provides a basis for further researching the effect of the annexin gene AtAnn 1.

In order to achieve the purpose, the invention adopts the following technical scheme:

an application of an annexin gene in plant water stress, wherein the annexin gene is AtAnn1, and a CDS sequence is shown in SEQ ID No. 1.

As a preferred technical scheme of the invention, the annexin gene can promote the germination of seeds under water stress.

As a preferred technical scheme of the invention, under the water stress, the annexin gene can promote the green turning of seedlings.

As a preferred technical scheme of the invention, under the condition of water stress, the annexin gene can promote the growth of the overground part of the seedling

According to the technical scheme, compared with the prior art, the invention discloses and provides the application of the annexin gene in the water stress of plants.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a schematic diagram of the gene of AtAnn1 provided by the present invention;

FIG. 2 is a diagram showing the amplification results of homozygous Atann1 mutant and wild type Col-0 provided by the present invention; wherein M is DNA Marker, 1 is wild type Col-0, 2 is mutant Atann1, 3 is recovery strain Atann N1/Atann1, and 4 is H₂O。

FIG. 3 is a graph showing the results of amplification of strains Col-0, Atann1 and Atann1/Atann1 according to the present invention;

FIG. 4 is a graph showing the results of germination of seeds under water stress with AtAnn1, wherein A is the results of germination rates of Col-0, AtAnn1 and AtANN1/AtANn1 strains under non-treatment conditions; b is a germination rate result graph of Col-0, Atann1 and Atann1/Atann1 lines after 2 days of treatment with 100mM mannitol; c is a germination rate result graph of Col-0, Atann1 and Atann1/Atann1 strains after 1 day, 2 days, 3 days, 4 days, 5 days of 200mM mannitol treatment; d is a germination rate result graph of Col-0, Atann1 and Atann1/Atann1 strains after 1 day, 2 days, 3 days, 4 days, 5 days of 300mM mannitol treatment; e is a germination rate result graph of Col-0, Atann1 and Atann1/Atann1 strains after 1 day, 2 days, 3 days, 4 days, 5 days of 400mM mannitol treatment; f is a germination rate result graph of Col-0, Atann1 and Atann1/Atann1 strains after 1 day, 2 days, 3 days, 4 days, 5 days of 500mM mannitol treatment; g is. 200. Germination rate results plots for Col-0, Atann1 and Atann1/Atann1 lines after 3 days of 300, 400, 500mM mannitol treatment; h is the germination profile obtained by dividing the germination results of Col-0, Atann1 and Atann N1/Atann1 strains by the control group data after 3 days of treatment with 300mM mannitol;

FIG. 5 is a graph showing the greening results of seedlings with AtAnn1 participating in water stress, wherein A is a graph showing the greening results of Col-0, AtAnn1 and AtANN1/AtANn1 strains under non-treatment conditions; b is a graph showing the greening rate of seedlings of Col-0, Atann1 and Atann1/Atann1 lines after 1 day, 2 days, 3 days, 4 days and 5 days of treatment with 100mM mannitol; c is a graph showing the greening rate of seedlings of Col-0, Atann1 and Atann1/Atann1 lines after 1 day, 2 days, 3 days, 4 days and 5 days of 200mM mannitol treatment; d is a graph showing the greening rate of seedlings of Col-0, Atann1 and Atann1/Atann1 lines after 1 day, 2 days, 3 days, 4 days and 5 days of 300mM mannitol treatment; e is a graph showing the greening rate of seedlings of Col-0, Atann1 and Atann1/Atann1 lines after 1 day, 2 days, 3 days, 4 days and 5 days of 400mM mannitol treatment; f is a graph showing the greening rate of seedlings of Col-0, Atann1 and Atann1/Atann1 lines after 1 day, 2 days, 3 days, 4 days and 5 days of 500mM mannitol treatment; g is a result graph of the greening rate of seedlings of Col-0, Atann1 and Atann1/Atann1 lines after treatment of 100mM mannitol for 4 days; h is a graph of the results of the greening rate of seedlings of Col-0, Atann1 and Atann N1/Atann1 lines divided by the greening rate of seedlings of Col-0, Atann1 and Atann N1/Atann1 lines of the control group after 4 days of 200mM mannitol treatment;

