CN112779279B

CN112779279B - Seed specific interference vector containing pOsGluB-4 promoter and application thereof

Info

Publication number: CN112779279B
Application number: CN201911085962.0A
Authority: CN
Inventors: 李辉; 李鹏慧; 黄维藻; 涂升斌; 汪松虎; 蒋海波; 庄勇; 刘阳轩; 魏明; 刘志坚; 古袁扬; 唐钰莹; 乐露; 胡永志; 路龙祥; 喻兰
Original assignee: Chengdu Institute of Biology of CAS
Current assignee: Chengdu Institute of Biology of CAS
Priority date: 2019-11-08
Filing date: 2019-11-08
Publication date: 2022-07-12
Anticipated expiration: 2039-11-08
Also published as: CN112779279A

Abstract

The invention belongs to the technical field of biology, and particularly relates to a seed specific interference vector containing a pOsGluB-4 promoter and application thereof. Specifically provides a seed specificity interference vector, the vector is a pOsGluB-4-RNAi vector, and the DNA sequence of the vector is shown as SEQ ID NO 9. The pOsGluB-4-RNAi vector can specifically interfere the expression of a target gene in rice seeds without affecting the normal expression of the target gene in other tissues and organs, so that the direct regulation and control effect of the target gene on the development of the seeds can be effectively researched, the purposes of improving the grain type, the yield and the rice quality of the rice can be achieved, and an effective technical means and a solution are provided for the molecular precise design and breeding of the rice yield and the rice quality. Meanwhile, the OsMADS1 seed-specific interference vector pOsGluB-4:: OsMADS1-RNAi based on the pOsGluB-4-RNAi vector is also provided, and the DNA sequence of the OsMADS1-RNAi is shown as SEQ ID NO 10; the carrier can improve the protein content in the rice and increase the nutritional value of the rice. The invention has important scientific research significance and application value.

Description

Seed specific interference vector containing pOsGluB-4 promoter and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a seed specific interference vector containing a pOsGluB-4 promoter and application thereof.

Background

Rice is the main ration for more than half of the world's population, and is also a basic source of human starch and protein. The growth and development of the rice seeds not only control the thousand seed weight which is one of three factors of the rice yield, but also are important factors directly determining the rice nutrition quality such as the protein content of the rice and the like. The morphological development of rice seeds and the protein content of rice are regulated and controlled by a series of important genes. Therefore, the research on the functions of the important regulatory genes and the regulatory mechanism of the important regulatory genes on the morphological development of the seeds and the protein content of the rice is the basis for developing the precise seed design breeding and the genetic engineering breeding by utilizing the important genes and breeding new high-yield and high-quality rice varieties.

At present, plant constitutive RNA interference (RNAi) technology is an important effective means for researching and utilizing the functions of these important genes. The technology uses a constitutive promoter with constant high expression in each tissue organ of a specific plant to drive the expression of Short hairpin RNA (shRNA) containing a sense and antisense DNA segment of a target gene, further triggers the specific degradation of mRNA of the target gene mediated by Dicer endoribonuclease, leads the expression of the target gene to be silent or the expression quantity of each tissue organ to be reduced in each development stage of the plant, and researches the whole function of the target gene and the development regulation and control effect on each tissue organ in each period of the plant through the phenotype of RNAi plants.

However, the constitutive RNA interference technology of plants has obvious defects and shortcomings in the aspects of researching and utilizing important regulatory genes for rice seed development. Because part of the gene not only regulates the rice seed development, but also has important regulation and control effects on fertility or/and plant type and other agronomic traits. If the constitutive RNA interference technology is used for inhibiting the expression of the gene in seeds, the normal expression and regulation functions of the target gene in flowers or/and other organs such as roots, stems and leaves can be influenced, the fertility or/and the plant type can be influenced, and unnecessary interference can be caused on the regulation function of the target gene on seed development and subsequent utilization of the target gene. Similarly, plant gene editing systems such as CRISPR/Cas9 commonly used at present can form irreversible mutations such as base insertion and deletion on DNA of a target gene of a receptor, and stably inherit the mutations to progeny of the receptor, thereby influencing the normal function of the target gene in all organs, tissues and cells of the receptor. Therefore, the plant gene editing system such as CRISPR/Cas9 and the like is used to cause unnecessary interference on the regulation and control function of the target gene on seed development and subsequent utilization thereof. Therefore, the plant constitutive RNA interference technology and the plant gene editing system such as CRISPR/Cas9 have obvious technical limitations and disadvantages in the technical field.

The OsMADS1 gene is an important member of rice MADS-Box transcription regulatory factor gene family, and is mainly expressed in seeds and flowers. Besides regulating the differentiation of meristems of rice flowers, the formation of flower primordia and controlling the normal development of flowers, the OsMADS1 also regulates and controls the seed shape through the interaction with genes such as OsDEP1, OsGS3 and the like, and influences the appearance quality of rice. The OsMADS1 constitutive RNA interference plant has abnormal phenotype of floral organ variation, extremely obvious reduction of seed setting rate, extremely obvious increase of grain length and unclosed glumes. Constitutive RNA interference technology is utilized to constitutively interfere the expression of the OsMADS1 gene, and the unique regulation and control functions of the OsMADS1 on seed development and rice quality cannot be specially researched.

On the other hand, protein is the second major nutrient component in rice. Meanwhile, the protein content is also an important index for determining the nutritional value and quality traits of rice. The cultivation of good rice varieties with moderate protein content has always been an important breeding target for breeders. However, the protein content in rice grains is the lowest in cereal crops, and the protein content of brown rice generally accounts for 8% -10% of dry weight. In addition, the protein content of the rice is comprehensively regulated and controlled by complex quantitative character sites and environmental factors, so that the difficulty of cultivating excellent rice varieties with moderate protein content by a conventional breeding method is high, and the period is long. Therefore, the targeted improvement of the protein content of rice by using genetic engineering technology is an effective strategy. Some of the conventional attempts have been to increase the protein content of rice, but have also brought about unfavorable traits such as plant fertility and extremely significantly reduced yield. For example, Liao et al (2019) use a constitutive RNA interference technology to inhibit the OsDCL3b gene, so that the protein content of an interference plant is increased from 9.01% to 10.40%. However, the simultaneous interference with fertility and yield of plants is very significant and difficult to apply in practice (Liao PF, Ouyang JX, Zhang JJ, et al. OsDCL3b extracts yield and quality in rice [ J ]. Plant Molecular Biology,2019,99(3): 193-204.).

Meanwhile, although the OsMADS1 gene has an important regulation function on rice flower development, the direct regulation function on rice seed development and rice quality development is not clear, and research reports and invention patents of the application of the OsMADS1 gene in improving the rice protein content are not shown.

In conclusion, if a seed-specific interference vector can be provided to specifically interfere with the development of rice seeds and the expression of regulatory genes (such as OsMADS1) for the nutritional quality such as rice protein and the like, the unique regulatory function of the genes such as OsMADS1 and the like for the development of rice seeds and the nutritional quality such as rice protein and the like can be specially researched, and the expression of the genes such as OsMADS1 and the like can be specifically regulated by using the seed-specific interference vector, so that the purposes of improving the quality traits such as rice yield, rice protein content and the like are achieved, and the method has very important scientific research value and practical application value.

Disclosure of Invention

The invention aims to provide a seed-specific interference vector and application thereof.

In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows: a seed specificity interference vector is a pOsGluB-4-RNAi vector, and the DNA sequence of the vector is shown as SEQ ID NO 9.

Correspondingly, the preparation method of the seed-specific interference vector comprises the following steps:

(1) obtaining a double-enzyme digestion pLHRNAi linear vector;

(2) and carrying out homologous recombination reaction on the linear vector and the DNA fragment of the pOsGluB-4 to obtain the required seed specificity interference vector.

Preferably, the double digestion in step (1) is carried out by using HindIII and KpnI restriction enzymes.

Correspondingly, the pOsGluB-4-RNAi seed specific interference vector is applied to the research of the function of a seed expression gene.

Correspondingly, the pOsGluB-4-RNAi seed specific interference vector is applied to the specific regulation of seed development and/or expression of a protein content regulation gene in seeds, the regulation of seed development, the improvement of rice grain types and the regulation of rice protein content.

Correspondingly, the OsMADS1 seed specific interference vector is pOsGluB-4, OsMADS1-RNAi vector, and the DNA sequence of the vector is shown as SEQ ID NO 10.

Correspondingly, the preparation method of the OsMADS1 seed-specific interference vector comprises the following steps:

(1) obtaining a pOsGluB-4-RNAi vector, wherein the DNA sequence of the vector is shown as SEQ ID NO 9;

(2) obtaining a sense interference fragment of the OsMADS1 gene, wherein the DNA sequence of the sense interference fragment is shown as SEQ ID NO 3;

(3) obtaining an OsMADS1 gene antisense interference fragment, wherein the DNA sequence of the antisense interference fragment is shown in SEQ ID NO 4;

(4) inserting the OsMADS1 gene sense interference fragment and the OsMADS1 gene antisense interference fragment into the pOsGluB-4-RNAi vector respectively to obtain the required pOsGluB-4: OsMADS1-RNAi vector; specifically, the method is carried out according to the method 1 or the method 2:

the method comprises the following steps: inserting the OsMADS1 gene sense interference fragment into the pOsGluB-4-RNAi vector to obtain an intermediate vector A containing the OsMADS1 gene sense interference fragment, and inserting the OsMADS1 gene antisense interference fragment into the intermediate vector A to obtain the required pOsGluB-4: OsMADS1-RNAi vector;

the method 2 comprises the following steps: inserting the OsMADS1 gene antisense interference fragment into the pOsGluB-4-RNAi vector to obtain an intermediate vector B containing the OsMADS1 gene antisense interference fragment, and inserting the OsMADS1 gene sense interference fragment into the intermediate vector B to obtain the required pOsGluB-4: OsMADS1-RNAi vector.

Preferably, the method of step (4) is:

the OsMADS1 gene sense interference fragment insertion site is positioned between KpnI and SacI enzyme digestion sites of a multiple cloning site on the left side of the FAD2 intron of the pOsGluB-4-RNAi vector; and/or; the insertion site of the OsMADS1 gene antisense interference fragment is positioned between BamHI and MluI enzyme digestion sites of the right multi-cloning site of the FAD2 promoter of the intermediate vector A in which the pOsGluB-4-RNAi vector is inserted with the OsMADS1 gene sense interference fragment;

the method 2 in the step (4) comprises the following steps:

the insertion site of the OsMADS1 gene antisense interference fragment is positioned between BamHI and MluI enzyme digestion sites of a multiple cloning site on the right side of an FAD2 promoter of the pOsGluB-4-RNAi vector; and/or; the insertion site of the OsMADS1 gene sense interference fragment is positioned between KpnI and SacI enzyme cutting sites of a multiple cloning site on the left side of an FAD2 intron of an intermediate vector B of the pOsGluB-4-RNAi vector into which the OsMADS1 gene antisense interference fragment is inserted.

Correspondingly, the OsMADS1 seed specific interference vector is applied to research on the specific regulation and control functions of the OsMADS1 gene on rice seed development, seed morphology and rice protein content.

Correspondingly, the OsMADS1 seed-specific interference vector is applied to the improvement of rice grain type and protein content.

The invention has the following beneficial effects:

1. the invention provides a seed specific interference vector pOsGluB-4-RNAi constructed by using a rice seed specific promoter pOsGluB-4, aiming at the technical defect that the prior constitutive RNA interference technology cannot specifically interfere and inhibit the target gene expression in the seed development process and tissues and organs, so that the direct and unique regulation and control functions of the target genes on the seed development cannot be specially researched. The seed specific interference vector can specifically interfere the expression of the target genes such as OsMADS1 in rice seeds, but does not affect the expression of the target genes such as OsMADS1 in other tissues and organs such as flowers, so that the direct regulation and control effect of the target genes such as OsMADS1 expressed in the seeds on the seed development can be effectively researched.

2. In the prior art, a constitutive RNA interference technology can interfere and inhibit the expression of a target gene in vegetative organs and floral organs such as roots, stems and leaves outside rice seeds, and the like, and can influence the vegetative growth and floral organ development of rice, so that negative influences can be brought to the fertility, yield and rice quality of the rice. Aiming at the technical defect, the seed specific interference vector pOsGluB-4-RNAi provided by the invention can be used for accurately regulating and controlling the expression of the regulatory genes of the development and quality traits of seeds such as OsMADS1 and the like in the seeds, but does not influence the normal functions of the genes in the nutritive organs and floral organs, thereby achieving the purposes of improving the rice yield and improving the rice quality and providing an effective technical means and solution for the genetic engineering breeding of the rice yield and the rice quality.

3. Aiming at the technical problem that the improvement of the rice nutritional quality by properly improving the rice protein content by utilizing the traditional breeding technology is difficult, the invention provides an OsMADS1 seed specific interference vector pOsGluB-4 constructed by applying a pOsGluB-4-RNAi seed specific interference vector, OsMADS1-RNAi and a preparation method, which can accurately regulate the expression of a rice protein regulation gene OsMADS1 in seeds, thereby obviously improving the rice protein content and improving the rice nutritional quality.

4. The technical scheme provided by the invention provides an important scientific basis for the regulation and control effect of the genes in the MADS-Box transcription regulatory factor gene family of the rice on the development of rice seeds and the protein content of the rice, and simultaneously provides an effective technical solution for obtaining rice materials with moderate protein content.

Drawings

FIG. 1 is a flow chart and a vector map for constructing a pOsGluB-4-RNAi vector;

FIG. 2 is a gene chip database-based OsGluB-4 gene expression profile analysis chart;

FIG. 3 is a diagram showing an analysis of OsGluB-4 gene expression profile based on transcriptome data;

FIG. 4 is an electrophoretic detection chart of the PCR amplification result of pOsGluB-4;

FIG. 5 is an electrophoretic map of a linear vector obtained by double digestion of pLHRNAi with HindIII and KpnI;

FIG. 6 is an electrophoretic test chart of colony PCR screening of positive monoclonal colonies carrying pOsGluB-4-RNAi recombinant vector;

FIG. 7 is a schematic diagram showing the construction scheme and structure of the pOsGluB-4: OsMADS1-RNAi vector;

FIG. 8 is a diagram showing the analysis of OsMADS1 expression profile based on the gene chip database;

FIG. 9 is a graph showing the analysis of qRT-PCR expression profile of OsMADS1 in Japanese panicle, floral organ and seed;

FIG. 10 is a photograph showing the result of PCR amplification of the sense interfering fragment and the antisense interfering fragment of OsMADS 1;

FIG. 11 is an electrophoretic map of a linear vector obtained by double digestion of pOsGluB-4-RNAi with BamHI and MluI;

FIG. 12 is an electrophoretic map of a product obtained by double digestion of the OsMADS1 gene antisense interference fragment with BamHI and MluI;

FIG. 13 is an electrophoresis test chart of a positive monoclonal colony of OsMADS1(antisense) -RNAi recombinant vector, which is screened by colony PCR for pOsGluB-4 with an antisense interference fragment of OsMADS1 gene inserted therein;

FIG. 14 shows the result of alignment of the pOsGluB-4 vector with OsMADS1(antisense) -RNAi recombinant vector inserted with the antisense interference fragment of OsMADS1 gene with SEQ ID NO 4;

FIG. 15 is an electrophoretic examination of a linear vector obtained by double-digesting pOsGluB-4:: OsMADS1(antisense) -RNAi vector with KpnI and SacI;

FIG. 16 is a diagram showing an electrophoretic detection of a product obtained by double-digesting a sense interference fragment of the OsMADS1 gene using KpnI and SacI;

FIG. 17 is an electrophoresis test chart of a positive monoclonal colony of OsMADS1-RNAi recombinant vector, which is screened by colony PCR for pOsGluB-4 with inserted OsMADS1 gene positive and antisense interference fragments;

FIG. 18 is a schematic diagram showing the core structure of OsMADS1-RNAi vector in pOsGluB-4:;

FIG. 19 is an electrophoretic detection chart of the PCR amplification result of the sense interfering fragment and the antisense interfering fragment of OsMADS 1;

FIG. 20 is an electrophoretic map of the product obtained by double digestion of pLHRNAi vector with BamHI and MluI;

FIG. 21 is an electrophoretic map of a product obtained by double digestion of the OsMADS1 gene antisense interference fragment with BamHI and MluI;

FIG. 22 is an electrophoresis test of a positive monoclonal colony of OsMADS1(antisense) -RNAi recombinant vector screened by colony PCR for pUbi with the antisense interference fragment of the inserted OsMADS1 gene;

FIG. 23 is a diagram showing an electrophoretic detection of a product obtained by double-digesting pUbi with KpnI and SacI in OsMADS1(antisense) -RNAi vector;

FIG. 24 is a diagram showing an electrophoretic detection of a product obtained by double digesting a sense interference fragment of OsMADS1 gene with KpnI and SacI;

FIG. 25 is an electrophoretic test chart of a positive monoclonal colony of an OsMADS1-RNAi recombinant vector, which is screened by colony PCR for pUbi with positive and antisense interfering fragments inserted into the OsMADS1 gene;

FIG. 26 shows the core structure of pUbi:OsMADS 1-RNAi vector;

FIG. 27 shows pOsGluB-4:OsMADS 1-RNAi vector T₀Carrying out PCR screening identification electrophoresis detection on the transgenic positive plants;

FIG. 28 shows pOsGluB-4: OsMADS1-RNAi vector T₀A generation positive plant rice flower phenotype identification chart;

FIG. 29 shows pOsGluB-4: OsMADS1-RNAi vector T₀T formed by generation positive plants₁Seed generation grain type identification chart;

FIG. 30 shows pOsGluB-4: OsMADS1-RNAi vector T₀T formed by generation positive plants₁A measurement result graph of the protein content of the seed-substituting rice;

FIG. 31 shows pUbi:OsMADS 1-RNAi vector T₀PCR screening identification electrophoresis detection images of transgenic positive plants;

FIG. 32 shows pUbi:OsMADS 1-RNAi vector T₀Positive plant glume flower and knot T₁Analysis chart of OsMADS1 expression level in generation seeds;

FIG. 33 shows pUbi:OsMADS 1-RNAi vector T₀A phenotype identification chart of the floral organs of the generation-positive plants;

FIG. 34 shows pUbi:OsMADS 1-RNAi vector T₀A generation positive plant setting percentage statistical analysis chart;

FIG. 35 shows pUbi:OsMADS 1-RNAi vector T₀T formed by generation positive plants₁Seed generation grain type identification chart;

FIG. 36 shows pUbi:OsMADS 1-RNAi vector T₀T formed by generation positive plants₁The result of the determination of the protein content of the seed-substituting rice is shown.

Detailed Description

The first embodiment is as follows: construction of pOsGluB-4-RNAi vector

Constructing a pOsGluB-4-RNAi vector, specifically cloning a promoter of a rice seed specific expression gene OsGluB-4 to a plant constitutive RNA interference binary vector pLHRNAi with a hygromycin screening marker in the forward direction by using a homologous recombination directed cloning method, and replacing an original Ubiquitin constitutive expression promoter pUbi in the pLHRNAi vector, thereby obtaining the pOsGluB-4-RNAi seed specific interference vector. Wherein the pOsGluB-4 is the promoter of OsGluB-4 gene. The construction flow chart and the vector map of the pOsGluB-4-RNAi vector are shown in figure 1, and the specific construction method is as follows:

first, OsGluB-4 gene expression profile analysis

1. OsGluB-4 gene expression profile analysis based on gene chip database

Expression profile analysis of OsGluB-4 gene in Nipponbare (Nipponbare, rice variety, japonica subspecies). The expression profile of OsGluB-4 (Gene: Os02g0268300) gene in Nippon sunny was analyzed using a Rice Gene chip expression database (http:// ricex pro. dna. affrc. go. jp/; Sato Y, Takehisa H, Kamatsuki K, et al. ricex pro Version 3.0: expanding the information resource for the purpose of obtaining a rice protein expression profile), as shown in FIG. 2 (inputting http:// ricex. dna. f. aff. f. g0268300 according to the web site required), and clicking on the rice protein profile, and then obtaining a new rice protein expression profile, which can be searched by clicking on the rice protein chip expression database (http:// ricex. p. f. D. 1213). As shown in FIG. 2, the OsGluB-4 gene was expressed only in the carpel at the seed development stage at the 5 th day after flowering (5 DAF), and the average expression level reached a maximum in the endosperm at 14 DAF, and then maintained at a high level in spite of the late-falling expression until the seed development matures, while not being expressed at the vegetative growth stage and the flower development stage of rice. The results show that the OsGluB-4 gene is only expressed in the development stage of rice seeds, and the promoter pOsGluB-4 is a rice seed specific promoter.

2. OsGluB-4 gene expression profiling analysis based on transcriptome data

Further, the expression profiles of OsGluB-4 gene in Japanese panicle (including flower) and seed were analyzed using the measured transcriptome data of each representative developmental stage sample of Japanese panicle (including flower) and seed, and the results are shown in FIG. 3. In fig. 3, the meaning of each reference numeral is specifically: p1 is Japanese fine young ear with ear length of 3-15 mm; p2 Japanese fine young ear with ear length of 15-50 mm; p3 Japanese fine panicle with panicle length of 50-100 mm; s1 seeds of day 1 (1 DAF) after Nipponbare flowering; s6 seeds of day 6 (6 DAF) after Nipponbare flowering; s12 seeds of day 12 (12 DAF) after Nipponbare flowering; s18 seeds of day 18 (18 DAF) after Nipponbare flowering; s24 seeds of 24 th day (24 DAF) after Nipponbare flowering.

As can be seen from FIG. 3, the OsGluB-4 gene was not expressed in all three stages of P1, P2 and P3 in the panicum of Japan (including flowers), but was detected in the seeds of 12 DAF (S12), and then its expression level gradually increased and reached a maximum in the seeds of 24 DAF (S24). This expression result is generally similar to the above-mentioned "gene chip database-based OsGluB-4 gene expression profiling" result. The results further indicate that the OsGluB-4 gene is only expressed in the development stage and the tissue organ of the rice seeds, and the promoter pOsGluB-4 is a rice seed specific promoter.

II, obtaining a seed specific promoter pOsGluB-4 DNA fragment

1. Extraction of genomic DNA of Nipponbare rice variety

Genomic DNA was extracted from a rice variety Nipponbare (Oryza sativa ssp. japonica. cv. Nipponbare) stored at the institute of Chengdu Biotechnology of the Chinese academy of sciences, using the CTAB method. The CTAB method for extracting DNA comprises the following steps:

(1) the method relates to the following reagent formula, wherein, the reagent is prepared according to standard amount, and then the actual amount is obtained according to the requirement.

