CN112759644A

CN112759644A - Heavy chain and light chain variable region gene of mycobacterium tuberculosis MPT64 protein monoclonal antibody, encoded polypeptide and application thereof

Info

Publication number: CN112759644A
Application number: CN202110115702.4A
Authority: CN
Inventors: 柏银兰; 宁唤唤; 康健; 张薇; 梁璇; 任瑞; 白鹭; 谢燕玲; 赵君豪; 吴正锋; 田茂林
Original assignee: Air Force Medical University of PLA
Current assignee: Air Force Medical University of PLA
Priority date: 2021-01-28
Filing date: 2021-01-28
Publication date: 2021-05-07

Abstract

The invention relates to heavy chain and light chain variable region genes of a monoclonal antibody of mycobacterium tuberculosis MPT64 protein, encoded polypeptides and application thereof. A monoclonal antibody of anti-mycobacterium tuberculosis MPT64 protein, namely mAb MPT64-A5B2, has a heavy chain variable region gene with a sequence of SEQ ID NO.1 and a light chain variable region gene with a sequence of SEQ ID NO. 3. The heavy chain variable region gene encoding polypeptide has the sequence of SEQ ID NO.2, and the light chain variable region gene encoding polypeptide has the sequence of SEQ ID NO. 4. The MPT64-A5B2 monoclonal antibody has good specificity. The variable region genes of the heavy chain and the light chain of the monoclonal antibody MPT64-A5B2 and the encoded polypeptide are applied to the preparation of a reagent, a vaccine and a medicament of the mycobacterium tuberculosis, and have better application prospect.

Description

Heavy chain and light chain variable region gene of mycobacterium tuberculosis MPT64 protein monoclonal antibody, encoded polypeptide and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and relates to the fields related to immunology and molecular biology. In particular to a heavy chain and light chain variable region gene of a monoclonal antibody of mycobacterium tuberculosis MPT64 protein, a coded polypeptide and application thereof.

Background

Tuberculosis (TB) is a chronic infectious disease caused by infection with Mycobacterium tuberculosis (Mtb). Bacillus Calmette-guerin (BCG) is currently the only prophylactic TB vaccine approved for use. Vaccination with BCG effectively suppressed the widespread prevalence of TB. However, as the problem of drug resistance of bacteria becomes more serious and the number of cases of TB combined AIDS infection increases, the TB epidemic situation is heated again, which brings great challenges to public health. The gold standard for diagnosing Active Tuberculosis (ATB) is internationally accepted as positive for culturing Mtb in sputum, bronchoalveolar lavage fluid or other sterile body fluid, and/or the biopsy meets the pathological manifestations of Mtb infection, but the two methods have the defects of long time consumption, invasiveness and the like, particularly the Mtb culture needs more than 4 weeks, and the positive rate is low. Simple and rapid smear acid-fast staining and chest imaging are often lack of specificity for TB diagnosis.

Tuberculin Skin Test (TST) tuberculin Pure Protein Derivatives (PPD) are used as stimulating antigens for diagnosis of Mtb infections. However, due to widespread vaccination with the BCG vaccine, TST cannot distinguish between BCG vaccination, non-tuberculous mycobacteria (NTM) and Mtb infection, with false positive results. In addition, drug-resistant TB cases are on the rise, and the prevalence of drug-resistant TB continues to threaten the progress that TB prevention and control work has taken. The treatment of TB still depends on antibiotics such as isoniazid, rifampicin, ethambutol and the like, and the discovery and the development of new antibiotics have great difficulty. Therefore, intensive research on diagnosis, prevention and treatment of TB is of great significance for effective control of TB epidemic.

Mtb Culture Filtrate Proteins (CFP) contain protein molecules secreted by Mtb during growth. Some of the proteins, such as Ag85 complex, ESAT-6, CFP10, MPT64, MPT32 and the like, can induce significant humoral and cellular immune responses in animal experiments, thereby becoming candidate antigens for preparing vaccines and diagnostic reagents. MPT64 consists of 228 amino acids encoded by 687 bases and encoded by the Mtb Rv1980c (also known as mpb64) gene. Studies have shown that MPT64 is located in the second missing differential coding region 2 (RD 2) during the passage of BCG, is only present in some strains of Mtb, is absent in BCG passaged after 1927, and is absent in most non-pathogenic NTM. Thus, detection of the MPT64 gene, protein or antibody can aid in the diagnosis of Mtb infection.