FIG. 6 is a graph showing the aerial growth regulation of seedlings under water stress by AtAnn1, wherein A is the area of the green cotyledon of the seedlings after 0, 100, 200, 300, 400, 500mM mannitol treatment of Col-0, Atann1 and Atann1/Atann1 lines; b is a graph of the results of the area of the green cotyledon of seedlings after 200mM mannitol treatment of lines Col-0, Atann1 and Atann1/Atann 1.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the examples, Arabidopsis wild type (Col-0), Annexin protein gene function deletion mutant Atann1 and its restorer line Atann N1/Atann1 were used as materials, wherein Arabidopsis Atann1 deletion mutant material (SALK _015426) was purchased from Arabidopsis Biological Resource Center (ABRC), an Arabidopsis mutant library, Atann1 gene was successfully cloned, and Atann1 deletion mutant was transformed to construct the restorer line Atann N1/Atann 1; the water stress is treated, and the effect of the AtAnn1 gene in the water stress tolerance of the seedling is preliminarily determined by detecting the germination rate and the green-turning rate of the seeds, the green cotyledon area of the seedling, the main root length, the lateral root number, the average length and other growth and development indexes.

Example 1

Identification of materials used in the experiments

Gene pattern of AtAnn1

The AtAnn1 gene consisted of 3 exons and 2 introns, and the AtAnn1(salk _015426) mutant T-DNA was inserted at base 1192 on exon 3 (FIG. 1). Triangles indicate T-DNA insertion sites, black boxes indicate exons, gray lines indicate introns, and black lines indicate 3 'and 5' non-coding regions.

The CDS sequence of AtAnn1 gene is:

ATGGCGACTCTTAAGGTTTCTGATTCTGTTCCTGCTCCTTCTGATGATGCTGAGCAATTGAGAACCGCTTTTGAAGGATGGGGTACGAACGAGGACTTGATCATATCAATCTTGGCTCACAGAAGTGCTGAACAGAGGAAAGTCATCAGGCAAGCATACCACGAAACCTACGGCGAAGACCTTCTCAAGACTCTTGACAAGGAGCTCTCTAACGATTTCGAGAGAGCTATCTTGTTGTGGACTCTTGAACCCGGTGAGCGTGATGCTTTATTGGCTAATGAAGCTACAAAAAGATGGACTTCAAGCAACCAAGTTCTTATGGAAGTTGCTTGCACAAGGACATCAACGCAGCTGCTTCACGCTAGGCAAGCTTACCATGCTCGCTACAAGAAGTCTCTTGAAGAGGACGTTGCTCACCACACTACCGGTGACTTCAGAAAGCTTTTGGTTTCTCTTGTTACCTCATACAGGTACGAAGGAGATGAAGTGAACATGACATTGGCTAAGCAAGAAGCTAAGCTGGTCCATGAGAAAATCAAGGACAAGCACTACAATGATGAGGATGTTATTAGAATCTTGTCCACAAGAAGCAAAGCTCAGATCAATGCTACTTTTAACCGTTACCAAGATGATCATGGCGAGGAAATTCTCAAGAGTCTTGAGGAAGGAGATGATGATGACAAGTTCCTTGCACTTTTGAGGTCAACCATTCAGTGCTTGACAAGACCAGAGCTTTACTTTGTCGATGTTCTTCGTTCAGCAATCAACAAAACTGGAACTGATGAAGGAGCACTCACTAGAATTGTGACCACAAGAGCTGAGATTGACTTGAAGGTCATTGGAGAGGAGTACCAGCGCAGGAACAGCATTCCTTTGGAGAAAGCTATTACCAAAGACACTCGTGGAGATTACGAGAAGATGCTCGTCGCACTTCTCGGTGAAGATGATGCTTAA, as shown in SEQ ID NO. 1;

the gene mutant comprises the following components: SALK _ 015426;

identification of homozygous mutants of Atann1

Identification of Atann1 DNA levels

In homozygous Atann1, no band was amplified with primers LP and RP, whereas a 0.8Kb fragment was amplified with primers LBb1.3 and RP for T-DNA insertion, and a 1.2Kb fragment for Atann1 was amplified with primers LP and RP in wild-type Col-0 (FIG. 2); the PCR identification result shows that Atann1 is a homozygous mutant.