1) CTAB extracting solution: CTAB powder 2g, 1M Tris powder 1.21g, 0.5M EDTA powder 0.74g, NaCl powder 8.18g, beta-mercaptoethanol 1ml, adding double distilled water to constant volume to 100 ml.

2) Extracting solution: 500ml of chloroform and 20ml of isoamyl alcohol.

3) DNA precipitation solution: isopropanol (-20 ℃ precooled).

4) Impurity eluent: 70ml of absolute ethyl alcohol and double distilled water are added to reach the constant volume of 100 ml.

5) DNA lysis solution: ultrapure water.

(2) The method specifically comprises the following steps:

1) 0.2g of the leaf blade is taken and put into a 2ml centrifuge tube, and 1 steel ball is put into the centrifuge tube.

2) Freezing the centrifuge tube in liquid nitrogen for 2min, and pulverizing the sample with tissue grinder.

3) Add 600. mu.l CTAB extract into the tube, vortex and shake to mix well.

4) And (3) putting the centrifugal tube into a 65 ℃ water bath kettle for warm bath for 30min, shaking for 3-5 times at intervals, and then cooling to room temperature.

5) Add 700. mu.l of the extract to the tube, mix the mixture upside down, and stand for 10 min. Then centrifuged at 12000rpm for 10 min.

6) Aspirate 500. mu.l of supernatant and transfer to a 1.5ml centrifuge tube. Add 800. mu.l of DNA precipitation solution into the centrifuge tube, mix it upside down (Chev not shake), put into a-20 ℃ refrigerator to precipitate DNA.

7) After the flocculent DNA precipitate appeared, the mixture was centrifuged at 12000rpm for 10 min. Then 700. mu.l of the impurity eluent was added thereto, and the mixture was left to stand for 5min and then centrifuged at 12000rpm for 10 min. And then pouring out the impurity eluent, and airing at room temperature or drying in an ultra-clean workbench.

8) After the DNA is dried in the air or dried by blowing, 50-100 mu l of DNA dissolving solution (namely ultrapure water) is used for dissolving the DNA, and the mass and the concentration of the DNA are detected by a spectrophotometer. The concentration of the DNA mentioned was determined to be 2046. mu.g/. mu.l, A₂₆₀/A₂₈₀It was 2.03.

2. A primer sequence for amplifying OsGluB-4 gene promoter pOsGluB-4 is designed.

pOsGluB-4-pLHRNAi-HindIII-F:

5’-TGGGCCCGGCGCGCCAAGCTTTACAGGGTTCCTTGCGTGAAG-3’。

Wherein "AAGCTT"sequence is a recognition sequence of HindIII restriction enzyme whose cleavage site is located in the sequence"AA"in between; said "ATAGAGCTCAGGCCTGGTACC"the sequence is the homologous recombination sequence at the HindIII enzyme cutting site and the left side of the HindIII enzyme cutting site on the pLHRNAi vector; said "TACAGGGTTCCTTGCGTGAAG"The sequence is a sense sequence of a promoter 5' initiation end of the rice OsGluB-4 gene.

pOsGluB-4-pLHRNAi-KpnI-R:

5’-ATAGAGCTCAGGCCTGGTACCAGCTATTTGAGGATGTTATTGGAAAC-3’。

Wherein, said "GGTACC"sequence is KpnI restriction enzyme recognition sequence, and the restriction enzyme cleavage site is located in the sequence"CC"in between; said "ATAGAGCTCAGGCCTGGTACCThe sequence is a homologous recombination sequence at a KpnI enzyme cutting site on a pLHRNAi vector and on the right side of the KpnI enzyme cutting site; the AGCTATTTGAGGATGTTATTGGAAAC sequence is the antisense sequence of the promoter 3' end of the rice OsGluB-4 gene.

And carrying out PCR amplification by using the primer and the DNA template of Nipponbare to obtain the required DNA fragment.

When pOsGluB-4-pLHRNAi-HindIII-F is designed, a HindIII restriction endonuclease recognition sequence and a sequence (5' -TGGGCCCGGCGCGCC) on the pLHRNAi vector are simultaneously includedAAGCTT-3') identical 21bp homologous recombination sequences; meanwhile, when pOsGluB-4-pLHRNAi-KpnI-R is designed, a KpnI restriction endonuclease recognition sequence and a sequence (5' -ATAGAGCTCAGGCCT) on the pLHRNAi vector are simultaneously containedGGTACC-3') identical 21bp homologous recombination sequences. Therefore, the 5 'of the PCR amplified fragment carries both the HindIII restriction endonuclease recognition sequence and the sequence (5' -TGGGCCCGGCGCGCC) on the pLHRNAi vectorAAGCTT-3 ') the same 21bp homologous recombination sequence, and the 3' of the PCR amplified fragment carries the KpnI restriction enzyme recognition sequence and the 21bp homologous recombination sequence that is the same as the sequence (5'-ATAGAGCTCAGGCCTGGTACC-3') in the plhci vector.

Therefore, after the pLHRNAi primary vector is subsequently linearized with HindIII and KpnI, the desired seed-specific interference vector can be constructed according to the experimental conditions by the following two methods: (1) directionally cloning a PCR amplification product containing the pOsGluB-4 promoter onto a linearized pLHRNAi original vector by adopting a homologous recombination method to construct and obtain the pOsGluB-4-RNAi seed specific interference vector. (2) Obtaining a PCR amplification product containing the pOsGluB-4 promoter, performing double enzyme digestion on the PCR amplification product containing the pOsGluB-4 promoter by using HindIII and KpnI, and then connecting the PCR amplification product subjected to double enzyme digestion to a linearized pLHRNAi vector to construct the pOsGluB-4-RNAi seed specific interference vector.

By using the method provided by the invention, the selectivity and flexibility of cloning the pOsGluB-4 promoter to the pLHRNAi original vector are increased, the technical difficulty can be reduced, and the success rate and efficiency are improved.

3. PCR amplification of pOsGluB-4 promoter DNA fragment

Taking the DNA of the Nipponbare genome as a template, synthesizing pOsGluB-4 promoter PCR amplification primer sequences pOsGluB-4-pLHRNAi-HindIII-F and pOsGluB-4-pLHRNAi-HindIII-R in the step 2 to obtain corresponding PCR amplification primers, and amplifying the rice seed specific promoter pOsGluB-4 by using Pfu high-fidelity DNA Polymerase (Fastfu DNA Polymerase) of Beijing Quanyujin biotechnology limited and adopting the following PCR reaction system and amplification program.

(1) PCR reaction (50. mu.l): mu.l of rice genomic DNA template, 1. mu.l of pOsGluB-4-pLHRNAi-HindIII-F primer (10. mu.M), 1. mu.l of pOsGluB-4-pLHRNAi-HindIII-R primer (10. mu.M), 10 XFastPfu Buffer 10. mu.l, 4. mu.l of 2.5mM dNTPs, 1. mu.l of FastPfu DNA Polymerase, and 31. mu.l of sterilized ultrapure water.

(2) PCR amplification procedure: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 10sec, annealing at 55 ℃ for 30sec, extension at 72 ℃ for 1min for 30sec, and 36 cycles; final extension at 72 ℃ for 5 min.

4. Detection, recovery and sequencing analysis of pOsGluB-4 promoter DNA fragment

The PCR amplification product of the rice seed specific promoter pOsGluB-4 was detected by gel electrophoresis, and the result is shown in lane 3 of FIG. 4 (lane 1 is BM5000+ DNA Marker (Bomeide biosome), and lane 2 is an unpotted control). As can be seen from FIG. 4, a PCR fragment of about 1.5kb was obtained by PCR amplification, which is the desired DNA fragment of pOsGluB-4.

A part of the PCR amplification product was recovered for use according to the kit method using a general agarose gel DNA recovery kit (DP209) from Tiangen Biochemical technology (Beijing) Ltd. Meanwhile, part of PCR amplification products are sent to Chengdu Kenaixi biotechnology limited company for sequencing. The result shows that the nucleotide sequence of the PCR amplification product is shown as SEQ ID NO 1. The PCR amplification product consists of a total 21bp homologous recombination sequence containing HindIII enzyme cutting site (6bp) and 15bp on the left side thereof on a pLHRNAi vector, a pOsGluB-4 promoter, a KpnI enzyme cutting site (6bp) and a total 21bp homologous recombination sequence of 15bp on the right side thereof. The 1 st-15 th nucleotide sequence from the 5' end of SEQ ID NO 1 is a homologous sequence on the left side of a HindIII restriction endonuclease recognition site on a pLHRNAi vector; the 1502 nd-1516 nd nucleotide sequence from the 3' end of SEQ ID NO 1 is a homologous sequence at the right side of the recognition site of the KpnI restriction endonuclease of the pLHRNAi vector.

The above-mentioned steps are only one embodiment provided for obtaining a DNA fragment of pOsGluB-4, and the DNA fragment of pOsGluB-4 can be artificially synthesized with a known sequence composition.

Third, construction of seed-specific interference vector pOsGluB-4-RNAi

1. HindIII and KpnI double-enzyme digestion pLHRNAi vector

The pLHRNAi vector is double digested by using Fastdigest HindIII and KpnI restriction enzymes of Fermentas China company Limited according to the steps of the product instruction, and the required pLHRNAi linear vector is obtained. The pLHRNAi linear vector was subjected to gel electrophoresis, and the results are shown in lane 2 of FIG. 5 (lane 1 is BM5000+ DNA Marker (Bomeide organism)).

2. pOsGluB-4-RNAi vector homologous recombination directed cloning

Performing homologous recombination reaction on the PCR amplification product (namely the DNA fragment of pOsGluB-4) with the correct sequence obtained in the step 1 and the pLHRNAi linear vector obtained in the step by using a BM seamless cloning kit (CL116-01) of Beijing Bomaide Gene technology Co., Ltd through sequencing, wherein the reaction system is as follows: PCR amplification product (. apprxeq.200 ng/. mu.l) 0.5. mu.l, pLHRNAi linearized vector (. apprxeq.65 ng/. mu.l) 2. mu.l, 2 × Smaless Cloning Mix 5. mu.l, and water to a total volume of 10. mu.l.

The specific operation steps of the homologous recombination directed cloning are as follows:

(1) sequentially adding the components in the reaction system into a 200-microliter PCR tube, gently mixing uniformly, and centrifuging for several seconds;

(2) keeping the temperature of the mixture on a PCR instrument at 50 ℃ for 30min for reaction;

(3) after the reaction is finished, obtaining a required homologous recombination product (namely the required pOsGluB-4-RNAi vector), and placing the centrifugal tube on ice for later use;

(4) transferring the homologous recombination product obtained in the step (3) into a Trans5 alpha competent cell.

The Trans5 alpha competent cell (CD201-01) is purchased from Beijing Quanjin Biotechnology Co., Ltd, and the specific operation steps of the transfer are as follows:

(5) taking 50 mu l of Trans5 alpha competent cells melted on ice bath, adding the homologous recombination product obtained in the step (3), gently mixing uniformly, and placing in ice bath for 30 minutes;

(6) performing heat shock in a water bath at 42 ℃ for 45sec, and then quickly transferring the centrifugal tube into an ice bath for 2min without shaking the centrifugal tube in the process;

(7) adding 500 μ l LB liquid culture medium (without antibiotic) into the centrifuge tube, mixing, culturing at 37 deg.C and 200rpm for 1h to recover bacteria;

(8) the transformed competent cells were aspirated and spread evenly on LB agarose plates containing 50mg/L kanamycin, after the liquid was absorbed, the plates were inverted and cultured overnight at 37 ℃ to obtain monoclonal colonies. The LB liquid culture medium (without antibiotics) comprises the following formula: 100ml of water was added with 1g of NaCl, 1g of Peptone and 0.5g of yeast extract, sterilized at 120 ℃ and stored at room temperature.

The LB agarose culture dish containing 50mg/L kanamycin has the following formula: adding 2g of agar on the basis of 100ml of LB liquid culture medium, sterilizing at 120 ℃ and high temperature, adding 100 mu l of kanamycin antibiotic with the concentration of 50 mu g/mu l when the temperature is reduced to 60-70 ℃, mixing uniformly, quickly pouring into a sterilized culture dish, and solidifying to obtain the product.

2. Identification of pOsGluB-4-RNAi vector

After the colonies grow out on the LB agarose culture dish in the step (8), 12 monoclonal colonies are selected and marked with a marker pen respectively. Respectively dipping a proper amount of monoclonal colony cells as PCR amplification templates, performing monoclonal colony PCR amplification by using a pOsGluB-4-F primer designed from the 5' end sequence of a pOsGluB-4 promoter and a primer AtFAD2-R designed from an AtFAD2 intron sequence on a pLHRNAi original vector by using 2 XTaq Plus MasterMix (Dye) PCR enzyme (CW28 2849M) of Beijing kang, century Biotechnology Co., Ltd to screen and identify a new recombinant vector pOsGluB-4-RNAi containing the rice seed specific promoter pOsGluB-4.

The pOsGluB-4-F primer sequence is 5'-ATGTCTGCCAGCATTGTGAAG-3' (namely the 5 ' start sense sequence of the promoter of the rice OsGluB-4 gene), and the AtFAD2-R primer sequence is 5'-GAAGCGACGGACCTGGAGAT-3'.

The PCR reaction system of the monoclonal colony is as follows: 2 XTaq Mix 10. mu.l, pOsGluB-4-F primer (10. mu.M) 1. mu.l, AtFAD2-R primer (10. mu.M) 1. mu.l, appropriate amount of monoclonal colony cells (edge of single colony was stained with sterilized toothpick), and sterilized ultrapure water was supplemented to make a total volume of 20. mu.l.

The monoclonal colony PCR amplification procedure: pre-denaturation at 95 ℃ for 2min, denaturation at 94 ℃ for 30sec, annealing at 55 ℃ for 30sec, extension at 72 ℃ for 1min for 30sec, 34 cycles, and final extension at 72 ℃ for 2 min.

The PCR amplification products were detected by gel electrophoresis, and the results are shown in FIG. 6. Lane 1: BM2000 DNA Marker (Bomeide organism)) lanes 2-7, 9-11 and 13: the monoclonal colony used as a PCR template contains a pOsGluB-4-RNAi recombinant vector with a pOsGluB-4 promoter; lane 14: the template was sterile water control. As seen from the figure, the DNA bands (2-7, 9-11, 13) of about 1.5kb were obtained as positive clones of pOsGluB-4-RNAi recombinant vectors containing pOsGluB-4 promoters. And selecting positive clone plasmids, sending the plasmids to Hiroschek biotechnology Limited company for sequencing, wherein an initial sequencing primer is AtFAD2-R, the company further designs a sequencing primer for additional sequencing, and after sequencing is completed, the sequencing result is shown as SEQ ID NO 5, namely the pOsGluB-4 promoter sequence.

Sequencing results show that the plasmid is a recombinant vector which clones SEQ ID NO 1 (containing pOsGluB-4 promoter) in a sequence table between HindIII and KpnI restriction enzyme recognition sites on a pLHRNAi vector, replaces the corresponding original sequence (containing pUbi promoter) of the pLHRNAi vector between the two restriction enzyme recognition sites, simultaneously reserves the restriction enzyme recognition sequences of HindIII and KpnI, and names the recombinant vector (namely the homologous recombinant product) as a seed-specific interference vector pOsGluB-4-RNAi; the DNA sequence of the pOsGluB-4-RNAi vector is shown as SEQ ID NO 9.

pOsGluB-4-RNAi is a plant binary vector, and the vector map of the vector is shown in figure 1. The core functional elements of the pOsGluB-4-RNAi vector comprise a seed specific promoter pOsGluB-4 which can be specifically started in the development stage and the seed, an Arabidopsis AtFAD2 (fatty acid desaturase 2) gene intron (used for forming a circular structure in shRNA), multiple cloning sites (used for cloning a sense fragment and an antisense fragment of a target gene) on the left side and the right side of the FAD2 gene intron, an NOS terminator, kanamycin and hygromycin screening marker gene and the like.

Example two: pOsGluB-4 construction of OsMADS1-RNAi vector

FIG. 7 shows the schematic structure and main construction process of OsMADS1-RNAi vector in pOsGluB-4. The specific operation method comprises the following steps:

first, analysis of OsMADS1 Gene expression Profile

1. Gene chip database-based transcript profiling analysis of OsMADS1 gene

Firstly, the expression spectrum of OsMADS1 (gene number: Os03g0215400) gene in Nipponbare is analyzed by utilizing a RiceXPro rice gene chip expression database, as shown in FIG. 8 (the website http:// ricexpro.dna. affrc. go. jp/category-select. php is input according to the needs of the graph, Os03g0215400 is input in Search options in a webpage, then Search is clicked, after the number under FeatureNum is clicked in a new webpage, Spatio-temporal profile is selected on the new webpage, the graph can be inquired, and downlink selected graph on the webpage is clicked, so that the graph can be obtained). OsMADS1 has high expression level mainly in ears (including floral organs) and seeds, and has low or no expression level in leaf and other vegetative organs.

2. OsMADS1 gene expression profiling analysis

The relative expression level of the OsMADS1 gene in each representative development period of Japanese panicle, floral organ and seed was analyzed by Real-Time PCR technology, as shown in FIG. 9. The reference numbers in the figures mean: p1 is a Japanese fine young ear with a spike length of 0-3 mm, P2 is a Japanese fine young ear with a spike length of 3-15 mm, P3 is a Japanese fine young ear with a spike length of 15-50 mm, P4 is a Japanese fine ear with a spike length of 50-100 mm, P5 is a Japanese fine ear with a spike length of 100-150 mm, P6 is a Japanese fine ear with a spike length of 150-200 mm, P7 is a Japanese fine ear with a spike length of more than 200mm, L1 is a husk of a small flower on a rice ear with a spike length of 100-150 mm, L2 is an husk of a small flower on a rice ear with a spike length of 150-200 mm, L3 is a husk of a small flower on a rice ear with a spike length of more than 200mm, Pa1 is a pistil of a small flower on a rice ear with a spike length of 100-150 mm, 2 is a rice tassel with a spike length of 150-200 mm, Pi 3 is a husk of a small flower on a rice ear with a spike length of more than 200mm, Pi is a rice spike length of a husk of a rice ear of more than 200mm, Pi is a rice spike length of a rice ear of a husk of a rice ear of a rice spike length of more than 200mm, Pi 3 is: seeds on day 1 (1 DAF) after nipponica flowering, S3: seeds on day 3 after nipponica flowering (3 DAF), S6: seeds on day 6 (6 DAF) after nipponica flowering, S9: seeds on day 9 after nipponica flowering (9 DAF), S12: seeds on day 12 after flowering in nipponlily (12 DAF), S15: seeds on day 15 after nipponica flowering (15 DAF), S18: seed at day 18 after nipponica flowering (18 DAF), S21: seeds on day 21 (21 DAF) after Nipponbare flowering.

As shown in FIG. 9, the expression level of the OsMADS1 gene in Nipponbare seeds is higher than that in panicle and floral organs as a whole, which indicates that the OsMADS1 gene may have important regulation and control effects on rice seed development and rice nutritional quality in addition to flower development.

Second, construction of pOsGluB-4-OsMADS 1-RNAi vector

1. Obtaining OsMADS1 gene interference fragment

(1) Primer design

1) The primer sequences for amplifying the sense interference fragment of the OsMADS1 gene are as follows:

OsMADS1-RNAi-KpnI-F:

5’-TCAAATAGCTGGTACCAGGCCTGAACAAATCAGGTCAAGAAAG-3’。

wherein "GGTACC"is a KpnI restriction enzyme recognition sequence, among the sequences"CC"restriction enzyme cutting site in the middle; "TCAAATAGCTGGTACCThe sequence of AGGCCTG is a homologous recombination sequence of 23bp at two sides of a KpnI restriction enzyme cutting site; "AACAAATCAGGTCAAGAAAG" is the sense sequence of the 5' start end of the interfering fragment of rice OsMADS1 gene (cDNA).

OsMADS1-RNAi-SacI-R:

5’-CTGACGTAGGGGCGATAGAGCTCTGTTTGCATTGGCTTCT-3’。

Wherein, the GAGCTC is a SacI restriction enzyme recognition sequence, and restriction enzyme cutting sites are arranged between the 'TC' in the sequence; said "CTGACGTAGGGGCGATAGAGCTC"is a homologous recombination sequence containing SacI restriction enzyme recognition site (6bp) and 23bp on the right side of the SacI restriction enzyme recognition site; "TGTTTGCATTGGCTTCT" represents the antisense sequence of the 3' -end of the interfering fragment of the OsMADS1 gene (cDNA) of rice.

The primers comprise homologous recombination sequences and restriction endonuclease recognition sequences, the tail end of a PCR fragment amplified at the later stage simultaneously comprises homologous recombination sequences at two sides of a KpnI restriction endonuclease cleavage site on a left multiple cloning site of an intron of a pOsGluB-4-RNAi vector AtFAD2, a SacI restriction endonuclease recognition site and a homologous recombination sequence at the right side of the SacI restriction endonuclease recognition site and a KpnI and SacI double digestion site, so that a sense interference fragment of an OsMADS1 gene can be subsequently cloned to the left multiple cloning site of the intron of the pOsGluB-4-RNAi vector AtFAD2 by a homologous recombination or double digestion connection method, and an intermediate recombination vector comprising the sense interference fragment of the OsMADS1 gene is obtained.

2) The primer sequences for amplifying the antisense interference fragment of the OsMADS1 gene are as follows:

OsMADS1-RNAi-BamHI-F:

5’-CGGGGATCCGTCGACTACAACAAATCAGGTCAAGAAAG-3’。

wherein "GGATCC"sequence is the recognition sequence of BamHI restriction endonuclease, of the sequence"GGBetween the two layers is a restriction enzyme cutting site; "CGGGGATCCGTCGACTAC' sequence is homologous recombination sequence of 18bp at right side of SnaBI restriction endonuclease cutting site on pOsGluB-4-RNAi vector; "AACAAATCAGGTCAAGAAAG" is rice OsMADS1 gene (cDNA) interference tabletSegment 5' start sense sequence.

OsMADS1-RNAi-MluI-R:

5’-AGGTGGAAGACGCGTTACTGTTTGCATTGGCTTCT-3’。

Wherein "ACGCGT"is MluI restriction endonuclease recognition sequence, among the sequences"ACBetween the two layers is a restriction enzyme cutting site; "AGGTGGAAGACGCGTTAC' is a homologous recombination sequence of 18bp on the left side of a SnaBI restriction enzyme cutting site on the pOsGluB-4-RNAi vector; "TGTTTGCATTGGCTTCT" is the antisense sequence of the 3' end of interfering fragment of OsMADS1 gene (cDNA) of rice.