Since MPT64 is only present in some Mtb strains, testing for MPT64 gene and protein can be used to identify Mtb infections and other mycobacterial infections. MPT64 gene of Mtb clinical isolates shows polymorphism (J Clin Microbiol.2013May; 51(5):1558-62.), the deletion of 63bp can cause false positive of detection results, and single nucleotide mutation does not influence diagnosisSensitivity to breakage (medicine (Baltimore) 2019 Dec; 98(49) e 18073). Extrapulmonary tuberculosis accounts for about 15-20% of all TB cases, and the MPT64 detection has better diagnosis of extrapulmonary tuberculosis under the condition of resource shortage, especially in tuberculous lymphadenitis and childhood tuberculosis (PLoS one.2018May 9; 13(5): e 0196723.). For sputum smear negative patient sera, the peptide mimic of MPT64 showed better sensitivity when tested (J Med Microbiol.2011Jan; 60(Pt 1): 69-74.). The gamma interferon release test (IGRA) is a rapid in vitro immunological diagnosis technology, which collects the whole blood of a patient or separated mononuclear cells, stimulates the RD1 area differential antigens ESAT-6 and CFP-10 in vitro in Mtb culture filtrate, detects the produced gamma interferon to judge whether the organism has mycobacterium tuberculosis infection. Because IGRA does not produce cross reaction with NTM and BCG in other environments, and the specificity is superior to the traditional TST, the IGRA has replaced TST to become a method for diagnosing latent tuberculosis infection (LTBI). The MPT64 protein can stimulate CD4 of body⁺And CD8⁺T cells activate to generate a protective immune response against Mtb. Studies have shown that the MPT64 protein can induce Delayed Type Hypersensitivity (DTH) of Mtb infected guinea pigs (infection Immun.1995 Mar; 63(3):804-10.), and induce an epitope of DTH at the C-terminal Gly of MPT64 protein₁₇₃-Ala₁₈₇Between 15 amino acid regions (Scand J Immunol.1997 May; 45(5): 499-. The study in the previous period of the subject group found that the recombinant MPT64 protein can induce IFN-gamma secretion of the immunized mice to be remarkably increased (preliminary study on expression, purification and immunological specificity of mycobacterium tuberculosis secretory protein MPT64 [ D)]The fourth military medical university, 2003, of the chinese people's liberation force). Therefore, the MPT64 protein can be used for developing a diagnostic reagent for detecting TB in vitro.

A high-sensitivity ELISA method is designed by the antibody MPT64 of Sakashita K and the like, is used for detecting MPT64 antigen in sputum samples of active TB patients, has the sensitivity of 88 percent and the specificity of 96.7 percent, can be used for detecting active tuberculosis and predicting the treatment effect (Int J Infect Dis.2020 Jul; 96: 244-. The MPT64 and CFP-10 antibodies are combined with gold nanoparticles, and are coupled with oligonucleotides, magnetic beads and capture antibodies in a liquid phase for detecting body fluid samples of TB patients, the results show that the sensitivity of the antibodies to pulmonary TB patients and extrapulmonary TB patients is 89.3 and 78.1 percent respectively, the specificity is 97.9-98.3 percent, and the sensitivity of the method for detecting smear negative pulmonary TB patients and extrapulmonary TB patients is obviously higher than that of a GeneXpert method recommended by WHO. Therefore, the anti-MPT64 antibody can be used to develop a more sensitive, more specific TB in vitro diagnostic kit.