Table 1 identification of T-DNA insertion homozygous mutant of AtAnn1 Gene the primer sequences used were as follows:

identification of the Atann1 RNA levels

The template used in the experiment is obtained by extracting RNA from the whole seedling cultured in a light incubator for 10 days after sowing. The reaction system for PCR was 20. mu.L, ACTIN as reference was amplified for 25 cycles, and AtAnn1 was amplified for 30 cycles.

The ACTIN bands of Col-0, Atann1 and AtANN1/Atann1 are clearly identical, but AtAnn1 gene transcripts are present in Col-0 and the recovery line AtANN1/Atann1, and AtAnn1 gene transcripts are absent in the AtANn1 mutant (FIG. 3), which indicates that AtAnn1 gene in the AtANn1 mutant is knocked out due to the insertion of T-DNA, and the identified AtANn1 mutant is a homozygous mutant at the RNA level.

Table 2 identification of Atann1 gene transcripts the primer sequences used were as follows:

example 2 Effect of AtAnn1 on the tolerance of seedlings to Water stress

To investigate whether the AtAnn1 gene plays a role in the process of seedling tolerance to water stress. We performed 0, 100, 200, 300, 400, 500mM mannitol treatment on three materials of Col-0, Atann1 and Atann1/Atann1, and examined the germination rate, the greening rate and the area of green cotyledon of seedlings, the process and the results are as follows:

AtAnn1 participates in the germination process of seeds under water stress

The germination rate of the seeds after the mannitol treatment is obviously reduced, and the time for reaching the maximum germination rate is also obviously prolonged, and the trend is gradually increased along with the increase of the concentration of the mannitol. Under non-treated conditions, germination began on Col-0, Atann1 and Atann1/Atann1 at day 2, with germination rates of 95.55. + -. 0.48%, 96.66. + -. 1.66% and 98.88. + -. 0.48%, respectively, with no significant difference between the three materials (FIG. 4A). The germination rates of three materials treated by 100mM mannitol for 2 days are 91.66 +/-1.44%, 92.77 +/-1.27% and 93.33 +/-2.50%, the germination rates of the three materials on the 3 rd day are more than 95%, and the reactions of the three materials to the treatment of the mannitol are not obviously different (figure 4B). After 2 days of 200mM mannitol treatment, only Col-0 seeds germinated, with a germination rate of about 60%. The germination rates of the three materials on day 3 are 96.11 + -0.96%, 65 + -2.35% and 94.44 + -2.09%, respectively. On day 4, the germination rates of the three materials were 98.33. + -. 1.44%, 75.83. + -. 1.76% and 97.77. + -. 1.27%, respectively. The germination rates of the three materials all reach more than 95% at the 5 th day, and the reaction differences of the three materials to the treatment of the mannitol are obvious (figure 4C). After 300mM mannitol treatment, the germination rates of the three materials on day 3 were 93.88. + -. 1.27%, 6.66. + -. 2.35%, 84.44. + -. 7.69%, respectively. On day 4, the germination rates of the three materials were 97.77 + -0.48%, 53.33 + -5.89% and 95 + -2.20%, respectively. On day 5, the germination rates of the three materials were 98.33%, 60 ± 4.71% and 97.77 ± 0.48%, respectively, and the responses of the three materials to mannitol treatment were significantly different (fig. 4D). After 400mM mannitol treatment, the germination rates were 43.33. + -. 2.35%, 0 and 25.00. + -. 2.20% for the three materials on day 3, respectively. On day 4, the germination rates of the three materials were 75.83. + -. 2.20%, 20.00. + -. 2.20% and 77.77. + -. 1.73%, respectively. On day 5, the germination rates of the three materials were 90.00. + -. 2.35%, 48.88. + -. 2%, and 92.77. + -. 1.73%, respectively, and the responses of the three materials to mannitol treatment were significantly different (FIG. 4E). Neither Atann1 germinated after 500mM mannitol treatment, Col-0 and Atann1/Atann1 were 49.44. + -. 1.73% and 30.00. + -. 2.37% on the fifth day, respectively (FIG. 4F). On day 3, there was no significant difference in germination rates between the three materials after 100mM mannitol treatment. 200. The germination rates of Col-0 and AtANN1/AtANn1 were significantly higher than that of AtANn1 in 300 and 400mM treatments, the differences of the responses of the three materials to mannitol treatment were significant (P <0.01), and the germination rates of the three materials were greatly reduced without significant difference in 500mM due to too high concentration (FIG. 4G). To eliminate the intrinsic differences of the samples, we divided the data of the treated group (300mM mannitol treatment for 3 days) by the control group (0mM mannitol treatment) to find the change rate of germination rate of each material under water stress, and the results showed that the germination rate of Col-0 was 14 times that of Atann1, and that the germination rate of Atann1/Atann1 was 12 times that of Atann1(P <0.01) with a very significant difference (FIG. 4H).