The primers comprise homologous recombination sequences and restriction endonuclease recognition sequences, and the tail end of a PCR fragment amplified at the later stage simultaneously comprises homologous recombination sequences on the right side and the left side of a SnaBI restriction endonuclease cleavage site on a right multiple cloning site of an intron of a pOsGluB-4-RNAi vector AtFAD2 and BamHI and MluI double cleavage sites, so that an OsMADS1 gene antisense interference fragment can be cloned to the right multiple cloning site of the intron of the AtFAD2 by a homologous recombination or double cleavage connection method to obtain a recombinant vector comprising the OsMADS1 gene antisense interference fragment.

(2) Extraction of leaf RNA and preparation of cDNA of Nipponbare rice variety

Using TRIzol^TMReagent (cat # 15596026, available from Thermo Fisher Scientific, llc) for extraction of RNA from leaves of 30-day nippon seedlings according to the instructions. Then, using the above-mentioned RNA as a template, a TransScript All-in-One First-Strand cDNA Synthesis Supermix for qPCR reverse transcription kit (cat 341-01, available from Beijing Quanyujin Biotechnology Co., Ltd.) was used to perform reverse transcription in accordance with the procedures described in the specification to obtain a Nipponbare leaf cDNA.

(3) PCR amplification of OsMADS1 gene interference fragment

PCR amplification was performed using the cDNA obtained in step (2) as a template, and OsMADS1-RNAi-KpnI-F and OsMADS1-RNAi-SacI-R primers, Pfu high fidelity DNA Polymerase (FastPu DNA Polymerase, cat. No.: AP221-01) from Beijing Quanji Biotechnology, Inc. to obtain product a.

And (3) carrying out PCR amplification by using the cDNA obtained in the step (2) as a template and using OsMADS1-RNAi-BamHI-F and OsMADS1-RNAi-MluI-R primers and Pfu high-fidelity DNA polymerase of Beijing Quanyujin biotechnology limited to obtain a product b.

Wherein, the PCR reaction system (50 μ l) of the product a: mu.l of rice cDNA template, 1. mu.l of OsMADS1-RNAi-KpnI-F primer (10. mu.M), 1. mu.l of OsMADS1-RNAi-SacI-R primer (10. mu.M), 10. mu.l of 5 XFastPfu Buffer, 4. mu.l of 2.5mM dNTPs, 1. mu.l of FastPfu DNA Polymerase and 31. mu.l of sterilized ultrapure water.

PCR reaction of the product b (50. mu.l): mu.l of rice cDNA template, 1. mu.l of OsMADS1-RNAi-BamHI-F primer (10. mu.M), 1. mu.l of OsMADS1-RNAi-MluI-R primer (10. mu.M), 10. mu.l of 5 XFastpfu Buffer, 4. mu.l of 2.5mM dNTPs, 1. mu.l of Fastpfu DNA Polymerase and 31. mu.l of sterilized ultrapure water.

The PCR amplification programs of the products a and b are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 10sec, annealing at 55 ℃ for 30sec, and extension at 72 ℃ for 40sec, for 36 cycles; final extension at 72 ℃ for 5 min.

The results of the electrophoresis detection of the products a and b are shown in FIG. 10. PCR amplification electrophoresis detection of OsMADS1 gene interference fragment, wherein the 1 st lane is BM2000 DNA Marker (Bomeide organism); lane 2, OsMADS1 gene sense interference fragment (product a); OsMADS1 gene antisense interference fragment (product b) in lane 3.

As can be seen, the fragment sizes of the product a and the product b are close to 500 bp. And respectively sending the product a and the product b to sequencing, wherein the sequence of the product a is shown as SEQ ID NO 3. Except for the sequences required by the cloning fragments added at the two ends of the sequence, homologous recombination sequences at the two sides of a KpnI restriction endonuclease cleavage site on the upstream multiple cloning site of the vector pOsGluB-4-RNAi, a SacI restriction endonuclease recognition site and the homologous recombination sequence at the right side of the SacI restriction endonuclease recognition site, and KpnI and SacI cleavage sites, the rest sequences of the SEQ ID NO 3 are part of the OsMADS1 gene cDNA (namely SEQ ID NO 2); the method specifically comprises the following steps: the 24 th to 446 th nucleotides from the 5 'end of SEQ ID NO 3 are sequences of the 492 th to 914 th nucleotides from the 5' end of SEQ ID NO 2. Therefore, the product a is a sense interference fragment of the OsMADS1 gene.

The sequence of the product b is shown as SEQ ID NO 4. Except sequences required by cloning fragments added at two ends of the sequence, homologous recombination sequences at the left and right sides of the SnaBI restriction enzyme cutting sites of the downstream multiple cloning sites of the vector pOsGluB-4-RNAi, MluI cutting sites and BamHI cutting sites of the SEQ ID NO4, the rest sequences are part of the reverse complementary sequence of the SEQ ID NO 3. The method comprises the following specific steps: the nucleotide fragments from the 19 th to 441 th nucleotides from the 5 'end of SEQ ID NO4 are the reverse complementary sequence from the 24 th to 446 th nucleotides from the 5' end of SEQ ID NO 3. Therefore, the product b is the antisense interference fragment of the OsMADS1 gene.

2. Construction of pOsGluB-4 (OsMADS 1(antisense) -RNAi vector) inserted into antisense interference fragment of OsMADS1 Gene

(1) OsMADS1 gene antisense interference fragment double enzyme digestion connection clone

The pOsGluB-4-RNAi vector constructed in the first example was digested with BamHI and MluI, and the results are shown in FIG. 11, and detected by electrophoresis using the pOsGluB-4-RNAi vector digested with BamHI and MluI, lane 1, BM5000+ DNA Marker (Bomaide organism); lane 2 is a pOsGluB-4-RNAi linearized vector digested with BamHI and MluI.

The antisense interference fragment of OsMADS1 gene (i.e. product b) was double-digested with BamHI and MluI, and the results are shown in FIG. 12, and the antisense interference fragment b of OsMADS1 gene was detected by electrophoresis with BamHI and MluI, lane 1: DL2 k DNA marker; lane 2: the OsMADS1 gene antisense interference fragment is obtained by double enzyme digestion of BamHI and MluI.

The double-digested antisense interference fragment of the OsMADS1 gene was ligated to a double-digested linearized vector between BamHI and MluI sites of the multiple cloning site at the right side of the AtFAD2 intron using T4 DNA ligase from Beijing Alyjin Biotechnology Ltd (cat # FL101-01) according to the procedures of the specification to obtain a ligation product, i.e., the desired pOsGluB-4:OsMADS 1(antisense interference fragment) -RNAi vector (antisense interference fragment inserted). The ligation product was transformed into Trans 5. alpha. competent cells according to the method described in example I, and the transformed cells were then spread on LB agarose plates containing kanamycin uniformly and cultured overnight at 37 ℃ to obtain transformed colonies.

(2) Identification of pOsGluB-4:: OsMADS1(antisense) -RNAi recombinant vector (insertion of antisense interference fragment)

The colony clones of several transformants in (1) above were selected and marked with marker pens, and dipped with appropriate amounts of monoclonal colony cells as PCR amplification templates, and colony PCR amplification was performed using AtFAD2-F primer at the end of AtFAD2 intron of pOsGluB-4-RNAi vector and 1390RNAi-R primer on the right side of the right side multiple cloning site of AtFAD2 intron, using 2 × Taq Plus Mastermix (Dye) PCR enzyme from Beijing kang, century Biotechnology Co., Ltd, to screen and identify pOsGluB-4:OsMADS 1(antisense interference fragment insert) with OsMADS1 gene antisense interference fragment insert. The PCR reaction system and the amplification procedure were the same as those in the case of amplifying the cells of the monoclonal colonies in example one. The AtFAD2-F and 1390RNAi-R primer sequences are shown below:

AtFAD2-F:5’-CCTTTCACAACCTGATTTCCCA-3’；

1390RNAi-R:5’-TAATCATCGCAAGACCGGCAACAGG-3’。

the PCR products were detected by gel electrophoresis, and the results are shown in FIG. 13, lane 1: BM2000 DNA Marker (bmede bio); lanes 2-10: the monoclonal colonies used as template for PCR contained or did not contain pOsGluB-4:: OsMADS1(antisense interference fragment) -RNAi recombinant vector (insert). As can be seen, the DNA band of about 800bp (lanes 2-7, 9 and 10) is the positive clone of the recombinant vector containing pOsGluB-4:OsMADS 1(antisense) -RNAi.

Selecting positive clones, sending to Chengdu Hingxi Biotechnology Limited company for sequencing, wherein sequencing primers are AtFAD2-F and 1390RANi-R, the sequences are shown as SEQ ID NO 6, comparing SEQ ID NO 6 with SEQ ID NO4 by using NADMAN5.0 sequence comparison software, and the comparison result is shown as figure 14. As can be seen from the figure, the interfering fragment of SEQ ID NO4 (i.e., antisense sequence of OsMADS1 gene) has been successfully cloned between BamHI and MluI cleavage sites of the right multiple cloning site of AtFAD2 promoter of pOsGluB-4-RNAi vector, and therefore, the vector was named pOsGluB-4:: OsMADS1(antisense) -RNAi vector (inserted antisense interfering fragment).

3. Obtaining pOsGluB-4 inserted with positive and negative interference fragments of OsMADS1 gene

(1) Double enzyme digestion connection cloning of OsMADS1 gene sense interference fragment

The pOsGluB-4:: OsMADS1(antisense interference fragment) -RNAi vector (insertion antisense interference fragment) obtained in the above step 2 was double-digested with KpnI and SacI to obtain pOsGluB-4:: OsMADS1(antisense interference fragment) -RNAi linearized vector (insertion antisense interference fragment). The results are shown in FIG. 15, lane 1: BM5000+ DNA Marker (bmede organism); lane 2: KpnI and SacI double-digested pOsGluB-4: OsMADS1(antisense interference fragment) -RNAi linearized vector (inserted).

The sense interference fragment of OsMADS1 gene (i.e., product a) was double-digested with KpnI and SacI, and the result is shown in FIG. 16, lane 1: BM2000 DNA Marker (bmede bio); lane 3: the OsMADS1 gene sense interference fragment is subjected to double digestion by KpnI and SacI.

The double-digested OsMADS1 gene sense interference fragment is connected between KpnI and SacI enzyme cutting sites of a multiple cloning site on the left side of an AtFAD2 intron on an OsMADS1(antisense interference fragment) -RNAi linearization vector (inserting antisense interference fragment) by using T4 DNA ligase of Beijing holotype gold biology, Inc. according to the steps of the instruction, a ligation product is obtained, namely the pOsGluB-4 which is simultaneously inserted with the positive and reverse interference fragments of the OsMADS1 gene, and the OsMADS1-RNAi vector. The ligation products were transformed into Trans 5. alpha. competent cells in the same manner, and the transformed cells were spread evenly on LB agarose plates containing kanamycin and cultured overnight at 37 ℃ to obtain transformed colonies.

(2) Identifying pOsGluB-4 inserted with positive and negative interference fragments of OsMADS1 gene simultaneously as OsMADS1-RNAi vector

Selecting several transformant colony cells in the step (1), respectively marking the colony cells with a marker pen, respectively dipping a proper amount of the monoclonal colony cells as a PCR amplification template, carrying out colony PCR amplification by using a pOsGluB-4-F1 primer positioned at the tail of a pOsGluB-4-RNAi vector pOsGluB-4 promoter and an AtFAD2-R primer positioned at the front end of an AtFAD2 intron, and using 2 XTaq Plus Mastermix (Dye) PCR enzyme of Beijing kang, century Biotech Limited to screen and identify pOsGluB-4:: OsMADS1-RNAi recombinant vectors which are simultaneously inserted into positive and negative interference fragments of an OsMADS1 gene. The PCR reaction system and the amplification procedure were the same as those in the case of amplifying cells of a single colony in example one. The pOsGluB-4-F1 and AtFAD2-R primer sequences are shown as follows:

pOsGluB-4-F1:5’-CATCCGATCGCCATCATC-3’；

AtFAD2-R:5’-GAAGCGACGGACCTGGAGAT-3’。

the results are shown in FIG. 17, lane 1: BM2000 DNA Marker (bmede bio); lanes 2-13: the single colony as the PCR template contains or does not contain pOsGluB-4 with OsMADS1 gene sense interference fragment insertion, OsMADS1-RNAi recombinant vector clone; lane 14: the template was sterile water control. As can be seen from the figure, the DNA bands of about 600bp (

lanes

2,4, 5, 7, 8, 10, 12 and 13) were obtained as positive clones carrying the pOsGluB-4:: OsMADS1-RNAi recombinant vector.

And selecting positive clones to be sequenced, wherein initial sequencing primers are pOsGluB-4-F and AtFAD2-R primers, the company further designs sequencing primers to perform additional sequencing, and after sequencing is completed, the sequencing result sequence is shown as SEQ ID NO 7, namely the combined sequence of the pOsGluB-4 promoter and the OsMADS1 sense interference fragment. As seen from the sequence, the forward cloning of SEQ ID NO 3 (i.e., the sense interference fragment of the OsMADS1 gene) in the sequence Listing has been successfully performed between Kpn I and SacI cleavage sites of the multiple cloning site on the left side of the AtFAD2 intron of OsMADS1(antisense interference fragment insertion) to thereby successfully obtain an RNAi vector into which the sense interference fragment of OsMADS1 is inserted, and the vector has been named pOsGluB-4:OsMADS 1-RNAi; the DNA sequence is shown as SEQ ID NO 10.

Specific construction process of OsGluB-4 OsMADS1-RNAi vector is shown in FIG. 7, and the core structure schematic diagram is shown in FIG. 18, which is a plant binary vector. OsMADS 1-RNAi's main functional elements include a seed specific promoter pOsGluB-4 capable of specifically starting the expression of shRNA containing OsMADS1 sense and antisense interference fragments in the seed development stage and seeds, an Arabidopsis AtFAD2 (fatty acid desaturase 2) gene intron (used for forming a ring structure in shRNA), an OsMADS1 sense interference fragment between KpnI and SacI enzyme cutting sites on the left side of the AtFAD2 gene intron, an OsMADS1 antisense interference fragment between BamHI and MluI enzyme cutting sites on the right side of the AtFAD2 gene intron, an NOS terminator, kanamycin and hygromycin screening marker genes, and the like.

The above examples are only given to a method for constructing the pOsGluB-4:: OsMADS1-RNAi vector, and in the case that the core structure of the pOsGluB-4:: OsMADS1-RNAi vector is known, those skilled in the art can also construct the vector by other equivalent methods, and the vectors with the same function, the same structure or similar obtained by the equivalent methods also fall into the protection scope of the present invention.

For example, a double-restriction ligation method can be adopted, wherein an OsMADS1 gene sense interference fragment and a pOsGluB-4-RNAi vector are subjected to double-restriction ligation to construct an intermediate vector, and an OsMADS1 gene antisense interference fragment and the intermediate vector are subjected to double-restriction ligation, so that a pOsGluB-4 gene antisense-interference vector OsMADS1-RNAi vector can also be obtained.

For another example, homologous recombination-directed cloning can also be performed, as follows: firstly, carrying out enzyme digestion on the pOsGluB-4-RNAi vector by using KpnI and SacI to obtain a linearized pOsGluB-4-RNAi vector; then, the product a (OsMADS1 gene sense interference) is cloned to the left multiple cloning site of the intron of the pOsGluB-4-RNAi vector FAD2 gene by using the homologous recombination directional cloning method in the first embodiment, and the pOsGluB-4:: OsMADS1(sense) -RNAi (insertion sense interference fragment) intermediate vector is obtained; then BamHI and MluI are used to double-digest pOsGluB-4:: OsMADS1(sense) -RNAi (insertion of sense interference fragment) intermediate vector to obtain linearized pOsGluB-4:: OsMADS1(sense) -RNAi (insertion of sense interference fragment) intermediate vector, and product b (OsMADS1 gene antisense interference fragment) is cloned to pOsGluB-4:: OsMADS1(sense) -RNAi (insertion of sense interference fragment) intermediate vector AtFAD2 gene intron right side multiple cloning site by using the homologous recombination targeted cloning method in the example I, and pOsGluB-4:: OsMADS1-RNAi vector can also be obtained.

Comparative example: construction of pUbi:OsMADS 1-RNAi vector

1. Selection of constitutively aligned RNA interference vectors

The ubiquitin promoter pUbi, derived from maize, is one of the most widely accepted constitutive promoters. The use of RNAi vectors such as pLHRNAi using constitutive promoters such as pUbi effectively suppresses the expression of target genes in rice (Li H, Jiang L, Youn JH, et al. A complex genetic expression a crystalline role of CYP90D2/D2 in regulating plant architecture in rice [ J ]. New Phytologist,2013,200(4):1076-1088.), but does not specifically interfere with the expression in seeds, but rather may affect the normal function of these target genes in vegetative organs and flowers, which may affect the normal growth and development of rice, ultimately reducing yield and rice quality.

2. Referring to the method of the first and second examples, pUbi (plasmid: OsMADS1-RNAi) vector was constructed. The method specifically comprises the following steps:

(1) obtaining pLHRNAi vector, wherein the sequence of the pLHRNAi vector is shown as SEQ ID NO 11.

(2) Positive and antisense interfering fragments of OsMADS1 gene were obtained by the method of example two. The electrophoresis detection of the PCR amplification result of the OsMADS1 gene positive and antisense interfering fragment is shown in FIG. 19, lane 1: BM2000 DNA Marker (bmede bio); lane 2: a sense interfering fragment of the OsMADS1 gene; lane 3: OsMADS1 gene antisense interference fragment.

(3) According to the method of example two, the antisense interference fragment of OsMADS1 gene was inserted into pLHRNAi vector to obtain pUbi vector containing the antisense interference fragment of OsMADS1 gene, OsMADS1(antisense) -RNAi vector.

The method comprises the following specific steps:

1) OsMADS1 gene antisense interference fragment double enzyme digestion connection clone

The pLHRNAi vector was digested with BamHI and MluI enzymes, as shown in FIG. 20, lane 1: BM5000+ DNA Marker (bmede bio); lane 2: the vector is linearized by pLHRNAi digested by BamHI and MluI.

The antisense interference fragment of OsMADS1 gene was digested with BamHI and MluI, and the results are shown in FIG. 21, lane 1: BM2000 DNA Marker (bmede bio); lane 3: the OsMADS1 gene antisense interference fragment is obtained by double enzyme digestion of BamHI and MluI.

The OsMADS1 gene antisense interference fragment which is subjected to double enzyme digestion by BamHI and MluI is connected between BamHI and MluI enzyme digestion sites of a multiple cloning site at the right side of an AtFAD2 intron on a pLHRNAi linearization vector by using T4 DNA ligase of Beijing holotype gold biology, Inc. according to the steps of the instruction, and a connection product, namely required pUbi which is inserted into the OsMADS1 gene antisense interference fragment is obtained, wherein the pUbi is OsMADS1(antisense) -RNAi vector.

The ligation products were transformed into Trans 5. alpha. competent cells, and the transformed cells were spread evenly on LB agarose plates containing kanamycin and cultured overnight at 37 ℃ to obtain transformed colonies.

2) Identification of pUbi inserted with antisense interfering fragment of OsMADS1 Gene by the method of example two OsMADS1(antisense) -RNAi recombinant vector

The colony clones of the transformed strains in the step 1) are selected and marked by marker pens respectively, and dipped with a proper amount of monoclonal colony cells respectively as PCR amplification templates, and colony PCR amplification is carried out by using an AtFAD2-F primer at the tail of an intron of a pLHRNAi vector AtFAD2 and a 1390RNAi-R primer on the right side of a multiple cloning site on the right side of the intron of AtFAD2 and using 2 XTaq Plus Mastermix (Dye) PCR enzyme of Beijing kang, century Biotech Limited to screen and identify a pUbi vector with the insertion of an OsMADS1 gene antisense interference fragment, namely OsMADS1(antisense interference) -RNAi (insertion antisense interference fragment) recombinant vector. The PCR reaction system and PCR amplification procedure are shown in examples one and two. AtFAD2-F and 1390RNAi-R primer sequences are shown below:

AtFAD2-F:5’-CCTTTCACAACCTGATTTCCCA-3’；

1390RNAi-R:5’-TAATCATCGCAAGACCGGCAACAGG-3’。

the results are shown in FIG. 22, lane 1: BM2000 DNA Marker (bmede bio); lanes 2-7, 9-13: the monoclonal colony used as the PCR template contains pUbi with OsMADS1 gene antisense interference fragment inserted into OsMADS1(antisense interference fragment inserted) recombinant vector. As can be seen from the figure, the DNA band of about 750bp is the positive clone of the recombinant vector carrying pUbi:: OsMADS1(antisense interference fragment) -RNAi (insertion antisense interference fragment).

The positive clones were selected and sent to Chengdu Hingxi Biotechnology Limited for sequencing, with the sequencing primers AtFAD2-F and 1390RANi-R, the sequences shown in SEQ ID NO 6, and the same as the pOsGluB-4 inserted into the antisense interference fragment of OsMADS1 gene, OsMADS1(antisense) -RNAi vector. The comparison of SEQ ID NO 6 and SEQ ID NO4 with NADMAN5.0 sequence comparison software shows that the interfering fragment of SEQ ID NO4 (i.e. the antisense sequence of OsMADS1 gene) in the sequence list has been cloned into a recombinant vector between BamHI and MluI restriction sites of the multiple cloning site at the right side of AtFAD2 promoter of pLHRNAi vector.

(4) According to the method of example two, the sense interfering fragment of OsMADS1 gene was inserted into pUbi: (OsMADS 1(antisense) -RNAi vector) into which the antisense interfering fragment of OsMADS1 gene had been inserted, obtained in step (3), to obtain pUbi: (OsMADS 1-RNAi vector) into which the sense interfering fragment of OsMADS1 gene was inserted. The specific method comprises the following steps:

1) double enzyme digestion connection cloning of OsMADS1 gene sense interference fragment

The pUbi:: OsMADS1(antisense) -RNAi vector inserted with the antisense interference fragment of OsMADS1 gene obtained by the double digestion step (3) with KpnI and SacI, the results are shown in FIG. 23, Lane 1: BM2000 DNA Marker (bmede bio); lane 2: pUbi (OsMADS 1(antisense interference fragment) vector subjected to double enzyme digestion by KpnI and SacI.

The sense interference fragment of OsMADS1 gene was double-digested with KpnI and SacI, and the result is shown in FIG. 24, the sense interference fragment a of OsMADS1 gene was double-digested with KpnI and SacI, Lane 1: BM2000 DNA Marker (bmede bio); lane 3: the OsMADS1 gene sense interference fragment is subjected to double digestion by KpnI and SacI.