Recent studies have shown that antibodies can protect against various experimental models of TB (cell.2016 Oct 6; 167(2): 433-443.). Tran AC and other researches show that the combination of a human monoclonal IgA 2E9 antibody and mouse interferon-gamma directed against an alpha-crystallin (Acr, HspX) antigen of a human transgenic mouse can prevent the infection of the multi-drug resistant mycobacterium tuberculosis (MDR-TB). The study in this subject group also found elevated levels of MPT64 antibody in alveolar lavage fluid from TB patients, significantly higher than in LTBI and normal groups (Front immunol.2020Oct 20; 11: 582833.). The MPT64 protein can stimulate CD4 of body⁺And CD8⁺T cells activate to generate a protective immune response against Mtb. The preliminary study of the subject group finds that the recombinant MPT64 protein is used for immunizing mice to induce humoral and cellular immune responses and effectively reduce the number of visceral organs and lotus bacteria after Mtb infection (preliminary study on expression, purification and immunological characteristics of mycobacterium tuberculosis secretory protein MPT64 [ D)]The fourth military medical university, 2003, of the chinese people's liberation force). MPT64 was thought to be associated with BCG virulence as an early loss protein of BCG passage. Thus, anti-MPT64 antibodies are likely to be useful for the emergency prevention of Mtb infection or for immunotherapy of TB.

In conclusion, the preparation of the anti-MPT64 monoclonal antibody provides support for clinical and laboratory detection, diagnosis and vaccine development of Mtb infection. Anti-MTP 64 antibodies currently on the market include tuberculosis MPT64 antibody (aa24-228) LS-C319088 of Lifesspan Biosciences and Anti-MPT64 antibody (ab193435) of Abcam, and are all rabbit polyclonal antibodies. By searching the international national patent compilation database (http:// patent copy 2.wipo. int /), no report has been found on the current in-vitro and in-vivo studies on the sequence of the variable region of the anti-MPT64 monoclonal antibody.

Disclosure of Invention

The invention aims to provide a heavy chain and light chain variable region gene of an anti-mycobacterium tuberculosis MPT64 monoclonal antibody, a polypeptide coded by the gene and application of the polypeptide.

The invention is realized by the following technical scheme:

by adopting a molecular biology technology, an Rv1980c (MPT64 or mpb64) gene is amplified from an Mtb H37Rv genome by a PCR method, cloned into a prokaryotic expression vector pET28a (+), IPTG induces and expresses a target protein, and the recombinant MPT64 protein is purified by a Ni affinity chromatography method. The BALB/c mouse is immunized subcutaneously by the recombinant protein, spleen cells of the immunized mouse are fused with myeloma cells SP2/0, and a hybridoma cell line is obtained by screening through an indirect ELISA method and is named as MPT64-A5B 2. The hybridoma cell is inoculated to the abdominal cavity of a mouse to prepare ascites, a medium-pressure liquid chromatograph is purified to obtain a purified monoclonal antibody, and the monoclonal antibody secreted by the hybridoma cell MPT64-A5B2 is identified to be capable of being specifically combined with Mtb MPT64 protein.

The heavy chain and light chain variable region genes of the cell strain secreting the monoclonal antibody are obtained by extracting RNA of the MPT64-A5B2 hybridoma cell and performing a reverse transcription PCR (RT-PCR) method. After sequence determination and BLAST comparison analysis in NCBI, the nucleotide sequence of the heavy chain variable region of the antibody is confirmed to have a sequence of SEQ ID NO.1, and the coded amino acid sequence thereof has a sequence of SEQ ID number 2; the light chain variable region gene nucleotide sequence of the antibody has a sequence of SEQ ID NO.3, and the coded amino acid sequence thereof has a sequence of SEQ ID NO. 4.

The results of homology comparison and germline gene source analysis of the heavy and light chain variable region genes of the successfully cloned monoclonal antibody MPT64-A5B2 of the invention with known antibody gene sequence databases (IMGT and NCBI) respectively show that the obtained gene sequences are indeed from mouse germline genes and are not completely consistent with various antibody gene sequences reported in the prior art.

The invention also relates to the application of the heavy and light chain variable region genes of the antibody and the polypeptide coded by the heavy and light chain variable region genes in the preparation of medicaments, vaccines and detection reagents for treating tuberculosis.

The heavy and light chain variable region genes (VH and VL) of the monoclonal antibody are successfully cloned by adopting an RT-PCR method. Based on the heavy chain and light chain variable region genes, the recombinant mycobacterium tuberculosis antigen can be used for constructing and expressing small molecular genetic engineering antibodies in various forms, such as ScFv antibodies, Fab antibodies, F (ab)2 antibodies, antibody fusion proteins and the like, and is used for preparing diagnostic reagents, medicines or vaccines for mycobacterium tuberculosis infection. Because the MPT64 coding gene only exists in the specificity of pathogenic mycobacteria, the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody obtained by the research can lay a certain foundation for the development of Mtb infection accurate diagnostic reagents, vaccines and medicines.