Example 3AtAnn1 participation in the Water stress seedling greening Process

After the mannitol treatment, the green turning rate of the seeds is obviously reduced, and the time for reaching the maximum green turning rate is also obviously delayed, and the trend is gradually increased along with the increase of the mannitol concentration. Under non-treated conditions, Col-0, Atann1, and Atann1/Atann1 turned green from day 3 with rates of 92.77. + -. 1.27%, 91.11. + -. 2.54%, and 92.77. + -. 0.96%, respectively, with no significant difference between the three materials (FIG. 5A). The green turning rates of three materials treated by 100mM mannitol for 3 days are respectively 75.00 +/-7.40%, 88.33 +/-2.20% and 78.88 +/-1.92%, and the green turning rates of the three materials reach about 90% on

days

4 and 5. There was no significant difference in the response of the three materials to mannitol treatment (fig. 5B).

After 200mM mannitol treatment, only Col-0 and AtANN1/Atann1 turned green at day 3, and the green turning rate was less than 20%. On day 4, all three materials turned green with green turning rates of 66.66 + -1.17%, 5.00 + -0.83% and 58.33 + -5.89%, respectively. The greenish turning rates of the three materials on day 5 were 93.33. + -. 2.35%, 47.77. + -. 2.54% and 95.00. + -. 1.17%, respectively (FIG. 5C).

After 300mM mannitol treatment, only Col-0, AtANN1/AtANn1 turned green and the rate of turning green was less than 30% on days 4 and 5 (FIG. 5D).

400. After 500mM mannitol treatment, none of the three materials turned green (FIG. 5E and FIG. 5F).

On the 4 th day of the mannitol treatment, at 100mM, the green turning rate of the three materials reaches 100%; the greenish turning rates at 200mM for Col-0 and AtANN1/AtANn1 were significantly higher than for AtANn1(P <0.01), and the greenish turning rates for the three materials were less than 10% for the 300, 400 and 500mM treatments due to the excessive concentration of mannitol (FIG. 5G).

To eliminate the intrinsic difference of the samples, we compared the data of the treated group (treated with 200mM mannitol for 4 days) with the data of the control group (treated with 0mM mannitol), and taken the change rate of the green turning rate of each material under water stress, the results showed that the green turning rate of Col-0 was 15 times that of Atann1, and the green turning rate of Atann N1/Atann1 was 12 times that of Atann1, with the difference being very significant (P <0.01) (FIG. 5H).