The sense interference fragment of the OsMADS1 gene which is subjected to double enzyme digestion by KpnI and SacI is connected between KpnI and SacI enzyme digestion sites of a multi-cloning site on the left side of an AtFAD2 intron on an OsMADS1(antisense interference fragment) -RNAi (antisense interference fragment) linearized vector by using T4 DNA ligase of Beijing holotype gold biology, Inc. according to the steps of the instruction, a connection product is obtained, and the connection product is the required pUbi which is simultaneously inserted with the sense interference fragment and the antisense interference fragment of the OsMADS1 gene, and the OsMADS1-RNAi vector is named as pUbi:OsMADS 1-RNAi vector.

2) Screening and identifying pUbi, namely OsMADS1-RNAi recombinant vector

Selecting several transformant colony cells in the step 1), respectively marking the colony cells with a marker pen, respectively dipping a proper amount of monoclonal colony cells as a PCR amplification template, carrying out colony PCR amplification by using a pUbi-F primer positioned at the tail of a pUbi promoter of a pLHRNAi vector and an AtFAD2-R primer positioned at the front end of an intron of AtFAD2, and using 2 xTaq Plus MasterMix (Dye) PCR enzyme of Beijing kang, century Biotechnology Limited to screen and identify the pUbi vector with the insertion of the positive-sense interference fragment of the OsMADS1 gene, namely an OsMADS1-RNAi recombinant vector. Colony PCR reaction system and PCR amplification procedure are shown in example one. The primer sequences for pUbi-F and AtFAD2-R are shown below:

pUbi-F:5’-TGCCTTCATACGCTATTTATTTGC-3’；

AtFAD2-R:5’-GAAGCGACGGACCTGGAGAT-3’。

as shown in FIG. 25, PCR identified pUbi:OsMADS 1-RNAi recombinant vector, lane 1: BM2000 DNA Marker (bmede bio); lanes 2-11: a single colony used as a PCR template contained pUbi with a sense interference fragment of OsMADS1 gene, OsMADS1-RNAi recombinant vector clone. As can be seen from the figure, the DNA band of about 750bp is the positive clone of the OsMADS1-RNAi recombinant vector with pUbi:. Selecting positive clones and sequencing, wherein the sequencing primers are pUbi-F and AtFAD2-R primers, the sequence is shown as SEQ ID NO 8, the sequencing result is compared with SEQ ID NO 3, and the comparison result shows that the SEQ ID NO 3(OsMADS1 gene sense interference fragment) in the sequence table is positively cloned between Kpn I and SacI enzyme digestion sites of a multiple cloning site on the left side of an intron of an OsMADS1(antisense interference fragment) -RNAi (insertion antisense interference fragment) vector AtFAD 2.

pUbi (plasmid DNA) the core structure of OsMADS1-RNAi plant binary vector is schematically shown in FIG. 26, and its main functional elements include constitutive promoter pUbi capable of promoting the expression of shRNA containing sense and antisense interference fragments of OsMADS1 in the whole development stage of plant, Arabidopsis thaliana AtFAD2 (fatty acid desaturase 2) gene intron (used to form a loop structure in shRNA), OsMADS1 sense interference fragment between Kpn I and SacI cleavage sites on the left side of AtFAD2 gene intron, OsMADS1 antisense interference fragment between BamHI and MluI on the right side of AtFAD2 gene intron, NOS terminator, kanamycin and hygromycin screening marker gene, etc.

Example three: specific application and effect display of pOsGluB-4 OsMADS1-RNAi seed specific interference vector

Firstly, the pOsGluB-4 constructed in the second example and the comparative example, OsMADS1-RNAi and the pUbi, OsMADS1-RNAi plasmid are sent to Hangzhou Baige Biotechnology Co., Ltd to respectively transform a rice variety Nipponbare. The transformation procedure was as follows:

1. callus induction and subculture of mature rice seeds

Selecting mature rice seeds, stripping glumes, pouring the rice seeds into a 50ml centrifugal tube, adding 75% ethanol for disinfection for 1min, pouring off the ethanol, washing the rice seeds with sterile water once, pouring off the rice seeds, adding 30% sodium hypochlorite for disinfection for 20min, pouring off the sodium hypochlorite, and washing the rice seeds with the sterile water for 5-6 times. And (4) sucking excess water by using a liquid transfer gun, and transferring the seeds to an induction culture medium, wherein 20-25 seeds are placed in each dish. After the callus grows out, the protoembryo can be directly used for transformation; the small particles grown beside the proembryo can be picked up to a new induction medium for subculture, and can be transformed when growing to a proper size.

The formula of the induction culture medium (1L) is as follows: to 1L N6 minimal medium (CHU' S N6 basal medium, available from phytotechnology laboratories, USA) was added 20000 Xmicro-element mother liquor 50. mu.l, 200 XEDTA-Fe²⁺5ml of mother liquor, 5ml of 200 XB 5 organic salt mother liquor, 1ml of 2,4-D mother liquor with the concentration of 2mg/ml, CaCl₂0.22g, proline 0.5g, hydrolyzed protein 0.3g, sucrose 30g and plant gel 3g, and the pH value is adjusted to 5.8.

The formula of the 20000 multiplied microelement mother liquor (100ml) is as follows: h₃BO₃ 0.62g，KI 0.083g，MnSO₄·4H₂O 2.23g，ZnSO₄·7H₂O 0.86g，Na₂MoO₄·2H₂O 0.025g，CuSO₄·5H₂O 0.0025g，CoCl₂·6H₂O 0.0025g。

The 200 × EDTA-Fe²⁺The mother liquor (500ml) formulation was: c₁₀H₁₄N₂Na₂3.73g of O8 (sodium ethylene diamine tetracetate) and 3.73g of FeSO4 & 7 H202.78g.

The 200 XB 5 organic salt mother liquor (100ml) has the following formula: 10.2g of vitamin B, 60.02g of vitamin B, 0.02g of nicotinic acid and 2g of inositol.

2. Agrobacterium culture

Respectively transferring pOsGluB-4, OsMADS1-RNAi vector and pUbi, OsMADS1-RNAi vector into Agrobacterium EHA105 strain by freeze-thawing method to obtain monoclonal colony. After identifying and obtaining the transformed agrobacterium EHA105 containing pOsGluB-4, OsMADS1-RNAi vector and pUbi, OsMADS1-RNAi vector, dipping a proper amount of monoclonal thallus into a liquid culture medium containing kanamycin and rifampicin antibiotics for overnight culture under the dark condition of 28 ℃, and then adding glycerol for storage in a refrigerator of-80 ℃ for later use. When in use, the agrobacterium EHA105 is streaked on a culture medium containing kanamycin and rifampicin antibiotics respectively, and cultured in the dark at 28 ℃ for 2d until single colonies appear.

The steps of transferring the carrier by the freeze-thaw method are as follows:

(1) thawing agrobacterium EH105 (said agrobacterium EH105 is stored at the institute for adults and biological research, academy of sciences, china) competent cells on ice; adding 1-2 μ l of each carrier, performing ice bath for 30min, freezing in liquid nitrogen for 1min, and performing water bath at 37 ℃ for 3 min.

(2) Adding 500. mu.l YEB liquid culture medium (without resistance), recovering at 28 deg.C and 200rpm/min for 3 hr to obtain bacterial liquid.

(3) And (3) coating the bacterial liquid on a solid culture medium containing kanamycin and rifampicin antibiotics, culturing in the dark at 28 ℃ for 2 days until single colonies appear, and selecting for monoclonal identification.

The YEB liquid culture medium comprises: 5g/L of Beef extract, 1g/L of Yeast extract, 5g/L of Peptone, 5g/L of Sucrose, 0.4g/100ml of MgSO 2₄.7H₂O, adjusting the pH value to 7.0 and 120 DEG CSterilizing at high temperature and high pressure.

The culture medium containing kanamycin and rifampicin antibiotics is as follows: adding 1.5g Agar into 100ml YEB liquid culture medium, sterilizing at 120 ℃ under high temperature and high pressure, adding 100 mu L kanamycin antibiotic mother liquor with the concentration of 50mg/ml and 125 mu L rifampicin antibiotic mother liquor with the concentration of 20mg/ml respectively when the temperature is 60-70 ℃, uniformly mixing, and pouring into a sterilized culture dish to ensure that the final concentrations of kanamycin and rifampicin in the culture medium are respectively 50mg/L and 25mg/L for later use.

3. Agrobacterium infection callus

Preparing hypertonic culture solution (AAM), sucking the culture solution by a liquid-moving machine, washing the agrobacterium on the plate, and adjusting the concentration of the bacteria to OD₆₀₀And the concentration is 0.3-0.5, namely the agrobacterium tumefaciens suspension for infecting and transforming the rice.

The formula of the hypertonic culture solution (1L) is as follows: 50ml of 20 XaaM bulk salt mother liquor, 5ml of 200 XabB 3 trace salt mother liquor, 5ml of the above 200 XB 5 organic salt mother liquor, and the above 200 XatDA-Fe²⁺5ml of mother liquor, 1ml of acetosyringone mother liquor (prepared in situ), 68.5g of sucrose, 36g of glucose, 0.5g of hydrolyzed casein, 0.876g of glutamine, 0.266g of aspartic acid, 0.1740.266g of arginine and 0.0075g of glycine, and the pH value is adjusted to be 5.8.

The formula of the 20 xAAM bulk salt mother liquor (1L) is as follows: KCl 59g, CaCl₂·H ₂0 3g，MgSO₄·7H ₂0 10g，NaH₂P0₄·H ₂0 3g。

The 200 XNBO B3 trace salt mother liquor (1L) has the formula as follows: MnSO₄·4H₂O 2.64 3g，ZnSO₄·7H ₂0 0.4g，H₃BO₃ 0.6g，KI 0.15g，Na₂MoO₄·2H ₂0 0.05g，CuSO₄·5H₂O 0.005g，CoCl₂·6H₂O 0.005g。

The formula of the acetosyringone mother liquor (1ml) is as follows: 0.03925g of acetosyringone were weighed out and dissolved in 1ml of DMSO (dimethyl sulfoxide).

And (3) selecting enough number of callus tissues (good callus state, bright yellow color, mellow and hard texture and proper particle diameter of about 3 mm) obtained in the step (1) and putting the callus tissues into a 100ml sterile triangular flask, and adding a proper amount of agrobacterium tumefaciens suspension to ensure that the agrobacterium tumefaciens suspension can be fully contacted with the callus tissues. The infection was left at room temperature for 20 minutes without shaking. The Agrobacterium suspension was then decanted, and the calli were blotted on sterile filter paper to remove excess Agrobacterium suspension, transferred to a co-culture medium with a layer of sterile filter paper and incubated in the dark at 26 ℃ for 3 days.

The formula of the co-culture medium (1L) is as follows: in 1L MS minimal medium (Murashige)&Skoog basic Medium available from Phytotechnology laboratories, USA) to which 200 × EDTA-Fe was added²⁺5ml of mother liquor, 1ml of 2mg/ml 2,4-D mother liquor, 0.5g of proline, 0.3g of hydrolyzed protein, 30g of cane sugar, 10g of glucose and 3g of plant gel, adjusting the pH value to 5.8, and adding 1ml of acetosyringone mother liquor when the gel is about to be poured after sterilization.

4. Screening culture of impregnated callus

The callus after 3 days of co-culture is subjected to a cleaning step, which specifically comprises the following steps: the calli on the co-culture medium were transferred to a sterilized Erlenmeyer flask with a 1ml sterile blue tip, rinsed twice with sterile water and once again with sterile water containing 500. mu.l/L carbenicillin in the third pass. And (3) absorbing excessive water by using a pipette gun, transferring the callus onto sterile filter paper, blowing the water on the callus by using wind of a super clean bench for about 30min, transferring the callus onto a screening culture medium for screening culture after the callus is dried, wherein the culture condition is 28-30 ℃, and performing dark culture. The screening time is 3-4 weeks.

The formula (1L) of the screening culture medium is as follows: 5ml of 200 XNBO B3 trace salt mother liquor, 5ml of 200 XL 3 ferric salt mother liquor, 5ml of 200 XL 3 organic salt mother liquor, 1.25ml of 2mg/ml 2,4-D mother liquor, 0.5G of proline, 0.5G of glutamine, 0.3G of hydrolyzed protein, 30G of maltose and 3G of plant gel are added into 1L MS minimal medium, the pH value is adjusted to be 5.8, and 1ml of the G418 screening antibiotic mother liquor with the concentration of 50mg/ml, 0.8ml of hygromycin mother liquor with the concentration of 50mg/ml and 2ml of penicillin mother liquor with the concentration of 200mg/ml are added when gel pouring is carried out after sterilization.

The formula of the 200 xL 3 ferric salt mother liquor (1L) is as follows: c₁₀H₁₄N₂Na₂O₈(sodium ethylenediaminetetraacetate) 14.90g, FeSO₄.7H₂0 11.18g。

5. Differentiation and regeneration of resistant callus

Culturing until the color is bright yellow and resistant callus with the diameter of 1-2 mm grows out. At this time, the hygromycin-resistant callus can be picked up on a differentiation medium for differentiation and regeneration. Placing 16 positive calluses on each differentiation dish, and placing the calluses in a greenhouse at 28-30 ℃ for illumination culture. Culturing for about 10 days, allowing the callus to emit green spots, and differentiating to obtain seedlings after about 10 days.

The formula of the differentiation medium (1L) is as follows: 5ml of 200 XNBO B3 trace salt mother liquor, 5ml of 200 XL 3 ferric salt mother liquor, 5ml of 200 XL 3 organic salt mother liquor, 4ml of KT mother liquor with the concentration of 0.5mg/ml, 2ml of IAA mother liquor with the concentration of 0.1mg/ml, 0.5g of proline, 0.5g of glutamine, 0.8g of hydrolyzed protein, 30g of maltose and 3g of plant gel are added into a 1L N6 basic culture medium, the pH value is adjusted to be 5.8, 0.6ml of hygromycin mother liquor with the concentration of 50mg/ml and 2ml of penicillin mother liquor with the concentration of 200mg/ml are added when gel is poured after sterilization.

6. Rooting of seedlings

And when the differentiated seedlings grow to about 2-3 cm and have obvious root systems, transferring the seedlings into root growing tubes filled with a rooting culture medium to grow the seedlings, wherein the rooting culture condition is 28-30 ℃, and performing sterile illumination culture.

The formula of the rooting medium (1L) is as follows: adding 200 × MS microelement mother liquor 2.5ml into 1L MS minimal medium, the above 200 × EDTA-Fe²⁺2.5ml of mother liquor, 2.5ml of 200 XMS organic element mother liquor, 1ml of IBA mother liquor with the concentration of 0.4mg/ml, 20g of cane sugar and 3g of plant gel, adjusting the pH value to 5.8, and adding 2ml of penicillin mother liquor with the concentration of 200mg/ml after sterilization and when pouring gel.

The formula of the 200 XMS organic element mother liquor (1L) is as follows: MnSO₄·4H₂O 4.46g，ZnSO₄·7H₂O 1.72g，H₃BO₃ 1.24g，KI 0.166g，Na₂MoO₄·2H₂O 0.05g，CuSO₄·5H₂O 0.005g，CoCl₂·6H₂O 0.005g。

The 200 x organic salt mother liquor (250ml) formulation is: 0.1g of glycine, 10.005g of vitamin B, 60.025g of vitamin B, 5g of inositol and 0.025g of nicotinic acid.

Second, pOsGluB-4 shows the effect of OsMADS1-RNAi seed specific interference vector transgenic rice

1. pOsGluB-4 OsMADS1-RNAi seed specific interference vector transgenic rice genotype identification.

pOsGluB-4 OsMADS1-RNAi vector transgenic rice T₀And identifying the genotype of the generation plant.

The total of the steps of obtaining pOsGluB-4, OsMADS1-RNAi transgenic rice T₀And 24 seedlings are planted. DNA in the seedling leaves is extracted by a CTAB method respectively, and PCR amplification is carried out by taking HYG-F9 and HYG-R as primers respectively. The primer sequences of HYG-F9 and HYG-R9 are as follows:

HYG-F9：5’-GGGTGTCACGTTGCAAGACC-3’；

HYG-R9:5’-ATGCCTCCGCTCGAAGTAGC-3’。

the designed target band was 472bp, and the identification result is shown in FIG. 27. pOsGluB-4: OsMADS1-RNAi vector T₀And (3) carrying out PCR screening, identification and electrophoresis detection on transgenic positive plants, wherein M: BM2000 DNA Marker (bmede bio); 1-24: the template is OsMADS1-RNAi vector T from pOsGluB-4₀DNA of transgenic plant leaves is substituted; 25: the template is sterile water control; 26: the template is from pOsGluB-4: OsMADS1-RNAi plasmid; 27 template DNA from leaves of Nippon rice. As can be seen from the figure, the DNA band of about 500bp (lanes 1-24) obtained is pOsGluB-4:: OsMADS1-RNAi transgenic positive rice plant. 24 strains of pOsGluB-4 which are positive through PCR identification are obtained in total, namely OsMADS1-RNAi vector T₀Generating transgenic rice plant, and forming T by using the 24 transgenic positive plants₀The generation strain is named as pOsGluB-4: OsMADS 1-Ri. And transplanting OsMADS1-Ri plants in the rice planting season into a transgenic isolation garden, and observing and identifying the phenotype in the whole growth period.

2. pOsGluB-4 OsMADS1-RNAi seed specificity interference transgenic rice seed phenotype identification

(1) pOsGluB-4: OsMADS1-RNAi seed specificity interference transgenic rice flower phenotype identification

T in pOsGluB-4:: OsMADS1-Ri₀And (3) carrying out phenotype identification on flowers and floral organs of No. 5, No. 6 and No. 11 plants in the flower development and maturity period of the transgenic positive plants. The results are shown in FIG. 28, pOsGluB-4: OsMADS1-RNAi seed-specific interference vector T₀The scale bar in the flower organ phenotype identification chart of the generation positive plant is 1 mm. As can be seen from the figure, T numbers 5#, 6# and 11# were compared with Nipponbare of the wild type receptor control rice variety₀The glumes of the flowers of the generation plants are normally closed, and the shapes and the numbers of the flower organs such as the female stamens and the like are not obviously abnormal. The results show that: OsMADS1-RNAi seed specific interference vector is used for interfering the expression of OsMADS1 gene in the development stage and seeds of Nipponbare rice, and the development of transgenic rice flowers and the development, the number, the shape and the structure of flower organs are not influenced.

(2) pOsGluB-4 OsMADS1-RNAi seed specificity interference transgenic rice grain type identification

T in pOsGluB-4:: OsMADS1-Ri₀After the seeds of the generation transgenic positive plants are mature and harvested, the phenotypes of the grains of the No. 5, No. 6 and No. 11 plants are identified. The results are shown in FIG. 29, and pOsGluB-4: OsMADS1-RNAi seed specificity interferes with the grain type identification of transgenic rice. It can be seen from the figure that the inner and outer glumes of the seeds of the plants # 5, # 6 and # 11 are not completely closed and the seeds are slightly elongated compared with the seeds of the wild type receptor control rice variety nipponica. Among the appearance qualities of rice, the slimness of grain shape is a popular and advantageous trait in rice consumption markets such as southern China and southeast Asia.

The result shows that the pOsGluB-4 which is based on the pOsGluB-4-RNAi seed specific interference vector and aims at the OsMADS1 target gene is used, the OsMADS1-RNAi seed specific interference vector does not obviously influence the development of transgenic rice flowers and the development, the number, the shape and the structure of flower organs, and the transgenic rice obtains the favorable character of slender grain type which influences the appearance and the quality of the rice. Therefore, the OsMADS1-RNAi seed specific interference vector can effectively and specially research the specific regulation and control function of OsMADS1 on the development of seed morphology and the like, and the OsMADS1 gene has an important regulation and control effect on the morphological development of rice seeds, and the pOsGluB-4-RNAi and pOsGluB-4:, OsMADS1-RNAi seed specific interference vector has certain application potential and value in rice grain type gene engineering breeding.

3. pOsGluB-4 OsMADS1-RNAi seed specificity interference transgenic rice protein content determination

Taking the T of pOsGluB-4: OsMADS1-Ri₀And (3) replacing grains of the transgenic positive plants No. 5, No. 6 and No. 11, removing glumes by using a brown rice machine to obtain brown rice, grinding the brown rice into powder by using a grinding machine, measuring the total nitrogen content of the sample by using a Dumas combustion nitrogen determination method, and finally multiplying the conversion coefficient of the total nitrogen content of the rice and the total protein content by 5.95 to obtain the total protein content of the brown rice. The results are shown in fig. 30, and the total protein content of the brown rice of the 3 transgenic rice plants of nos. 5#, 6# and 11# is significantly higher than that of the Japanese fine, especially the protein content of the brown rice of the 6# plant is up to 13.86%, which is 14.59% higher than that of the Japanese fine.

The result shows that the pOsGluB-4 of the OsMADS1 target gene based on the pOsGluB-4-RNAi seed specific interference vector is used, the expression of the OsMADS1 gene in the seed is obviously and effectively reduced, the transgenic rice with normal flower and floral organs and extremely and obviously improved protein content is obtained, the specific regulation function of OsMADS1 on the rice protein content can be effectively and specially researched, the OsMADS1 gene has an important regulation function on the rice protein content, and the pOsGluB-4-RNAi and pOsGluB-4 have important application potential and value in rice protein genetic engineering breeding.

4. pOsGluB-4-RNAi and pOsGluB-4:OsMADS 1-RNAi seed specific interference vector beneficial effect display

The results in the

steps

2 and 3 show that the OsMADS1-RNAi seed specific interference vector which is based on the pOsGluB-4-RNAi interference vector and aims at the OsMADS1 target gene is used for obviously and effectively reducing the OsMADS1 gene expression level in the transgenic rice seeds, but the growth of the transgenic rice flowers and the growth, the number, the shape and the structure of flower organs are not obviously influenced, and the transgenic rice with long grain type and obviously improved rice protein content is obtained.

OsMADS1-RNAi seed specific interference vector can effectively and specifically research the specific regulation and control functions of OsMADS1 on seed morphological development and rice protein content, and shows that the OsMADS1 gene has an important regulation and control effect on rice seed morphological development and rice protein content. In addition, specific regulation functions of the expression genes in other seeds besides OsMADS1 on the morphological development of the seeds and the quality of rice can be studied purposely by using the pOsGluB-4-RNAi seed specific interference vector. Therefore, the seed specific interference vector pOsGluB-4-RNAi and the OsMADS1 seed specific interference vector pOsGluB-4, OsMADS1-RNAi have important application potential and value in rice grain type and rice quality genetic engineering breeding.

Third, control vector pUbi, OsMADS1-RNAi constitutive interference vector transgenic rice effect display

1. pUbi (plasmid DNA) OsMADS1-RNAi constitutive interference vector transgenic rice genotype identification

(1) pUbi:OsMADS 1-RNAi transgenic rice T₀Genotype identification of generation plant

In the steps, pUbi is obtained in all, OsMADS1-RNAi transgenic rice T₀And (3) generating 23 seedlings, extracting DNA in leaves of the seedlings by adopting a CTAB method, and performing PCR amplification by using HYG-F9 and HYG-R as primers. The primer sequences of HYG-F9 and HYG-R9 are as follows:

HYG-F9:5’-GGGTGTCACGTTGCAAGACC-3’；

HYG-R9:5’-TGCCTCCGCTCGAAGTAGC-3’。

the designed target band is 472bp, the identification result is shown in FIG. 31, pUbi:OsMADS 1-RNAi vector T₀Identifying transgenosis of the generation transformation plants, wherein M is BM2000 DNA Marker (Bomaide organism); 1-19, 21-24: the template is derived from pUbi:: OsMADS1-RNAi vector T₀DNA of transgenic plant leaves is substituted; 20: the template was sterile water control. As can be seen from the figure, the DNA band of about 500bp is pUbi:: OsMADS1-RNAi transgene positiveA rice plant. 23 strains of pUbi which are identified as positive by PCR are obtained in total, and OsMADS1-RNAi transgenic rice T₀Generating plants, and forming T by the 23 positive transgenic plants₀The generation line is named as pUbi, OsMADS 1-Ri. The same method as the second step is used for transplanting and planting the pUbi plants OsMADS1-Ri, and the phenotype is observed and identified in the whole growth period.

(2) pUbi:OsMADS 1-RNAi transgenic rice T₁Expression analysis of generation seeds OsMADS1

After pUbi shows that OsMADS1-Ri plants blossom and fruit, No. 2, No. 4 and No. 12T are selected₀Ears (including flowers) and 12 DAF seeds (T) at mature stage of generation plant₁Seed generation) were analyzed for the expression level of OsMADS1 gene. Taking wild transgenic receptor rice variety Nipponbare as a control, taking 3 mature flowers (and seeds samples of 12 DAF after flowering, quickly freezing by liquid nitrogen, and storing in a refrigerator at-80 ℃, then extracting Total RNA of the samples of the flowers by using a Plant Total RNA Isolation Kit (product number: RE-05011, purchased from Kyowa Biotechnology Co., Ltd.), extracting Total RNA of the samples of the seeds of the 12 DAF by using an RNAprep Pure polyphenol Plant Total RNA extraction Kit (product number: DP441, purchased from Tiangen Biochemical technology (Beijing) Co., Ltd.), reversely transcribing the Total RNA of the samples of the mature flowers and the seeds of the 12 DAF respectively as templates to obtain cDNA, using the cDNA as templates, using the expression level of the rice Actionn gene as an internal reference, and using a real-time fluorescent quantitative PCR (qRT-PCR) instrument to detect the expression level of the MADS1 gene in the mature flowers and the seeds of the 12 DAF, the primers are OsMADS1-F and OsMADS1-R, and the primer sequences are as follows:

OsMADS1-F:5’-CTACATGGACCATCTGAGCAATGA-3’；

OsMADS1-R:5’-AAGAGAGCACGCACGTACTTAG-3’。

the rice OsActin gene is used as an internal reference, and the primer sequence is as follows:

OsActin-F:5’-TGGAACTGGTATGGTCAAGGC-3’；

OsActin-R:5’-AGTCTCATGGATACCCGCAG-3’。

the results are shown in FIG. 32, NIP: wild type (Nipponbare) control seed plants; 2#, 4#, 12#: pUbi:OsMADS1-Ri constitutive interference transgeneRice plant T₁And (5) seed generation. Compared with wild rice, pUbi shows that OsMADS1-Ri constitutive interference transgenic rice plant T₀Flower and T of generations₁The OsMADS1 gene expression level in the generation seeds is extremely low, and is obviously reduced compared with the wild type. The results show that the use of pUbi-OsMADS 1-RNAi constitutive interference vector effectively inhibits the expression level of OsMADS1 gene in seeds and also interferes with the normal expression of OsMADS1 in flowers. Therefore, pUbi based on the constitutive interference vector pLHRNAi-the constitutive interference vector OsMADS1-Ri cannot specifically inhibit the expression level of OsMADS1 gene in seeds, and may influence the normal control effect of OsMADS1 gene on flower development.

2. pUbi (recombinant plasmid constructs) OsMADS1-RNAi constitutive interference transgenic rice phenotype identification and protein content determination

(1) pUbi: OsMADS1-RNAi constitutive interference transgenic rice floral phenotype identification

T at pUbi:: OsMADS1-Ri₀And (3) performing phenotype identification on flowers and floral organs of No. 2, No. 4 and No. 12 plants in the flower development and maturity period of the transgenic plants. The results are shown in FIG. 33, and pUbi:OsMADS 1-RNAi constitutively interfered with the phenotypic characterization of transgenic rice flowers. The scale bar in the figure is 1 mm. As can be seen from the figure,

T #

2,4 and 12 in comparison with the wild type control rice variety Nipponbare₀The glume of the generation plant flowers is abnormal in shape and can not be normally closed, and phenotypes such as abnormal extension of blade leaf materialization, reduction of stamen number, abnormal variation of the number, shape and structure of flower organs such as twins and pistils and the like appear.

The results show that the use of pUbi based on the constitutive interference vector pLHRNAi:: OsMADS1-RNAi constitutive interference vector interferes with the normal expression of OsMADS1 gene in flowers, and influences the normal control effect of OsMADS1 on flower development, resulting in pUbi:: T of OsMADS1-Ri₀The transgenic plant has abnormal phenotypes such as the number, the shape, the structural variation and the like of floral organs, and can influence the constitutive interference on the normal development, the setting rate and the shape of plant seeds.

(2) pUbi (recombinant plasmid constructs for expressing OsMADS1-RNAi constitutive interference transgenic rice setting percentage determination)

T in pUbi:: OsMADS1-Ri₀Seed maturation harvest of transgenic positive plantsThen, statistical analysis was performed on the seed set of plants # 2, # 4 and # 12. The results are shown in FIG. 34, OsMADS1 constitutively interferes with transgenic rice setting percentage statistics. As can be seen from the figure, numbers T2 #, 4# and 12#, respectively₀The seed setting rate of the generation plants is obviously reduced and is lower than 10 percent.

The result shows that the use of pUbi constructed based on the constitutive interference vector pLHRNAi, OsMADS1-RNAi constitutive interference vector, effectively inhibits the expression level of OsMADS1 gene in seeds, but also interferes with the normal expression of OsMADS1 in flowers, influences the normal regulation and control effect of OsMADS1 on flower development, and causes pUbi:OsMADS1-Ri T₀The transgenic plant has abnormal phenotypes such as floral organ number, morphology, structural variation and the like, so that the maturing rate of transgenic offspring is extremely low and the transgenic offspring is difficult to utilize in breeding and production. On the other hand, the use of pUbi based on pLHRNAi, in which OsMADS1-RNAi vector causes the abnormal variation of the number, morphology and structure of floral organs in transgenic offspring, affects fertilization and subsequent seed development, therefore, the direct specific regulatory function of OsMADS1 on rice seed development cannot be studied specifically by using pUbi.

(3) pUbi, OsMADS1-RNAi constitutive interference transgenic rice grain type identification

T in pUbi:: OsMADS1-Ri₀After the seeds of the generation transgenic positive plants are mature and harvested, the phenotypes of the grains of the No. 2, No. 4 and No. 12 plants are identified. The results are shown in FIG. 35, OsMADS1 constitutively interferes with transgenic rice grain type identification. As can be seen from the figure, compared with the wild type receptor control rice variety Nipponbare, No. 2, No. 4 and No. 12, the seeds of the plants have abnormal inner and outer glume forms and can not be normally closed, and the brown rice in the seeds is obviously reduced.

The result shows that the use of pUbi constructed based on the constitutive interference vector pLHRNAi, OsMADS1-RNAi constitutive interference vector, while effectively inhibiting the expression level of OsMADS1 gene in seeds, interferes with the normal expression of OsMADS1 in flowers, influences the normal regulation and control effect of OsMADS1 on flower development, and causes pUbi:OsMADS1-Ri T₀The transgenic plant has abnormal phenotypes such as the number, the form, the structural variation and the like of floral organs, so that the transgenic offspring not only has extremely low setting rate but also has seed germinationAbnormal breeding and morphological structure, and difficult utilization in breeding and production. On the other hand, the pUbi based on pLHRNAi is used, the OsMADS1-RNAi vector causes abnormal variation of the form and structure of the inner and outer palea of transgenic offspring, and the abnormal variation can influence the development of inner and outer glumes, the form structure and other aspects of seeds in the follow-up seeds, so that the direct specific regulation function of the OsMADS1 on the rice seed development cannot be specially researched by using the pUbi.

(4) pUbi, OsMADS1-RNAi constitutive interference transgenic rice protein content determination

Taking T of pUbi, OsMADS1-Ri₀And replacing grains of the transgenic positive plants No. 2#, No. 4# and No. 12# plants, removing glumes by using a brown rice machine to obtain brown rice, grinding the brown rice into powder by using a grinding machine, measuring the total nitrogen content of a sample by using a Dumas combustion nitrogen determination method, and finally multiplying the conversion coefficient of the total nitrogen content of the rice and the total protein content by 5.95 to obtain the total protein content of the brown rice. The results are shown in fig. 36, the total protein content of the brown rice of the 3 transgenic rice plants of # 2, # 4 and # 12 is significantly higher than that of the Japanese fine, and particularly, the protein content of the brown rice of the # 2 and # 12 plants is as high as 13.99% and 13.08%.

The results show that the use of pUbi based on the constitutive interference vector pLHRNAi, OsMADS1-RNAi constitutive interference vector, effectively inhibits the expression level of OsMADS1 gene in seeds, but also interferes with the normal expression of OsMADS1 in flowers, influences the normal regulation and control effect of OsMADS1 on flower development, and causes the T of pUbi, OsMADS1-Ri₀The transgenic plant has abnormal phenotypes such as floral organ number, morphology, structural variation and the like, so that the transgenic offspring not only has extremely low maturing rate, but also has abnormal seed development and morphological structure. Although the protein content of the progeny interfered by the OsMADS1 genome forming is remarkably improved, the protein content is seriously abnormal, the brown rice is obviously reduced, and the setting rate is extremely low, so that the protein content is difficult to utilize in breeding and production. On the other hand, using pUbi based on pLHRNAi, OsMADS1-RNAi vector resulted in significantly smaller morphological alterations of brown rice in transgenic offspring. The grain size of the brown rice and the ratio of the embryo and the endosperm to the brown rice are also important factors for determining the protein content of the rice. Thus, using pUbi:: OsMAD based on pLHRNAiThe S1-RNAi vector cannot be used for specially researching and distinguishing whether the protein content in transgenic offspring is improved as a result of direct regulation and control of the OsMADS1 gene on protein-related genes or as an indirect result of the protein content improvement caused by grain type change of the transgenic offspring brown rice.

3. Reference constitutive interference vectors pLHRNAi and pUbi, and the limitation of OsMADS1-RNAi in the research and application of specific function of expressed gene in seed.

The pLHRNAi vector has a pUbi constitutive expression promoter from corn, so that the constitutive interference efficiency in rice root, stem and leaf vegetative organs, flower organs and seeds is high. However, the advantage of high constitutive interference efficiency of pLHRNAi in various tissues and organs of rice results in pLHRNAi vector and pUbi constructed based on the vector, namely OsMADS1-RNAi constitutive interference vector, which has the technical limitation and the defect of direct specific regulation function of target genes such as OsMADS1 expressed in seeds on the development and quality of rice seeds because the expression of the target genes such as OsMADS1 expressed in seeds can not be specifically interfered but the normal expression and regulation function of the target genes such as OsMADS1 in flower organs and other nutritive organs are not interfered.

Aiming at the technical limitations and disadvantages of the pLHRNAi constitutive interference vector, the pOsGluB-4-RNAi and pOsGluB-4:: OsMADS1-RNAi seed specific interference vector is constructed by using the pLHRNAi vector skeleton advantages and the pOsGluB-4 seed specific promoter. OsMADS1-RNAi vector overcomes the technical limitations and disadvantages of pLHRNAi vector on the basis of utilizing the advantages of pLHRNAi vector, can specifically interfere the expression quantity of target genes in seeds but does not influence the expression quantity and normal functions of target genes in flower organs and other nutritive organs, thereby achieving the purpose of specifically researching the direct specific regulation and control functions of target genes such as OsMADS1 and the like expressed in the seeds on the development and quality of rice seeds, and simultaneously can specifically regulate and control the expression quantity of the target genes such as OsMADS1 and the like in the seeds, thereby achieving the purpose of improving the grain type and quality of the rice and utilizing the target genes in breeding.

Sequence listing

<110> institute of biological research of Chengdu of Chinese academy of sciences

<120> seed-specific interference vector containing pOsGluB-4 promoter and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1516

<212> DNA

<213> pOsGluB-4 promoter sequence (pOsGluB-4)

<400> 1

tgggcccggc gcgccaagct ttacagggtt ccttgcgtga agaagggtgg cctgcggttc 60

accattaacg gtcacgacta cttccagcta gtactggtga ccaacgtcgc ggcggcaggg 120

tcaatcaagt ccatggaggt tatgggttcc aacacagcgg attggatgcc gatggcacgt 180

aactggggcg cccaatggca ctcactggcc tacctcaccg gtcaaggtct atcctttagg 240

gtcaccaaca cagatgacca aacgctcgtc ttcaccaacg tcgtgccacc aggatggaag 300

tttggccaga catttgcaag caagctgcag ttcaagtgag aggagaagcc tgaattgata 360

ccggagcgtt tcttttggga gtaacatctc tggttgccta gcaaacatat gattgtatat 420

aagtttcgtt gtgcgtttat tctttcggtg tgtaaaataa catacatgct ttcctgatat 480

tttcttgtat atatgtacac acacacgaca aatccttcca tttctattat tattgaacaa 540

tttaattgcg agggcgagta cttgtctgtt tacctttttt ttttcagatg gcattttata 600

gtttaacctt tcatggaccg gcagtagttc taaccatgaa tgaaaagaaa tcatagtcca 660

caccacgcag ggacattgtg gtcattttag acaagacgat ttgattaatg tcttgtatga 720

tatggtcgac agtgaggact aacaaacata tggcatattt tattaccggc gagttaaata 780

aatttatgtc acagtaataa actgcctaat aaatgcacgc cagaaaatat aatgataaaa 840

aaaagaaaag atacataagt ccattgcttc tactttttta aaaattaaat ccaacatttt 900

ctattttttg gtataaactt ggaagtacta gttggatatg caaaatcatc taacctccat 960

atatttcatc aatttgttta ctttacatat gggagaggat agtatgtcaa agaaaatgac 1020

aacaagctta caagtttctt attttaaaag ttccgctaac ttatcaagca tagtgtgcca 1080

cgcaaaactg acaacaaacc aacaaattta aggagcgcct aacttatcat ctatgacata 1140

ccgcacaaaa tgataacata ctagagaaac tttattgcac aaaaggaaat ttatccataa 1200

ggcaaaggaa catcttaagg ctttggatat acatttacca acaagcattg tttgtattac 1260

ccctaaagcg caagacatgt catccatgag tcatagtgtg tatatctcaa cattgcaaag 1320

ctaccttttt tctattatac ttttcgcatt ataggctaga tattatctat acatgtcaac 1380

aaactctatc cctacgtcat atctgaagat tcttttcttc actatataag ttggcttccc 1440

tgtcattgaa ctcacatcaa ccagcccaag tttccaataa catcctcaaa tagctggtac 1500

caggcctgag ctctat 1516

<210> 2

<211> 1151

<212> DNA

<213> OsMADS1 Gene cDNA sequence (OsMADS1 cDNA)

<400> 2

gatcaggtag ccaaaccaca ccaccataaa gctagcttgc aaaggggata gagtagtaga 60

gagagagaga gaggagagga ggaggaagaa gatggggagg gggaaggtgg agctgaagcg 120

gatcgagaac aagatcagcc ggcaggtgac gttcgccaag cgcaggaacg gcctgctcaa 180

gaaggcctac gagctctccc tcctctgcga cgccgaggtc gccctcatca tcttctccgg 240

ccgcggccgc ctcttcgagt tctccagctc atcatgcatg tacaaaacct tggagaggta 300

ccgcagctgc aactacaact cacaggatgc agcagctcca gaaaacgaaa ttaattacca 360

agaatacctg aagctgaaaa caagagttga atttcttcaa accacacaga gaaatattct 420

tggtgaggat ttgggcccac taagcatgaa ggagctggag cagcttgaga accagataga 480

agtatccctc aaacaaatca ggtcaagaaa gaaccaagca ctgcttgatc agctgtttga 540

tctgaagagc aaggagcaac agctgcaaga tctcaacaaa gacttgagga aaaagttaca 600

ggaaaccagt gcagagaatg tgctccatat gtcctggcaa gatggtggtg ggcacagcgg 660

ttctagcact gttcttgctg atcagcctca tcaccatcag ggtcttctcc accctcaccc 720

agatcagggt gaccattccc tgcagattgg gtatcatcac cctcatgctc accatcacca 780

ggcctacatg gaccatctga gcaatgaagc agcagacatg gttgctcatc accccaatga 840

acacatccca tccggctgga tatgatgtgt gtgttcagtt caggcttcag gcttcagaga 900

agccaatgca aacagtgtcc tgtaatccag taattacagg gcatatgtaa tgtaatgtaa 960

tgtaatccct gatctatatt ttgctaagta cgtgcgtgct ctcttacgac cttctccccc 1020

aaacagttaa tcaggggaat aataatttcg tttgatgcac gtactgtatg tctgtatctg 1080

tcactgtatc gtaggaccgt ccatgtataa caatttccgt tttggatgtg gtaacaagtt 1140

aattggcact t 1151

<210> 3

<211> 469

<212> DNA

<213> sense interfering fragment of OsMADS1 Gene (OsMADS1)

<400> 3

tcaaatagct ggtaccaggc ctgaacaaat caggtcaaga aagaaccaag cactgcttga 60

tcagctgttt gatctgaaga gcaaggagca acagctgcaa gatctcaaca aagacttgag 120

gaaaaagtta caggaaacca gtgcagagaa tgtgctccat atgtcctggc aagatggtgg 180

tgggcacagc ggttctagca ctgttcttgc tgatcagcct catcaccatc agggtcttct 240

ccaccctcac ccagatcagg gtgaccattc cctgcagatt gggtatcatc accctcatgc 300

tcaccatcac caggcctaca tggaccatct gagcaatgaa gcagcagaca tggttgctca 360

tcaccccaat gaacacatcc catccggctg gatatgatgt gtgtgttcag ttcaggcttc 420

aggcttcaga gaagccaatg caaacagagc tctatcgccc ctacgtcag 469

<210> 4

<211> 459

<212> DNA

<213> OsMADS1 Gene antisense interference fragment (OsMADS1)

<400> 4

cggggatccg tcgactactg tttgcattgg cttctctgaa gcctgaagcc tgaactgaac 60

acacacatca tatccagccg gatgggatgt gttcattggg gtgatgagca accatgtctg 120

ctgcttcatt gctcagatgg tccatgtagg cctggtgatg gtgagcatga gggtgatgat 180

acccaatctg cagggaatgg tcaccctgat ctgggtgagg gtggagaaga ccctgatggt 240

gatgaggctg atcagcaaga acagtgctag aaccgctgtg cccaccacca tcttgccagg 300

acatatggag cacattctct gcactggttt cctgtaactt tttcctcaag tctttgttga 360

gatcttgcag ctgttgctcc ttgctcttca gatcaaacag ctgatcaagc agtgcttggt 420

tctttcttga cctgatttgt tgtaacgcgt cttccacct 459

<210> 5

<211> 1593

<212> DNA

<213> sequencing sequence of pOsGluB-4 promoter on vector pOsGluB-4-RNAi (pOsGluB-4)

<400> 5

ctcaatagcc ctttggtctt ctgagactgt atctttgata ttcttggagt agacgagagt 60

gtcgtgctcc accatgttgg gcccggcgcg ccaagcttta cagggttcct tgcgtgaaga 120

agggtggcct gcggttcacc attaacggtc acgactactt ccagctagta ctggtgacca 180

acgtcgcggc ggcagggtca atcaagtcca tggaggttat gggttccaac acagcggatt 240

ggatgccgat ggcacgtaac tggggcgccc aatggcactc actggcctac ctcaccggtc 300

aaggtctatc ctttagggtc accaacacag atgaccaaac gctcgtcttc accaacgtcg 360

tgccaccagg atggaagttt ggccagacat ttgcaagcaa gctgcagttc aagtgagagg 420

agaagcctga attgataccg gagcgtttct tttgggagta acatctctgg ttgcctagca 480

aacatatgat tgtatataag tttcgttgtg cgtttattct ttcggtgtgt aaaataacat 540

acatgctttc ctgatatttt cttgtatata tgtacacaca cacgacaaat ccttccattt 600

ctattattat tgaacaattt aattgcgagg gcgagtactt gtctgtttac cttttttttt 660

tcagatggca ttttatagtt taacctttca tggaccggca gtagttctaa ccatgaatga 720

aaagaaatca tagtccacac cacgcaggga cattgtggtc attttagaca agacgatttg 780

attaatgtct tgtatgatat ggtcgacagt gaggactaac aaacatatgg catattttat 840

taccggcgag ttaaataaat ttatgtcaca gtaataaact gcctaataaa tgcacgccag 900

aaaatataat gataaaaaaa agaaaagata cataagtcca ttgcttctac ttttttaaaa 960

attaaatcca acattttcta ttttttggta taaacttgga agtactagtt ggatatgcaa 1020

aatcatctaa cctccatata tttcatcaat ttgtttactt tacatatggg agaggatagt 1080

atgtcaaaga aaatgacaac aagcttacaa gtttcttatt ttaaaagttc cgctaactta 1140

tcaagcatag tgtgccacgc aaaactgaca acaaaccaac aaatttaagg agcgcctaac 1200

ttatcatcta tgacataccg cacaaaatga taacatacta gagaaacttt attgcacaaa 1260

aggaaattta tccataaggc aaaggaacat cttaaggctt tggatataca tttaccaaca 1320

agcattgttt gtattacccc taaagcgcaa gacatgtcat ccatgagtca tagtgtgtat 1380

atctcaacat tgcaaagcta ccttttttct attatacttt tcgcattata ggctagatat 1440

tatctataca tgtcaacaaa ctctatccct acgtcatatc tgaagattct tttcttcact 1500

atataagttg gcttccctgt cattgaactc acatcaacca gcccaagttt ccaataacat 1560

cctcaaatag ctggtaccag gcctgagctc tat 1593

<210> 6

<211> 1160

<212> DNA

<213> pOsGluB-4 with inserted antisense interfering fragment of OsMADS1 Gene:: pUbi on OsMADS1(antisense) -RNAi vector and with inserted antisense interfering fragment of OsMADS1 Gene:: corresponding antisense interfering fragment of OsMADS1 gene on OsMADS1(antisense) -RNAi vector (pOsGluB-4 with inserted antisense interfering fragment of OsMADS1 gene:: OsMADS1(antisense) -RNAi vector and pUbi with inserted antisense interfering fragment of OsMADS1 gene:: corresponding antisense interfering fragment of OsMADS1 gene on OsMADS1(antisense) -RNAi vector)