Example 4 participation of AtAnn1 in the aerial growth control of seedlings under Water stress

The mannitol treatment has obvious inhibition effect on the growth of seedling cotyledon, and the green cotyledon area of the seedling is continuously reduced. The green cotyledon area of the three materials under the non-treatment condition is 2.52 +/-0.08 mm²、2.63±0.12mm²And 2.34. + -. 0.10mm². The green cotyledon area of each of the three materials after 100mM mannitol treatment was 1.65. + -. 0.07mM²、1.64±0.01mm²And 1.49. + -. 0.08mm². The area of the green cotyledon of the 200mM mannitol-treated three materials was 0.85. + -. 0.09mM, respectively²、0.16±0.01mm²And 0.63. + -. 0.04mm². After 300mM mannitol treatment, the green cotyledon area of each of the three materials was 0.19. + -. 0.03mM²、0mm²And 0.03. + -. 0.005mm²The green cotyledon area of the three materials was 05 days after 400, 500mM mannitol treatment (FIG. 6A). As can be seen from the results, the green cotyledon area of Col-0 and AtANN1/Atann1 was significantly higher than that of Atann1 (P) at 5 days of 200mM mannitol treatment<0.01)。

To eliminate the intrinsic differences of the samples, the rate of change of the green cotyledon area under water stress was taken for each material by dividing the data of the treatment group (treated with 100mM mannitol for 5 days) by the control group, and the results showed that the green cotyledon area of Col-0 was 5.5 times that of Atann1, and the green cotyledon area of Atann1/Atann1 was 4 times that of Atann1, with the differences being very significant (P <0.01) (fig. 6B).

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other. The device disclosed by the embodiment corresponds to the method disclosed by the embodiment, so that the description is simple, and the relevant points can be referred to the method part for description.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> university of northriver

Institute of Geographical Sciences, Hebei Academy of Sciences

<120> application of annexin gene in plant water stress

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 954

<212> DNA

<213> CDS (coding sequence)

<400> 1

atggcgactc ttaaggtttc tgattctgtt cctgctcctt ctgatgatgc tgagcaattg 60

agaaccgctt ttgaaggatg gggtacgaac gaggacttga tcatatcaat cttggctcac 120

agaagtgctg aacagaggaa agtcatcagg caagcatacc acgaaaccta cggcgaagac 180

cttctcaaga ctcttgacaa ggagctctct aacgatttcg agagagctat cttgttgtgg 240

actcttgaac ccggtgagcg tgatgcttta ttggctaatg aagctacaaa aagatggact 300

tcaagcaacc aagttcttat ggaagttgct tgcacaagga catcaacgca gctgcttcac 360

gctaggcaag cttaccatgc tcgctacaag aagtctcttg aagaggacgt tgctcaccac 420

actaccggtg acttcagaaa gcttttggtt tctcttgtta cctcatacag gtacgaagga 480

gatgaagtga acatgacatt ggctaagcaa gaagctaagc tggtccatga gaaaatcaag 540

gacaagcact acaatgatga ggatgttatt agaatcttgt ccacaagaag caaagctcag 600

atcaatgcta cttttaaccg ttaccaagat gatcatggcg aggaaattct caagagtctt 660

gaggaaggag atgatgatga caagttcctt gcacttttga ggtcaaccat tcagtgcttg 720

acaagaccag agctttactt tgtcgatgtt cttcgttcag caatcaacaa aactggaact 780

gatgaaggag cactcactag aattgtgacc acaagagctg agattgactt gaaggtcatt 840

ggagaggagt accagcgcag gaacagcatt cctttggaga aagctattac caaagacact 900

cgtggagatt acgagaagat gctcgtcgca cttctcggtg aagatgatgc ttaa 954

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgagcgtgat gctttattgg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgctccttca tcagttccag 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

attttgccga tttcggaac 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcttaatcaa tcaatcctcc 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctcaaaacac acaacagaaa c 21

Claims

1. The application of the annexin gene in water stress of plants is characterized in that the annexin gene is AtAnn1, and a CDS sequence is shown in SEQ ID No. 1.

2. The use of the annexin gene in water stress of plants according to claim 1, wherein the annexin gene can promote germination of seeds under water stress.

3. The use of the annexin gene in plant water stress according to claim 1, wherein the annexin gene can promote seedling greening under water stress.

4. The use of the annexin gene in water stress of plants according to claim 1, wherein the annexin gene can promote growth of overground parts of seedlings under water stress.