<400> 6

atagatgaca ccgcgcgcga taatttatcc tagtttgcgc gctatatttt gttttctatc 60

gcgtattaaa tgtataattg cgggactcta atcataaaaa cccatctcat aaataacgtc 120

atgcattaca tgttaattat tacatgctta acgtaattca acagaaatta tatgataatc 180

atcgcaagac cggcaacagg attcaatctt aagaaacttt attgccaaat gtttgaacga 240

tcggggaaat tcgagctggt cacctgtaat tcacacgtgg tggtggtggt ggtggctagc 300

gttaacacta gtcagatcta ccatggtgga ctcctcttag aattcccggg gatccgtcga 360

ctacaacaaa tcaggtcaag aaagaaccaa gcactgcttg atcagctgtt tgatctgaag 420

agcaaggagc aacagctgca agatctcaac aaagacttga ggaaaaagtt acaggaaacc 480

agtgcagaga atgtgctcca tatgtcctgg caagatggtg gtgggcacag cggttctagc 540

actgttcttg ctgatcagcc tcatcaccat cagggtcttc tccaccctca cccagatcag 600

ggtgaccatt ccctgcagat tgggtatcat caccctcatg ctcaccatca ccaggcctac 660

atggaccatc tgagcaatga agcagcagac atggttgctc atcaccccaa tgaacacatc 720

ccatccggct ggatatgatg tgtgtgttca gttcaggctt caggcttcag agaagccaat 780

gcaaacagta acgcgtcttc cacctgcacc catgtttctg cagaaaacca aaagcaaaag 840

aatcaacaag ctgaaaactc aagactatgg aatagtttta tcattaattc taaaaaacag 900

agcatgcaca agaaacaagt ggtaacgatt caagagagtc ttcagacaaa tgatccaaag 960

tgggaaatca ggttgtgaaa gggattgcca caaatagaaa atgcgtggac caaaaggaat 1020

aaagagtaga gaagcggcat aatgtgagaa atacaaaaac gattgcgttg agaatacgac 1080

tagtagtaag taatacgatg ttaataaggc aggtcacatc tcttgcttgt ggttaacatc 1140

agtttgcttg tattaaaaat 1160

<210> 7

<211> 2379

<212> DNA

<213> pOsGluB-4 inserted with positive and negative interfering fragments of OsMADS1 gene at the same time, OsGluB-4 promoter sequence sequenced in OsMADS1-RNAi vector and corresponding fragment sequence of OsMADS1 gene sense interfering fragment (OsMADS1)

<400> 7

cggctacagg gttccttgcg tgaagaaggg tggcctgcgg ttcaccatta acggtcacga 60

ctacttccag ctagtactgg tgaccaacgt cgcggcggca gggtcaatca agtccatgga 120

ggttatgggt tccaacacag cggattggat gccgatggca cgtaactggg gcgcccaatg 180

gcactcactg gcctacctca ccggtcaagg tctatccttt agggtcacca acacagatga 240

ccaaacgctc gtcttcacca acgtcgtgcc accaggatgg aagtttggcc agacatttgc 300

aagcaagctg cagttcaagt gagaggagaa gcctgaattg ataccggagc gtttcttttg 360

ggagtaacat ctctggttgc ctagcaaaca tatgattgta tataagtttc gttgtgcgtt 420

tattctttcg gtgtgtaaaa taacatacat gctttcctga tattttcttg tatatatgta 480

cacacacacg acaaatcctt ccatttctat tattattgaa caatttaatt gcgagggcga 540

gtacttgtct gtttaccttt tttttttcag atggcatttt atagtttaac ctttcatgga 600

ccggcagtag ttctaaccat gaatgaaaag aaatcatagt ccacaccacg cagggacatt 660

gtggtcattt tagacaagac gatttgatta atgtcttgta tgatatggtc gacagtgagg 720

actaacaaac atatggcata ttttattacc ggcgagttaa ataaatttat gtcacagtaa 780

taaactgcct aataaatgca cgccagaaaa tataatgata aaaaaaagaa aagatacata 840

agtccattgc ttctactttt ttaaaaatta aatccaacat tttctatttt ttggtataaa 900

cttggaagta ctagttggat atgcaaaatc atctaacctc catatatttc atcaatttgt 960

ttactttaca tatgggagag gatagtatgt caaagaaaat gacaacaagc ttacaagttt 1020

cttattttaa aagttccgct aacttatcaa gcatagtgtg ccacgcaaaa ctgacaacaa 1080

accaacaaat ttaaggagcg cctaacttat catctatgac ataccgcaca aaatgataac 1140

atactagaga aactttattg cacaaaagga aatttatcca taaggcaaag gaacatctta 1200

aggctttgga tatacattta ccaacaagca ttgtttgtat tacccctaaa gcgcaagaca 1260

tgtcatccat gagtcatagt gtgtatatct caacattgca aagctacctt ttttctatta 1320

tacttttcgc attataggct agatattatc tatacatgtc aacaaactct atccctacgt 1380

catatctgaa gattcttttc ttcactatat aagttggctt ccctgtcatt gaactcacat 1440

caaccagccc aagtttccaa taacatcctc aaatagctgg taccaggcct gaacaaatca 1500

ggtcaagaaa gaaccaagca ctgcttgatc agctgtttga tctgaagagc aaggagcaac 1560

agctgcaaga tctcaacaaa gacttgagga aaaagttaca ggaaaccagt gcagagaatg 1620

tgctccatat gtcctggcaa gatggtggtg ggcacagcgg ttctagcact gttcttgctg 1680

atcagcctca tcaccatcag ggtcttctcc accctcaccc agatcagggt gaccattccc 1740

tgcagattgg gtatcatcac cctcatgctc accatcacca ggcctacatg gaccatctga 1800

gcaatgaagc agcagacatg gttgctcatc accccaatga acacatccca tccggctgga 1860

tatgatgtgt gtgttcagtt caggcttcag gcttcagaga agccaatgca aacagagctc 1920

tatcgcccct acgtcagctc catctccagg tccgtcgctt ctcttccatt tcttctcatt 1980

ttcgattttg attcttattt ctttccagta gctcctgctc tgtgaatttc tccgctcacg 2040

atagatctgc ttatactcct tacattcaac cttagatctg gtctcgattc tctgtttctc 2100

tgtttttttc ttttggtcga gaatctgatg tttgtttatg ttctgtcacc attaataata 2160

atgaactctc tcattcaatg attagtttct ctcgtctaca aacgatatgt tgcattttca 2220

cttttcttct ttttttctaa gatgatttgc tttgaccaat ttgtttagat ctttatttta 2280

ttttattttc tggtgggttg gtggaaattg aaaaaaaaaa aaacagcata aattgttatt 2340

tgttaatgga ttcatttttt ggctatttgt tcagcaagc 2379

<210> 8

<211> 469

<212> DNA

<213> pUbi inserted into the sense and antisense interfering fragments of OsMADS1 Gene:: OsMADS1 gene sense interfering fragment corresponding fragment sequence (OsMADS1) sequenced in OsMADS1-RNAi vector

<400> 8

ttctgcacta ggtaccaggc ctgaacaaat caggtcaaga aagaaccaag cactgcttga 60

tcagctgttt gatctgaaga gcaaggagca acagctgcaa gatctcaaca aagacttgag 120

gaaaaagtta caggaaacca gtgcagagaa tgtgctccat atgtcctggc aagatggtgg 180

tgggcacagc ggttctagca ctgttcttgc tgatcagcct catcaccatc agggtcttct 240

ccaccctcac ccagatcagg gtgaccattc cctgcagatt gggtatcatc accctcatgc 300

tcaccatcac caggcctaca tggaccatct gagcaatgaa gcagcagaca tggttgctca 360

tcaccccaat gaacacatcc catccggctg gatatgatgt gtgtgttcag ttcaggcttc 420

aggcttcaga gaagccaatg caaacagagc tctatcgccc ctacgtcag 469

<210> 9

<211> 11537

<212> DNA

<213> pOsGluB-4-RNAi vector (pOsGluB-4-RNAi)

<400> 9

ctagccacca ccaccaccac cacgtgtgaa ttacaggtga ccagctcgaa tttccccgat 60

cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg 120

attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg 180

acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg 240

atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg 300

ttactagatc gggaattaaa ctatcagtgt ttgacaggat atattggcgg gtaaacctaa 360

gagaaaagag cgtttattag aataacggat atttaaaagg gcgtgaaaag gtttatccgt 420

tcgtccattt gtatgtgcat gccaaccaca gggttcccct cgggatcaaa gtactttgat 480

ccaacccctc cgctgctata gtgcagtcgg cttctgacgt tcagtgcagc cgtcttctga 540

aaacgacatg tcgcacaagt cctaagttac gcgacaggct gccgccctgc ccttttcctg 600

gcgttttctt gtcgcgtgtt ttagtcgcat aaagtagaat acttgcgact agaaccggag 660

acattacgcc atgaacaaga gcgccgccgc tggcctgctg ggctatgccc gcgtcagcac 720

cgacgaccag gacttgacca accaacgggc cgaactgcac gcggccggct gcaccaagct 780

gttttccgag aagatcaccg gcaccaggcg cgaccgcccg gagctggcca ggatgcttga 840

ccacctacgc cctggcgacg ttgtgacagt gaccaggcta gaccgcctgg cccgcagcac 900

ccgcgaccta ctggacattg ccgagcgcat ccaggaggcc ggcgcgggcc tgcgtagcct 960

ggcagagccg tgggccgaca ccaccacgcc ggccggccgc atggtgttga ccgtgttcgc 1020

cggcattgcc gagttcgagc gttccctaat catcgaccgc acccggagcg ggcgcgaggc 1080

cgccaaggcc cgaggcgtga agtttggccc ccgccctacc ctcaccccgg cacagatcgc 1140

gcacgcccgc gagctgatcg accaggaagg ccgcaccgtg aaagaggcgg ctgcactgct 1200

tggcgtgcat cgctcgaccc tgtaccgcgc acttgagcgc agcgaggaag tgacgcccac 1260

cgaggccagg cggcgcggtg ccttccgtga ggacgcattg accgaggccg acgccctggc 1320

ggccgccgag aatgaacgcc aagaggaaca agcatgaaac cgcaccagga cggccaggac 1380

gaaccgtttt tcattaccga agagatcgag gcggagatga tcgcggccgg gtacgtgttc 1440

gagccgcccg cgcacgtctc aaccgtgcgg ctgcatgaaa tcctggccgg tttgtctgat 1500

gccaagctgg cggcctggcc ggccagcttg gccgctgaag aaaccgagcg ccgccgtcta 1560

aaaaggtgat gtgtatttga gtaaaacagc ttgcgtcatg cggtcgctgc gtatatgatg 1620

cgatgagtaa ataaacaaat acgcaagggg aacgcatgaa ggttatcgct gtacttaacc 1680

agaaaggcgg gtcaggcaag acgaccatcg caacccatct agcccgcgcc ctgcaactcg 1740

ccggggccga tgttctgtta gtcgattccg atccccaggg cagtgcccgc gattgggcgg 1800

ccgtgcggga agatcaaccg ctaaccgttg tcggcatcga ccgcccgacg attgaccgcg 1860

acgtgaaggc catcggccgg cgcgacttcg tagtgatcga cggagcgccc caggcggcgg 1920

acttggctgt gtccgcgatc aaggcagccg acttcgtgct gattccggtg cagccaagcc 1980

cttacgacat atgggccacc gccgacctgg tggagctggt taagcagcgc attgaggtca 2040

cggatggaag gctacaagcg gcctttgtcg tgtcgcgggc gatcaaaggc acgcgcatcg 2100

gcggtgaggt tgccgaggcg ctggccgggt acgagctgcc cattcttgag tcccgtatca 2160

cgcagcgcgt gagctaccca ggcactgccg ccgccggcac aaccgttctt gaatcagaac 2220

ccgagggcga cgctgcccgc gaggtccagg cgctggccgc tgaaattaaa tcaaaactca 2280

tttgagttaa tgaggtaaag agaaaatgag caaaagcaca aacacgctaa gtgccggccg 2340

tccgagcgca cgcagcagca aggctgcaac gttggccagc ctggcagaca cgccagccat 2400

gaagcgggtc aactttcagt tgccggcgga ggatcacacc aagctgaaga tgtacgcggt 2460

acgccaaggc aagaccatta ccgagctgct atctgaatac atcgcgcagc taccagagta 2520

aatgagcaaa tgaataaatg agtagatgaa ttttagcggc taaaggaggc ggcatggaaa 2580

atcaagaaca accaggcacc gacgccgtgg aatgccccat gtgtggagga acgggcggtt 2640

ggccaggcgt aagcggctgg gttgtctgcc ggccctgcaa tggcactgga acccccaagc 2700

ccgaggaatc ggcgtgacgg tcgcaaacca tccggcccgg tacaaatcgg cgcggcgctg 2760

ggtgatgacc tggtggagaa gttgaaggcc gcgcaggccg cccagcggca acgcatcgag 2820

gcagaagcac gccccggtga atcgtggcaa gcggccgctg atcgaatccg caaagaatcc 2880

cggcaaccgc cggcagccgg tgcgccgtcg attaggaagc cgcccaaggg cgacgagcaa 2940

ccagattttt tcgttccgat gctctatgac gtgggcaccc gcgatagtcg cagcatcatg 3000

gacgtggccg ttttccgtct gtcgaagcgt gaccgacgag ctggcgaggt gatccgctac 3060

gagcttccag acgggcacgt agaggtttcc gcagggccgg ccggcatggc cagtgtgtgg 3120

gattacgacc tggtactgat ggcggtttcc catctaaccg aatccatgaa ccgataccgg 3180

gaagggaagg gagacaagcc cggccgcgtg ttccgtccac acgttgcgga cgtactcaag 3240

ttctgccggc gagccgatgg cggaaagcag aaagacgacc tggtagaaac ctgcattcgg 3300

ttaaacacca cgcacgttgc catgcagcgt acgaagaagg ccaagaacgg ccgcctggtg 3360

acggtatccg agggtgaagc cttgattagc cgctacaaga tcgtaaagag cgaaaccggg 3420

cggccggagt acatcgagat cgagctagct gattggatgt accgcgagat cacagaaggc 3480

aagaacccgg acgtgctgac ggttcacccc gattactttt tgatcgatcc cggcatcggc 3540

cgttttctct accgcctggc acgccgcgcc gcaggcaagg cagaagccag atggttgttc 3600

aagacgatct acgaacgcag tggcagcgcc ggagagttca agaagttctg tttcaccgtg 3660

cgcaagctga tcgggtcaaa tgacctgccg gagtacgatt tgaaggagga ggcggggcag 3720

gctggcccga tcctagtcat gcgctaccgc aacctgatcg agggcgaagc atccgccggt 3780

tcctaatgta cggagcagat gctagggcaa attgccctag caggggaaaa aggtcgaaaa 3840

ggtctctttc ctgtggatag cacgtacatt gggaacccaa agccgtacat tgggaaccgg 3900

aacccgtaca ttgggaaccc aaagccgtac attgggaacc ggtcacacat gtaagtgact 3960

gatataaaag agaaaaaagg cgatttttcc gcctaaaact ctttaaaact tattaaaact 4020

cttaaaaccc gcctggcctg tgcataactg tctggccagc gcacagccga agagctgcaa 4080

aaagcgccta cccttcggtc gctgcgctcc ctacgccccg ccgcttcgcg tcggcctatc 4140

gcggccgctg gccgctcaaa aatggctggc ctacggccag gcaatctacc agggcgcgga 4200

caagccgcgc cgtcgccact cgaccgccgg cgcccacatc aaggcaccct gcctcgcgcg 4260

tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 4320

tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 4380

gtgtcggggc gcagccatga cccagtcacg tagcgatagc ggagtgtata ctggcttaac 4440

tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga aataccgcac 4500

agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg 4560

ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 4620

ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 4680

gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 4740

gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 4800

taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 4860

accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 4920

tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 4980

cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 5040

agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 5100

gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 5160

gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 5220

tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 5280

acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 5340

cagtggaacg aaaactcacg ttaagggatt ttggtcatgc attctaggta ctaaaacaat 5400

tcatccagta aaatataata ttttattttc tcccaatcag gcttgatccc cagtaagtca 5460

aaaaatagct cgacatactg ttcttccccg atatcctccc tgatcgaccg gacgcagaag 5520

gcaatgtcat accacttgtc cgccctgccg cttctcccaa gatcaataaa gccacttact 5580

ttgccatctt tcacaaagat gttgctgtct cccaggtcgc cgtgggaaaa gacaagttcc 5640

tcttcgggct tttccgtctt taaaaaatca tacagctcgc gcggatcttt aaatggagtg 5700

tcttcttccc agttttcgca atccacatcg gccagatcgt tattcagtaa gtaatccaat 5760

tcggctaagc ggctgtctaa gctattcgta tagggacaat ccgatatgtc gatggagtga 5820

aagagcctga tgcactccgc atacagctcg ataatctttt cagggctttg ttcatcttca 5880

tactcttccg agcaaaggac gccatcggcc tcactcatga gcagattgct ccagccatca 5940

tgccgttcaa agtgcaggac ctttggaaca ggcagctttc cttccagcca tagcatcatg 6000

tccttttccc gttccacatc ataggtggtc cctttatacc ggctgtccgt catttttaaa 6060

tataggtttt cattttctcc caccagctta tataccttag caggagacat tccttccgta 6120

tcttttacgc agcggtattt ttcgatcagt tttttcaatt ccggtgatat tctcatttta 6180

gccatttatt atttccttcc tcttttctac agtatttaaa gataccccaa gaagctaatt 6240

ataacaagac gaactccaat tcactgttcc ttgcattcta aaaccttaaa taccagaaaa 6300

cagctttttc aaagttgttt tcaaagttgg cgtataacat agtatcgacg gagccgattt 6360

tgaaaccgcg gtgatcacag gcagcaacgc tctgtcatcg ttacaatcaa catgctaccc 6420

tccgcgagat catccgtgtt tcaaacccgg cagcttagtt gccgttcttc cgaatagcat 6480

cggtaacatg agcaaagtct gccgccttac aacggctctc ccgctgacgc cgtcccggac 6540

tgatgggctg cctgtatcga gtggtgattt tgtgccgagc tgccggtcgg ggagctgttg 6600

gctggctggt ggcaggatat attgtggtgt aaacaaattg acgcttagac aacttaataa 6660

cacattgcgg acgtttttaa tgtactgaat taacgccgaa ttaattcggg ggatctggat 6720

tttagtactg gattttggtt ttaggaatta gaaattttat tgatagaagt attttacaaa 6780

tacaaataca tactaagggt ttcttatatg ctcaacacat gagcgaaacc ctataggaac 6840

cctaattccc ttatctggga actactcaca cattattatg gagaaactcg agcttgtcga 6900

tcgacagatc cggtcggcat ctactctatt tctttgccct cggacgagtg ctggggcgtc 6960

ggtttccact atcggcgagt acttctacac agccatcggt ccagacggcc gcgcttctgc 7020

gggcgatttg tgtacgcccg acagtcccgg ctccggatcg gacgattgcg tcgcatcgac 7080

cctgcgccca agctgcatca tcgaaattgc cgtcaaccaa gctctgatag agttggtcaa 7140

gaccaatgcg gagcatatac gcccggagtc gtggcgatcc tgcaagctcc ggatgcctcc 7200

gctcgaagta gcgcgtctgc tgctccatac aagccaacca cggcctccag aagaagatgt 7260

tggcgacctc gtattgggaa tccccgaaca tcgcctcgct ccagtcaatg accgctgtta 7320

tgcggccatt gtccgtcagg acattgttgg agccgaaatc cgcgtgcacg aggtgccgga 7380

cttcggggca gtcctcggcc caaagcatca gctcatcgag agcctgcgcg acggacgcac 7440

tgacggtgtc gtccatcaca gtttgccagt gatacacatg gggatcagca atcgcgcata 7500

tgaaatcacg ccatgtagtg tattgaccga ttccttgcgg tccgaatggg ccgaacccgc 7560

tcgtctggct aagatcggcc gcagcgatcg catccatagc ctccgcgacc ggttgtagaa 7620

cagcgggcag ttcggtttca ggcaggtctt gcaacgtgac accctgtgca cggcgggaga 7680

tgcaataggt caggctctcg ctaaactccc caatgtcaag cacttccgga atcgggagcg 7740

cggccgatgc aaagtgccga taaacataac gatctttgta gaaaccatcg gcgcagctat 7800

ttacccgcag gacatatcca cgccctccta catcgaagct gaaagcacga gattcttcgc 7860

cctccgagag ctgcatcagg tcggagacgc tgtcgaactt ttcgatcaga aacttctcga 7920

cagacgtcgc ggtgagttca ggctttttca tatctcattg ccccccggga tctgcgaaag 7980

ctcgagagag atagatttgt agagagagac tggtgatttc agcgtgtcct ctccaaatga 8040

aatgaacttc cttatataga ggaaggtctt gcgaaggata gtgggattgt gcgtcatccc 8100

ttacgtcagt ggagatatca catcaatcca cttgctttga agacgtggtt ggaacgtctt 8160

ctttttccac gatgctcctc gtgggtgggg gtccatcttt gggaccactg tcggcagagg 8220

catcttgaac gatagccttt cctttatcgc aatgatggca tttgtaggtg ccaccttcct 8280

tttctactgt ccttttgatg aagtgacaga tagctgggca atggaatccg aggaggtttc 8340

ccgatattac cctttgttga aaagtctcaa tagccctttg gtcttctgag actgtatctt 8400

tgatattctt ggagtagacg agagtgtcgt gctccaccat gttatcacat caatccactt 8460

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 8520

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 8580

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 8640

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 8700

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 8760

ccaccatgtt gggcccggcg cgccaagctt tacagggttc cttgcgtgaa gaagggtggc 8820

ctgcggttca ccattaacgg tcacgactac ttccagctag tactggtgac caacgtcgcg 8880

gcggcagggt caatcaagtc catggaggtt atgggttcca acacagcgga ttggatgccg 8940

atggcacgta actggggcgc ccaatggcac tcactggcct acctcaccgg tcaaggtcta 9000

tcctttaggg tcaccaacac agatgaccaa acgctcgtct tcaccaacgt cgtgccacca 9060

ggatggaagt ttggccagac atttgcaagc aagctgcagt tcaagtgaga ggagaagcct 9120

gaattgatac cggagcgttt cttttgggag taacatctct ggttgcctag caaacatatg 9180

attgtatata agtttcgttg tgcgtttatt ctttcggtgt gtaaaataac atacatgctt 9240

tcctgatatt ttcttgtata tatgtacaca cacacgacaa atccttccat ttctattatt 9300

attgaacaat ttaattgcga gggcgagtac ttgtctgttt accttttttt tttcagatgg 9360

cattttatag tttaaccttt catggaccgg cagtagttct aaccatgaat gaaaagaaat 9420

catagtccac accacgcagg gacattgtgg tcattttaga caagacgatt tgattaatgt 9480

cttgtatgat atggtcgaca gtgaggacta acaaacatat ggcatatttt attaccggcg 9540

agttaaataa atttatgtca cagtaataaa ctgcctaata aatgcacgcc agaaaatata 9600

atgataaaaa aaagaaaaga tacataagtc cattgcttct acttttttaa aaattaaatc 9660

caacattttc tattttttgg tataaacttg gaagtactag ttggatatgc aaaatcatct 9720

aacctccata tatttcatca atttgtttac tttacatatg ggagaggata gtatgtcaaa 9780

gaaaatgaca acaagcttac aagtttctta ttttaaaagt tccgctaact tatcaagcat 9840

agtgtgccac gcaaaactga caacaaacca acaaatttaa ggagcgccta acttatcatc 9900

tatgacatac cgcacaaaat gataacatac tagagaaact ttattgcaca aaaggaaatt 9960

tatccataag gcaaaggaac atcttaaggc tttggatata catttaccaa caagcattgt 10020

ttgtattacc cctaaagcgc aagacatgtc atccatgagt catagtgtgt atatctcaac 10080

attgcaaagc tacctttttt ctattatact tttcgcatta taggctagat attatctata 10140

catgtcaaca aactctatcc ctacgtcata tctgaagatt cttttcttca ctatataagt 10200

tggcttccct gtcattgaac tcacatcaac cagcccaagt ttccaataac atcctcaaat 10260

agctggtacc aggcctgagc tctatcgccc ctacgtcagc tccatctcca ggtccgtcgc 10320

ttctcttcca tttcttctca ttttcgattt tgattcttat ttctttccag tagctcctgc 10380

tctgtgaatt tctccgctca cgatagatct gcttatactc cttacattca accttagatc 10440

tggtctcgat tctctgtttc tctgtttttt tcttttggtc gagaatctga tgtttgttta 10500

tgttctgtca ccattaataa taatgaactc tctcattcat acaatgatta gtttctctcg 10560

tctacaaaac gatatgttgc attttcactt ttcttctttt tttctaagat gatttgcttt 10620

gaccaatttg tttagatctt tattttattt tattttctgg tgggttggtg gaaattgaaa 10680

aaaaaaaaaa cagcataaat tgttatttgt taatgtattc attttttggc tatttgttct 10740

gggtaaaaat ctgcttctac tattgaatct ttcctggatt ttttactcct attgggtttt 10800

tatagtaaaa atacataata aaaggaaaac aaaagtttta tagattctct taaacccctt 10860

acgataaaag ttggaatcaa aataattcag gatcagatgc tctttgattg attcagatgc 10920

gattacagtt gcatggcaaa ttttctagat ccgtcgtcac attttatttt ctgtttaaat 10980

atctaaatct gatatatgat gtcgacaaat tctggtggct tatacatcac ttcaactgtt 11040

ttcttttggc tttgtttgtc aacttggttt tcaatacgat ttgtgatttc gatcgctgaa 11100

tttttaatac aagcaaactg atgttaacca caagcaagag atgtgacctg ccttattaac 11160

atcgtattac ttactactag tcgtattctc aacgcaatcg tttttgtatt tctcacatta 11220

tgccgcttct ctactcttta ttccttttgg tccacgcatt ttctatttgt ggcaatccct 11280

ttcacaacct gatttcccac tttggatcat ttgtctgaag actctcttga atcgttacca 11340

cttgtttctt gtgcatgctc tgttttttag aattaatgat aaaactattc catagtcttg 11400

agttttcagc ttgttgattc ttttgctttt ggttttctgc agaaacatgg gtgcaggtgg 11460

aagacgcgtt acgtagtcga cggatccccg ggaattctaa gaggagtcca ccatggtaga 11520

tctgactagt gttaacg 11537

<210> 10

<211> 12399

<212> DNA

<213> pOsGluB-4-RNAi vector inserted into pOsGluB-4:: OsMADS1-RNAi vector sequence of positive and antisense interference fragments of OsMADS1 gene (pOsGluB-4:: OsMADS1-RNAi)

<400> 10

ctagccacca ccaccaccac cacgtgtgaa ttacaggtga ccagctcgaa tttccccgat 60

cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg 120

attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg 180

acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg 240

atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg 300

ttactagatc gggaattaaa ctatcagtgt ttgacaggat atattggcgg gtaaacctaa 360

gagaaaagag cgtttattag aataacggat atttaaaagg gcgtgaaaag gtttatccgt 420

tcgtccattt gtatgtgcat gccaaccaca gggttcccct cgggatcaaa gtactttgat 480

ccaacccctc cgctgctata gtgcagtcgg cttctgacgt tcagtgcagc cgtcttctga 540

aaacgacatg tcgcacaagt cctaagttac gcgacaggct gccgccctgc ccttttcctg 600

gcgttttctt gtcgcgtgtt ttagtcgcat aaagtagaat acttgcgact agaaccggag 660

acattacgcc atgaacaaga gcgccgccgc tggcctgctg ggctatgccc gcgtcagcac 720

cgacgaccag gacttgacca accaacgggc cgaactgcac gcggccggct gcaccaagct 780

gttttccgag aagatcaccg gcaccaggcg cgaccgcccg gagctggcca ggatgcttga 840

ccacctacgc cctggcgacg ttgtgacagt gaccaggcta gaccgcctgg cccgcagcac 900

ccgcgaccta ctggacattg ccgagcgcat ccaggaggcc ggcgcgggcc tgcgtagcct 960

ggcagagccg tgggccgaca ccaccacgcc ggccggccgc atggtgttga ccgtgttcgc 1020

cggcattgcc gagttcgagc gttccctaat catcgaccgc acccggagcg ggcgcgaggc 1080

cgccaaggcc cgaggcgtga agtttggccc ccgccctacc ctcaccccgg cacagatcgc 1140

gcacgcccgc gagctgatcg accaggaagg ccgcaccgtg aaagaggcgg ctgcactgct 1200

tggcgtgcat cgctcgaccc tgtaccgcgc acttgagcgc agcgaggaag tgacgcccac 1260

cgaggccagg cggcgcggtg ccttccgtga ggacgcattg accgaggccg acgccctggc 1320

ggccgccgag aatgaacgcc aagaggaaca agcatgaaac cgcaccagga cggccaggac 1380

gaaccgtttt tcattaccga agagatcgag gcggagatga tcgcggccgg gtacgtgttc 1440

gagccgcccg cgcacgtctc aaccgtgcgg ctgcatgaaa tcctggccgg tttgtctgat 1500

gccaagctgg cggcctggcc ggccagcttg gccgctgaag aaaccgagcg ccgccgtcta 1560

aaaaggtgat gtgtatttga gtaaaacagc ttgcgtcatg cggtcgctgc gtatatgatg 1620

cgatgagtaa ataaacaaat acgcaagggg aacgcatgaa ggttatcgct gtacttaacc 1680

agaaaggcgg gtcaggcaag acgaccatcg caacccatct agcccgcgcc ctgcaactcg 1740

ccggggccga tgttctgtta gtcgattccg atccccaggg cagtgcccgc gattgggcgg 1800

ccgtgcggga agatcaaccg ctaaccgttg tcggcatcga ccgcccgacg attgaccgcg 1860

acgtgaaggc catcggccgg cgcgacttcg tagtgatcga cggagcgccc caggcggcgg 1920

acttggctgt gtccgcgatc aaggcagccg acttcgtgct gattccggtg cagccaagcc 1980

cttacgacat atgggccacc gccgacctgg tggagctggt taagcagcgc attgaggtca 2040

cggatggaag gctacaagcg gcctttgtcg tgtcgcgggc gatcaaaggc acgcgcatcg 2100

gcggtgaggt tgccgaggcg ctggccgggt acgagctgcc cattcttgag tcccgtatca 2160

cgcagcgcgt gagctaccca ggcactgccg ccgccggcac aaccgttctt gaatcagaac 2220

ccgagggcga cgctgcccgc gaggtccagg cgctggccgc tgaaattaaa tcaaaactca 2280

tttgagttaa tgaggtaaag agaaaatgag caaaagcaca aacacgctaa gtgccggccg 2340

tccgagcgca cgcagcagca aggctgcaac gttggccagc ctggcagaca cgccagccat 2400

gaagcgggtc aactttcagt tgccggcgga ggatcacacc aagctgaaga tgtacgcggt 2460

acgccaaggc aagaccatta ccgagctgct atctgaatac atcgcgcagc taccagagta 2520

aatgagcaaa tgaataaatg agtagatgaa ttttagcggc taaaggaggc ggcatggaaa 2580

atcaagaaca accaggcacc gacgccgtgg aatgccccat gtgtggagga acgggcggtt 2640

ggccaggcgt aagcggctgg gttgtctgcc ggccctgcaa tggcactgga acccccaagc 2700

ccgaggaatc ggcgtgacgg tcgcaaacca tccggcccgg tacaaatcgg cgcggcgctg 2760

ggtgatgacc tggtggagaa gttgaaggcc gcgcaggccg cccagcggca acgcatcgag 2820

gcagaagcac gccccggtga atcgtggcaa gcggccgctg atcgaatccg caaagaatcc 2880

cggcaaccgc cggcagccgg tgcgccgtcg attaggaagc cgcccaaggg cgacgagcaa 2940

ccagattttt tcgttccgat gctctatgac gtgggcaccc gcgatagtcg cagcatcatg 3000

gacgtggccg ttttccgtct gtcgaagcgt gaccgacgag ctggcgaggt gatccgctac 3060

gagcttccag acgggcacgt agaggtttcc gcagggccgg ccggcatggc cagtgtgtgg 3120

gattacgacc tggtactgat ggcggtttcc catctaaccg aatccatgaa ccgataccgg 3180

gaagggaagg gagacaagcc cggccgcgtg ttccgtccac acgttgcgga cgtactcaag 3240

ttctgccggc gagccgatgg cggaaagcag aaagacgacc tggtagaaac ctgcattcgg 3300

ttaaacacca cgcacgttgc catgcagcgt acgaagaagg ccaagaacgg ccgcctggtg 3360

acggtatccg agggtgaagc cttgattagc cgctacaaga tcgtaaagag cgaaaccggg 3420

cggccggagt acatcgagat cgagctagct gattggatgt accgcgagat cacagaaggc 3480

aagaacccgg acgtgctgac ggttcacccc gattactttt tgatcgatcc cggcatcggc 3540

cgttttctct accgcctggc acgccgcgcc gcaggcaagg cagaagccag atggttgttc 3600

aagacgatct acgaacgcag tggcagcgcc ggagagttca agaagttctg tttcaccgtg 3660

cgcaagctga tcgggtcaaa tgacctgccg gagtacgatt tgaaggagga ggcggggcag 3720

gctggcccga tcctagtcat gcgctaccgc aacctgatcg agggcgaagc atccgccggt 3780

tcctaatgta cggagcagat gctagggcaa attgccctag caggggaaaa aggtcgaaaa 3840

ggtctctttc ctgtggatag cacgtacatt gggaacccaa agccgtacat tgggaaccgg 3900

aacccgtaca ttgggaaccc aaagccgtac attgggaacc ggtcacacat gtaagtgact 3960

gatataaaag agaaaaaagg cgatttttcc gcctaaaact ctttaaaact tattaaaact 4020

cttaaaaccc gcctggcctg tgcataactg tctggccagc gcacagccga agagctgcaa 4080

aaagcgccta cccttcggtc gctgcgctcc ctacgccccg ccgcttcgcg tcggcctatc 4140

gcggccgctg gccgctcaaa aatggctggc ctacggccag gcaatctacc agggcgcgga 4200

caagccgcgc cgtcgccact cgaccgccgg cgcccacatc aaggcaccct gcctcgcgcg 4260

tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 4320

tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 4380

gtgtcggggc gcagccatga cccagtcacg tagcgatagc ggagtgtata ctggcttaac 4440

tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga aataccgcac 4500

agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg 4560

ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 4620

ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 4680

gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 4740

gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 4800

taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 4860

accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 4920

tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 4980

cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 5040

agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 5100

gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 5160

gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 5220

tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 5280

acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 5340

cagtggaacg aaaactcacg ttaagggatt ttggtcatgc attctaggta ctaaaacaat 5400

tcatccagta aaatataata ttttattttc tcccaatcag gcttgatccc cagtaagtca 5460

aaaaatagct cgacatactg ttcttccccg atatcctccc tgatcgaccg gacgcagaag 5520

gcaatgtcat accacttgtc cgccctgccg cttctcccaa gatcaataaa gccacttact 5580

ttgccatctt tcacaaagat gttgctgtct cccaggtcgc cgtgggaaaa gacaagttcc 5640

tcttcgggct tttccgtctt taaaaaatca tacagctcgc gcggatcttt aaatggagtg 5700

tcttcttccc agttttcgca atccacatcg gccagatcgt tattcagtaa gtaatccaat 5760

tcggctaagc ggctgtctaa gctattcgta tagggacaat ccgatatgtc gatggagtga 5820

aagagcctga tgcactccgc atacagctcg ataatctttt cagggctttg ttcatcttca 5880

tactcttccg agcaaaggac gccatcggcc tcactcatga gcagattgct ccagccatca 5940

tgccgttcaa agtgcaggac ctttggaaca ggcagctttc cttccagcca tagcatcatg 6000

tccttttccc gttccacatc ataggtggtc cctttatacc ggctgtccgt catttttaaa 6060

tataggtttt cattttctcc caccagctta tataccttag caggagacat tccttccgta 6120

tcttttacgc agcggtattt ttcgatcagt tttttcaatt ccggtgatat tctcatttta 6180

gccatttatt atttccttcc tcttttctac agtatttaaa gataccccaa gaagctaatt 6240

ataacaagac gaactccaat tcactgttcc ttgcattcta aaaccttaaa taccagaaaa 6300

cagctttttc aaagttgttt tcaaagttgg cgtataacat agtatcgacg gagccgattt 6360

tgaaaccgcg gtgatcacag gcagcaacgc tctgtcatcg ttacaatcaa catgctaccc 6420

tccgcgagat catccgtgtt tcaaacccgg cagcttagtt gccgttcttc cgaatagcat 6480

cggtaacatg agcaaagtct gccgccttac aacggctctc ccgctgacgc cgtcccggac 6540

tgatgggctg cctgtatcga gtggtgattt tgtgccgagc tgccggtcgg ggagctgttg 6600

gctggctggt ggcaggatat attgtggtgt aaacaaattg acgcttagac aacttaataa 6660

cacattgcgg acgtttttaa tgtactgaat taacgccgaa ttaattcggg ggatctggat 6720

tttagtactg gattttggtt ttaggaatta gaaattttat tgatagaagt attttacaaa 6780

tacaaataca tactaagggt ttcttatatg ctcaacacat gagcgaaacc ctataggaac 6840

cctaattccc ttatctggga actactcaca cattattatg gagaaactcg agcttgtcga 6900

tcgacagatc cggtcggcat ctactctatt tctttgccct cggacgagtg ctggggcgtc 6960

ggtttccact atcggcgagt acttctacac agccatcggt ccagacggcc gcgcttctgc 7020

gggcgatttg tgtacgcccg acagtcccgg ctccggatcg gacgattgcg tcgcatcgac 7080

cctgcgccca agctgcatca tcgaaattgc cgtcaaccaa gctctgatag agttggtcaa 7140

gaccaatgcg gagcatatac gcccggagtc gtggcgatcc tgcaagctcc ggatgcctcc 7200

gctcgaagta gcgcgtctgc tgctccatac aagccaacca cggcctccag aagaagatgt 7260

tggcgacctc gtattgggaa tccccgaaca tcgcctcgct ccagtcaatg accgctgtta 7320

tgcggccatt gtccgtcagg acattgttgg agccgaaatc cgcgtgcacg aggtgccgga 7380

cttcggggca gtcctcggcc caaagcatca gctcatcgag agcctgcgcg acggacgcac 7440

tgacggtgtc gtccatcaca gtttgccagt gatacacatg gggatcagca atcgcgcata 7500

tgaaatcacg ccatgtagtg tattgaccga ttccttgcgg tccgaatggg ccgaacccgc 7560

tcgtctggct aagatcggcc gcagcgatcg catccatagc ctccgcgacc ggttgtagaa 7620

cagcgggcag ttcggtttca ggcaggtctt gcaacgtgac accctgtgca cggcgggaga 7680

tgcaataggt caggctctcg ctaaactccc caatgtcaag cacttccgga atcgggagcg 7740

cggccgatgc aaagtgccga taaacataac gatctttgta gaaaccatcg gcgcagctat 7800

ttacccgcag gacatatcca cgccctccta catcgaagct gaaagcacga gattcttcgc 7860

cctccgagag ctgcatcagg tcggagacgc tgtcgaactt ttcgatcaga aacttctcga 7920

cagacgtcgc ggtgagttca ggctttttca tatctcattg ccccccggga tctgcgaaag 7980

ctcgagagag atagatttgt agagagagac tggtgatttc agcgtgtcct ctccaaatga 8040

aatgaacttc cttatataga ggaaggtctt gcgaaggata gtgggattgt gcgtcatccc 8100

ttacgtcagt ggagatatca catcaatcca cttgctttga agacgtggtt ggaacgtctt 8160

ctttttccac gatgctcctc gtgggtgggg gtccatcttt gggaccactg tcggcagagg 8220

catcttgaac gatagccttt cctttatcgc aatgatggca tttgtaggtg ccaccttcct 8280

tttctactgt ccttttgatg aagtgacaga tagctgggca atggaatccg aggaggtttc 8340

ccgatattac cctttgttga aaagtctcaa tagccctttg gtcttctgag actgtatctt 8400

tgatattctt ggagtagacg agagtgtcgt gctccaccat gttatcacat caatccactt 8460

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 8520

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 8580

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 8640

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 8700

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 8760

ccaccatgtt gggcccggcg cgccaagctt tacagggttc cttgcgtgaa gaagggtggc 8820

ctgcggttca ccattaacgg tcacgactac ttccagctag tactggtgac caacgtcgcg 8880

gcggcagggt caatcaagtc catggaggtt atgggttcca acacagcgga ttggatgccg 8940

atggcacgta actggggcgc ccaatggcac tcactggcct acctcaccgg tcaaggtcta 9000

tcctttaggg tcaccaacac agatgaccaa acgctcgtct tcaccaacgt cgtgccacca 9060

ggatggaagt ttggccagac atttgcaagc aagctgcagt tcaagtgaga ggagaagcct 9120

gaattgatac cggagcgttt cttttgggag taacatctct ggttgcctag caaacatatg 9180

attgtatata agtttcgttg tgcgtttatt ctttcggtgt gtaaaataac atacatgctt 9240

tcctgatatt ttcttgtata tatgtacaca cacacgacaa atccttccat ttctattatt 9300

attgaacaat ttaattgcga gggcgagtac ttgtctgttt accttttttt tttcagatgg 9360

cattttatag tttaaccttt catggaccgg cagtagttct aaccatgaat gaaaagaaat 9420

catagtccac accacgcagg gacattgtgg tcattttaga caagacgatt tgattaatgt 9480

cttgtatgat atggtcgaca gtgaggacta acaaacatat ggcatatttt attaccggcg 9540

agttaaataa atttatgtca cagtaataaa ctgcctaata aatgcacgcc agaaaatata 9600

atgataaaaa aaagaaaaga tacataagtc cattgcttct acttttttaa aaattaaatc 9660

caacattttc tattttttgg tataaacttg gaagtactag ttggatatgc aaaatcatct 9720

aacctccata tatttcatca atttgtttac tttacatatg ggagaggata gtatgtcaaa 9780

gaaaatgaca acaagcttac aagtttctta ttttaaaagt tccgctaact tatcaagcat 9840

agtgtgccac gcaaaactga caacaaacca acaaatttaa ggagcgccta acttatcatc 9900

tatgacatac cgcacaaaat gataacatac tagagaaact ttattgcaca aaaggaaatt 9960

tatccataag gcaaaggaac atcttaaggc tttggatata catttaccaa caagcattgt 10020

ttgtattacc cctaaagcgc aagacatgtc atccatgagt catagtgtgt atatctcaac 10080

attgcaaagc tacctttttt ctattatact tttcgcatta taggctagat attatctata 10140

catgtcaaca aactctatcc ctacgtcata tctgaagatt cttttcttca ctatataagt 10200

tggcttccct gtcattgaac tcacatcaac cagcccaagt ttccaataac atcctcaaat 10260

agctggtacc aggcctacaa atcaggtcaa gaaagaacca agcactgctt gatcagctgt 10320

ttgatctgaa gagcaaggag caacagctgc aagatctcaa caaagacttg aggaaaaagt 10380

tacaggaaac cagtgcagag aatgtgctcc atatgtcctg gcaagatggt ggtgggcaca 10440

gcggttctag cactgttctt gctgatcagc ctcatcacca tcagggtctt ctccaccctc 10500

acccagatca gggtgaccat tccctgcaga ttgggtatca tcaccctcat gctcaccatc 10560

accaggccta catggaccat ctgagcaatg aagcagcaga catggttgct catcacccca 10620

atgaacacat cccatccggc tggatatgat gtgtgtgttc agttcaggct tcaggcttca 10680

gagaagccaa tgcaaacaga gctctatcgc ccctagagct ctatcgcccc tacgtcagct 10740

ccatctccag gtccgtcgct tctcttccat ttcttctcat tttcgatttt gattcttatt 10800

tctttccagt agctcctgct ctgtgaattt ctccgctcac gatagatctg cttatactcc 10860

ttacattcaa ccttagatct ggtctcgatt ctctgtttct ctgttttttt cttttggtcg 10920

agaatctgat gtttgtttat gttctgtcac cattaataat aatgaactct ctcattcata 10980

caatgattag tttctctcgt ctacaaaacg atatgttgca ttttcacttt tcttcttttt 11040

ttctaagatg atttgctttg accaatttgt ttagatcttt attttatttt attttctggt 11100

gggttggtgg aaattgaaaa aaaaaaaaac agcataaatt gttatttgtt aatgtattca 11160

ttttttggct atttgttctg ggtaaaaatc tgcttctact attgaatctt tcctggattt 11220

tttactccta ttgggttttt atagtaaaaa tacataataa aaggaaaaca aaagttttat 11280

agattctctt aaacccctta cgataaaagt tggaatcaaa ataattcagg atcagatgct 11340

ctttgattga ttcagatgcg attacagttg catggcaaat tttctagatc cgtcgtcaca 11400

ttttattttc tgtttaaata tctaaatctg atatatgatg tcgacaaatt ctggtggctt 11460

atacatcact tcaactgttt tcttttggct ttgtttgtca acttggtttt caatacgatt 11520

tgtgatttcg atcgctgaat ttttaataca agcaaactga tgttaaccac aagcaagaga 11580

tgtgacctgc cttattaaca tcgtattact tactactagt cgtattctca acgcaatcgt 11640

ttttgtattt ctcacattat gccgcttctc tactctttat tccttttggt ccacgcattt 11700

tctatttgtg gcaatccctt tcacaacctg atttcccact ttggatcatt tgtctgaaga 11760

ctctcttgaa tcgttaccac ttgtttcttg tgcatgctct gttttttaga attaatgata 11820

aaactattcc atagtcttga gttttcagct tgttgattct tttgcttttg gttttctgca 11880

gaaacatggg tgcaggtgga agacgcgttg tttgcattgg cttctctgaa gcctgaagcc 11940

tgaactgaac acacacatca tatccagccg gatgggatgt gttcattggg gtgatgagca 12000

accatgtctg ctgcttcatt gctcagatgg tccatgtagg cctggtgatg gtgagcatga 12060

gggtgatgat acccaatctg cagggaatgg tcaccctgat ctgggtgagg gtggagaaga 12120

ccctgatggt gatgaggctg atcagcaaga acagtgctag aaccgctgtg cccaccacca 12180

tcttgccagg acatatggag cacattctct gcactggttt cctgtaactt tttcctcaag 12240

tctttgttga gatcttgcag ctgttgctcc ttgctcttca gatcaaacag ctgatcaagc 12300

agtgcttggt tctttcttga cctgatttgt ttacgtagtc gacggatccc cgggaattct 12360

aagaggagtc caccatggta gatctgacta gtgttaacg 12399

<210> 11

<211> 12060

<212> DNA

<213> pLHRNAi vector (pLHRNAi)

<400> 11

ctagccacca ccaccaccac cacgtgtgaa ttacaggtga ccagctcgaa tttccccgat 60

cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg 120

attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg 180

acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg 240

atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg 300

ttactagatc gggaattaaa ctatcagtgt ttgacaggat atattggcgg gtaaacctaa 360

gagaaaagag cgtttattag aataacggat atttaaaagg gcgtgaaaag gtttatccgt 420

tcgtccattt gtatgtgcat gccaaccaca gggttcccct cgggatcaaa gtactttgat 480

ccaacccctc cgctgctata gtgcagtcgg cttctgacgt tcagtgcagc cgtcttctga 540

aaacgacatg tcgcacaagt cctaagttac gcgacaggct gccgccctgc ccttttcctg 600

gcgttttctt gtcgcgtgtt ttagtcgcat aaagtagaat acttgcgact agaaccggag 660

acattacgcc atgaacaaga gcgccgccgc tggcctgctg ggctatgccc gcgtcagcac 720

cgacgaccag gacttgacca accaacgggc cgaactgcac gcggccggct gcaccaagct 780

gttttccgag aagatcaccg gcaccaggcg cgaccgcccg gagctggcca ggatgcttga 840

ccacctacgc cctggcgacg ttgtgacagt gaccaggcta gaccgcctgg cccgcagcac 900

ccgcgaccta ctggacattg ccgagcgcat ccaggaggcc ggcgcgggcc tgcgtagcct 960

ggcagagccg tgggccgaca ccaccacgcc ggccggccgc atggtgttga ccgtgttcgc 1020

cggcattgcc gagttcgagc gttccctaat catcgaccgc acccggagcg ggcgcgaggc 1080

cgccaaggcc cgaggcgtga agtttggccc ccgccctacc ctcaccccgg cacagatcgc 1140

gcacgcccgc gagctgatcg accaggaagg ccgcaccgtg aaagaggcgg ctgcactgct 1200

tggcgtgcat cgctcgaccc tgtaccgcgc acttgagcgc agcgaggaag tgacgcccac 1260

cgaggccagg cggcgcggtg ccttccgtga ggacgcattg accgaggccg acgccctggc 1320

ggccgccgag aatgaacgcc aagaggaaca agcatgaaac cgcaccagga cggccaggac 1380

gaaccgtttt tcattaccga agagatcgag gcggagatga tcgcggccgg gtacgtgttc 1440

gagccgcccg cgcacgtctc aaccgtgcgg ctgcatgaaa tcctggccgg tttgtctgat 1500

gccaagctgg cggcctggcc ggccagcttg gccgctgaag aaaccgagcg ccgccgtcta 1560

aaaaggtgat gtgtatttga gtaaaacagc ttgcgtcatg cggtcgctgc gtatatgatg 1620

cgatgagtaa ataaacaaat acgcaagggg aacgcatgaa ggttatcgct gtacttaacc 1680

agaaaggcgg gtcaggcaag acgaccatcg caacccatct agcccgcgcc ctgcaactcg 1740

ccggggccga tgttctgtta gtcgattccg atccccaggg cagtgcccgc gattgggcgg 1800

ccgtgcggga agatcaaccg ctaaccgttg tcggcatcga ccgcccgacg attgaccgcg 1860

acgtgaaggc catcggccgg cgcgacttcg tagtgatcga cggagcgccc caggcggcgg 1920

acttggctgt gtccgcgatc aaggcagccg acttcgtgct gattccggtg cagccaagcc 1980

cttacgacat atgggccacc gccgacctgg tggagctggt taagcagcgc attgaggtca 2040

cggatggaag gctacaagcg gcctttgtcg tgtcgcgggc gatcaaaggc acgcgcatcg 2100

gcggtgaggt tgccgaggcg ctggccgggt acgagctgcc cattcttgag tcccgtatca 2160

cgcagcgcgt gagctaccca ggcactgccg ccgccggcac aaccgttctt gaatcagaac 2220

ccgagggcga cgctgcccgc gaggtccagg cgctggccgc tgaaattaaa tcaaaactca 2280

tttgagttaa tgaggtaaag agaaaatgag caaaagcaca aacacgctaa gtgccggccg 2340

tccgagcgca cgcagcagca aggctgcaac gttggccagc ctggcagaca cgccagccat 2400

gaagcgggtc aactttcagt tgccggcgga ggatcacacc aagctgaaga tgtacgcggt 2460

acgccaaggc aagaccatta ccgagctgct atctgaatac atcgcgcagc taccagagta 2520

aatgagcaaa tgaataaatg agtagatgaa ttttagcggc taaaggaggc ggcatggaaa 2580

atcaagaaca accaggcacc gacgccgtgg aatgccccat gtgtggagga acgggcggtt 2640

ggccaggcgt aagcggctgg gttgtctgcc ggccctgcaa tggcactgga acccccaagc 2700

ccgaggaatc ggcgtgacgg tcgcaaacca tccggcccgg tacaaatcgg cgcggcgctg 2760

ggtgatgacc tggtggagaa gttgaaggcc gcgcaggccg cccagcggca acgcatcgag 2820

gcagaagcac gccccggtga atcgtggcaa gcggccgctg atcgaatccg caaagaatcc 2880

cggcaaccgc cggcagccgg tgcgccgtcg attaggaagc cgcccaaggg cgacgagcaa 2940

ccagattttt tcgttccgat gctctatgac gtgggcaccc gcgatagtcg cagcatcatg 3000

gacgtggccg ttttccgtct gtcgaagcgt gaccgacgag ctggcgaggt gatccgctac 3060

gagcttccag acgggcacgt agaggtttcc gcagggccgg ccggcatggc cagtgtgtgg 3120

gattacgacc tggtactgat ggcggtttcc catctaaccg aatccatgaa ccgataccgg 3180

gaagggaagg gagacaagcc cggccgcgtg ttccgtccac acgttgcgga cgtactcaag 3240

ttctgccggc gagccgatgg cggaaagcag aaagacgacc tggtagaaac ctgcattcgg 3300

ttaaacacca cgcacgttgc catgcagcgt acgaagaagg ccaagaacgg ccgcctggtg 3360

acggtatccg agggtgaagc cttgattagc cgctacaaga tcgtaaagag cgaaaccggg 3420

cggccggagt acatcgagat cgagctagct gattggatgt accgcgagat cacagaaggc 3480

aagaacccgg acgtgctgac ggttcacccc gattactttt tgatcgatcc cggcatcggc 3540

cgttttctct accgcctggc acgccgcgcc gcaggcaagg cagaagccag atggttgttc 3600

aagacgatct acgaacgcag tggcagcgcc ggagagttca agaagttctg tttcaccgtg 3660

cgcaagctga tcgggtcaaa tgacctgccg gagtacgatt tgaaggagga ggcggggcag 3720

gctggcccga tcctagtcat gcgctaccgc aacctgatcg agggcgaagc atccgccggt 3780

tcctaatgta cggagcagat gctagggcaa attgccctag caggggaaaa aggtcgaaaa 3840

ggtctctttc ctgtggatag cacgtacatt gggaacccaa agccgtacat tgggaaccgg 3900

aacccgtaca ttgggaaccc aaagccgtac attgggaacc ggtcacacat gtaagtgact 3960

gatataaaag agaaaaaagg cgatttttcc gcctaaaact ctttaaaact tattaaaact 4020

cttaaaaccc gcctggcctg tgcataactg tctggccagc gcacagccga agagctgcaa 4080

aaagcgccta cccttcggtc gctgcgctcc ctacgccccg ccgcttcgcg tcggcctatc 4140

gcggccgctg gccgctcaaa aatggctggc ctacggccag gcaatctacc agggcgcgga 4200

caagccgcgc cgtcgccact cgaccgccgg cgcccacatc aaggcaccct gcctcgcgcg 4260

tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 4320

tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 4380

gtgtcggggc gcagccatga cccagtcacg tagcgatagc ggagtgtata ctggcttaac 4440

tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga aataccgcac 4500

agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg 4560

ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 4620

ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 4680

gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 4740

gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 4800

taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 4860

accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 4920

tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 4980

cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 5040

agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 5100

gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 5160

gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 5220

tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 5280

acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 5340

cagtggaacg aaaactcacg ttaagggatt ttggtcatgc attctaggta ctaaaacaat 5400

tcatccagta aaatataata ttttattttc tcccaatcag gcttgatccc cagtaagtca 5460

aaaaatagct cgacatactg ttcttccccg atatcctccc tgatcgaccg gacgcagaag 5520

gcaatgtcat accacttgtc cgccctgccg cttctcccaa gatcaataaa gccacttact 5580

ttgccatctt tcacaaagat gttgctgtct cccaggtcgc cgtgggaaaa gacaagttcc 5640

tcttcgggct tttccgtctt taaaaaatca tacagctcgc gcggatcttt aaatggagtg 5700

tcttcttccc agttttcgca atccacatcg gccagatcgt tattcagtaa gtaatccaat 5760

tcggctaagc ggctgtctaa gctattcgta tagggacaat ccgatatgtc gatggagtga 5820

aagagcctga tgcactccgc atacagctcg ataatctttt cagggctttg ttcatcttca 5880

tactcttccg agcaaaggac gccatcggcc tcactcatga gcagattgct ccagccatca 5940

tgccgttcaa agtgcaggac ctttggaaca ggcagctttc cttccagcca tagcatcatg 6000

tccttttccc gttccacatc ataggtggtc cctttatacc ggctgtccgt catttttaaa 6060

tataggtttt cattttctcc caccagctta tataccttag caggagacat tccttccgta 6120

tcttttacgc agcggtattt ttcgatcagt tttttcaatt ccggtgatat tctcatttta 6180

gccatttatt atttccttcc tcttttctac agtatttaaa gataccccaa gaagctaatt 6240

ataacaagac gaactccaat tcactgttcc ttgcattcta aaaccttaaa taccagaaaa 6300

cagctttttc aaagttgttt tcaaagttgg cgtataacat agtatcgacg gagccgattt 6360

tgaaaccgcg gtgatcacag gcagcaacgc tctgtcatcg ttacaatcaa catgctaccc 6420

tccgcgagat catccgtgtt tcaaacccgg cagcttagtt gccgttcttc cgaatagcat 6480

cggtaacatg agcaaagtct gccgccttac aacggctctc ccgctgacgc cgtcccggac 6540

tgatgggctg cctgtatcga gtggtgattt tgtgccgagc tgccggtcgg ggagctgttg 6600

gctggctggt ggcaggatat attgtggtgt aaacaaattg acgcttagac aacttaataa 6660

cacattgcgg acgtttttaa tgtactgaat taacgccgaa ttaattcggg ggatctggat 6720

tttagtactg gattttggtt ttaggaatta gaaattttat tgatagaagt attttacaaa 6780

tacaaataca tactaagggt ttcttatatg ctcaacacat gagcgaaacc ctataggaac 6840

cctaattccc ttatctggga actactcaca cattattatg gagaaactcg agcttgtcga 6900

tcgacagatc cggtcggcat ctactctatt tctttgccct cggacgagtg ctggggcgtc 6960

ggtttccact atcggcgagt acttctacac agccatcggt ccagacggcc gcgcttctgc 7020

gggcgatttg tgtacgcccg acagtcccgg ctccggatcg gacgattgcg tcgcatcgac 7080

cctgcgccca agctgcatca tcgaaattgc cgtcaaccaa gctctgatag agttggtcaa 7140

gaccaatgcg gagcatatac gcccggagtc gtggcgatcc tgcaagctcc ggatgcctcc 7200

gctcgaagta gcgcgtctgc tgctccatac aagccaacca cggcctccag aagaagatgt 7260

tggcgacctc gtattgggaa tccccgaaca tcgcctcgct ccagtcaatg accgctgtta 7320

tgcggccatt gtccgtcagg acattgttgg agccgaaatc cgcgtgcacg aggtgccgga 7380

cttcggggca gtcctcggcc caaagcatca gctcatcgag agcctgcgcg acggacgcac 7440

tgacggtgtc gtccatcaca gtttgccagt gatacacatg gggatcagca atcgcgcata 7500

tgaaatcacg ccatgtagtg tattgaccga ttccttgcgg tccgaatggg ccgaacccgc 7560

tcgtctggct aagatcggcc gcagcgatcg catccatagc ctccgcgacc ggttgtagaa 7620

cagcgggcag ttcggtttca ggcaggtctt gcaacgtgac accctgtgca cggcgggaga 7680

tgcaataggt caggctctcg ctaaactccc caatgtcaag cacttccgga atcgggagcg 7740

cggccgatgc aaagtgccga taaacataac gatctttgta gaaaccatcg gcgcagctat 7800

ttacccgcag gacatatcca cgccctccta catcgaagct gaaagcacga gattcttcgc 7860

cctccgagag ctgcatcagg tcggagacgc tgtcgaactt ttcgatcaga aacttctcga 7920

cagacgtcgc ggtgagttca ggctttttca tatctcattg ccccccggga tctgcgaaag 7980

ctcgagagag atagatttgt agagagagac tggtgatttc agcgtgtcct ctccaaatga 8040

aatgaacttc cttatataga ggaaggtctt gcgaaggata gtgggattgt gcgtcatccc 8100

ttacgtcagt ggagatatca catcaatcca cttgctttga agacgtggtt ggaacgtctt 8160

ctttttccac gatgctcctc gtgggtgggg gtccatcttt gggaccactg tcggcagagg 8220

catcttgaac gatagccttt cctttatcgc aatgatggca tttgtaggtg ccaccttcct 8280

tttctactgt ccttttgatg aagtgacaga tagctgggca atggaatccg aggaggtttc 8340

ccgatattac cctttgttga aaagtctcaa tagccctttg gtcttctgag actgtatctt 8400

tgatattctt ggagtagacg agagtgtcgt gctccaccat gttatcacat caatccactt 8460

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 8520

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 8580

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 8640

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 8700

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 8760

ccaccatgtt gggcccggcg cgccaagctt ctagtgcagt gcagcgtgac ccggtcgtgc 8820

ccctctctag agataatgag cattgcatgt ctaagttata aaaaattacc acatattttt 8880

tttgtcacac ttgtttgaag tgcagtttat ctatctttat acatatattt aaactttact 8940

ctacgaataa tataatctat agtactacaa taatatcagt gttttagaga atcatataaa 9000

tgaacagtta gacatggtct aaaggacaat tgagtatttt gacaacagga ctctacagtt 9060

ttatcttttt agtgtgcatg tgttctcctt tttttttgca aatagcttca cctatataat 9120

acttcatcca ttttattagt acatccattt agggtttagg gttaatggtt tttatagact 9180

aattttttta gtacatctat tttattctat tttagcctct aaattaagaa aactaaaact 9240

ctattttagt ttttttattt aataatttag atataaaata gaataaaata aagtgactaa 9300

aaattaaaca aatacccttt aagaaattaa aaaaactaag gaaacatttt tcttgtttcg 9360

agtagataat gccagcctgt taaacgccgt cgacgagtct aacggacacc aaccagcgaa 9420

ccagcagcgt cgcgtcgggc caagcgaagc agacggcacg gcatctctgt cgctgcctct 9480

ggacccctct cgagagttcc gctccaccgt tggacttgct ccgctgtcgg catccagaaa 9540

ttgcgtggcg gagcggcaga cgtgagccgg cacggcaggc ggcctcctcc tcctctcacg 9600

gcacggcagc tacgggggat tcctttccca ccgctccttc gctttccctt cctcgcccgc 9660

cgtaataaat agacaccccc tccacaccct ctttccccaa cctcgtgttg ttcggagcgc 9720

acacacacac aaccagatct cccccaaatc cacccgtcgg cacctccgct tcaaggtacg 9780

ccgctcgtcc tccccccccc cccctctcta ccttctctag atcggcgttc cggtccatgg 9840

ttagggcccg gtagttctac ttctgttcat gtttgtgtta gatccgtgtt tgtgttagat 9900

ccgtgctgct agcgttcgta cacggatgcg acctgtacgt cagacacgtt ctgattgcta 9960

acttgccagt gtttctcttt ggggaatcct gggatggctc tagccgttcc gcagacggga 10020

tcgatttcat gatttttttt gtttcgttgc atagggtttg gtttgccctt ttcctttatt 10080

tcaatatatg ccgtgcactt gtttgtcggg tcatcttttc atgctttttt ttgtcttggt 10140

tgtgatgatg tggtctggtt gggcggtcgt tctagatcgg agtagaattc tgtttcaaac 10200

tacctggtgg atttattaat tttggatctg tatgtgtgtg ccatacatat tcatagttac 10260

gaattgaaga tgatggatgg aaatatcgat ctaggatagg tatacatgtt gatgcgggtt 10320

ttactgatgc atatacagag atgctttttg ttcgcttggt tgtgatgatg tggtgtggtt 10380

gggcggtcgt tcattcgttc tagatcggag tagaatactg tttcaaacta cctggtgtat 10440

ttattaattt tggaactgta tgtgtgtgtc atacatcttc atagttacga gtttaagatg 10500

gatggaaata tcgatctagg ataggtatac atgttgatgt gggttttact gatgcatata 10560

catgatggca tatgcagcat ctattcatat gctctaacct tgagtaccta tctattataa 10620

taaacaagta tgttttataa ttattttgat cttgatatac ttggatgatg gcatatgcag 10680

cagctatatg tggatttttt tagccctgcc ttcatacgct atttatttgc ttggtactgt 10740

ttcttttgtc gatgctcacc ctgttgtttg gtgttacttc tgcactaggt accaggcctg 10800

agctctatcg cccctacgtc agctccatct ccaggtccgt cgcttctctt ccatttcttc 10860

tcattttcga ttttgattct tatttctttc cagtagctcc tgctctgtga atttctccgc 10920

tcacgataga tctgcttata ctccttacat tcaaccttag atctggtctc gattctctgt 10980

ttctctgttt ttttcttttg gtcgagaatc tgatgtttgt ttatgttctg tcaccattaa 11040

taataatgaa ctctctcatt catacaatga ttagtttctc tcgtctacaa aacgatatgt 11100

tgcattttca cttttcttct ttttttctaa gatgatttgc tttgaccaat ttgtttagat 11160

ctttatttta ttttattttc tggtgggttg gtggaaattg aaaaaaaaaa aaacagcata 11220

aattgttatt tgttaatgta ttcatttttt ggctatttgt tctgggtaaa aatctgcttc 11280

tactattgaa tctttcctgg attttttact cctattgggt ttttatagta aaaatacata 11340

ataaaaggaa aacaaaagtt ttatagattc tcttaaaccc cttacgataa aagttggaat 11400

caaaataatt caggatcaga tgctctttga ttgattcaga tgcgattaca gttgcatggc 11460

aaattttcta gatccgtcgt cacattttat tttctgttta aatatctaaa tctgatatat 11520

gatgtcgaca aattctggtg gcttatacat cacttcaact gttttctttt ggctttgttt 11580

gtcaacttgg ttttcaatac gatttgtgat ttcgatcgct gaatttttaa tacaagcaaa 11640

ctgatgttaa ccacaagcaa gagatgtgac ctgccttatt aacatcgtat tacttactac 11700

tagtcgtatt ctcaacgcaa tcgtttttgt atttctcaca ttatgccgct tctctactct 11760

ttattccttt tggtccacgc attttctatt tgtggcaatc cctttcacaa cctgatttcc 11820

cactttggat catttgtctg aagactctct tgaatcgtta ccacttgttt cttgtgcatg 11880

ctctgttttt tagaattaat gataaaacta ttccatagtc ttgagttttc agcttgttga 11940

ttcttttgct tttggttttc tgcagaaaca tgggtgcagg tggaagacgc gttacgtagt 12000

cgacggatcc ccgggaattc taagaggagt ccaccatggt agatctgact agtgttaacg 12060

Claims

1.OsMADS1Research on seed-specific interference vectorsOsMADS1The application of the gene in the specific regulation and control functions of rice seed development, seed morphology and rice protein content is characterized in that: the above-mentionedOsMADS1A seed-specific interfering vector of pOsGluB-4::OsMADS1-an RNAi vector whose DNA sequence is shown in SEQ ID NO 10.

2.OsMADS1The application of the seed specific interference carrier in improving the rice grain type and the rice protein content is characterized in that: the above-mentionedOsMADS1A seed-specific interfering vector of pOsGluB-4::OsMADS1-an RNAi vector whose DNA sequence is shown in SEQ ID NO 10.