Compared with the prior art, the invention has the following beneficial technical effects:

1. the monoclonal antibody obtained by the invention can specifically recognize MPT64 protein in an Mtb standard strain H37Rv, and has no non-specific reaction with BCG lacking MPT64 antigen and Mycobacterium smegmatis. The MPT64-A5B2 monoclonal antibody is shown to have good specificity.

2. The heavy chain and light chain variable region genes and amino acid sequences of the monoclonal antibody MPT64-A5B2 cloned by the invention are analyzed by sequence to confirm the uniqueness of the antibody sequence.

3. The variable region genes of the heavy chain and the light chain of the monoclonal antibody MPT64-A5B2 are analyzed to obtain the CDR region of the variable region, thereby providing support for the diagnosis and detection of Mtb infection in laboratories and clinics.

Drawings

FIG. 1 is a diagram showing the result of the detection of the subclass of the monoclonal antibody MPT64-A5B 2.

FIG. 2 is a diagram showing the results of detecting the specificity of Mycobacterium with the monoclonal antibody MPT64-A5B 2.

The specific implementation mode is as follows:

the invention uses prokaryotic expression and affinity purification recombinant Mtb Rv1980c (MPT64) protein to immunize female BALB/c mice, and prepares a group of monoclonal antibodies of mice against MPT 64; screening out hybridoma cell strain capable of stably secreting high-affinity anti-MPT64 monoclonal antibody, extracting total RNA of the cell strain, and obtaining the gene sequence of the monoclonal antibody by RT-PCR method; the variable region sequence of the monoclonal antibody gene is confirmed by sequencing, and the uniqueness and Complementary Determining Region (CDR) sequences of the corresponding protein sequences are determined by analysis; provides technical support for the development of diagnostic reagents, vaccines and medicines for Mtb infection of the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody and the encoded polypeptide thereof. The heavy and light chain variable region genes of the monoclonal antibody, the preparation method of the polypeptide coded by the genes and the antibody sequence are only explained in detail below, which is used for explaining the invention but not limiting.

The method is implemented by the following steps:

1 preparation of mouse anti-MPT64 high affinity antibody

1.1 preparation and purification of monoclonal antibodies

According to the monoclonal antibody preparation method (practical monoclonal antibody technology, Xushikeqia main edition, P9-P11), a female BALB/c mouse (purchased from laboratory animal center of air force military medical university) is immunized by purified MPT64 protein, and primary subcutaneous immunization antigen is 50 mu g/Freund's incomplete adjuvant; two weeks apart, subcutaneous immunizations were performed twice; the third subcutaneous immunization antigen is 25 mug/mouse; and taking blood from tail vein one week after the third immunization is finished, and detecting the immunization effect. Immunized mice were boosted with 25 μ g of immunizing antigen per mouse, three days after completion, the mice were sacrificed and splenic lymphocyte suspensions of the immunized mice were prepared and counted.

Mouse myeloma cells SP2/0 were taken at the logarithmic growth phase and counted, and myeloma cells were subjected to cell fusion with spleen lymphocytes at a ratio of 5: 1. The fused cell suspension was added to a 96-well plate containing feeder cells (normal female BALB/c mouse peritoneal macrophages) at 37 ℃ with 5% CO₂And (5) culturing. After cell cloning appeared, cell supernatant was taken for indirect ELISA detection, and positive clones were selected. Cells containing positive clones were cloned by limiting dilution until a hybridoma cell line capable of stably secreting antibody was obtained, designated MPT64-A5B 2. The Ig subclass of antibody secreted by B1C8 was determined, and the result showed that the monoclonal antibody was of IgG1 subclass, kappa-type light chain (FIG. 1).

1.2 recognition of MPT64 protein by monoclonal antibody

Carrying out SDS-PAGE on the protein Marker and the purified MPT64 protein; after electrophoresis, turning the membrane and sealing; incubation with MPT64-A5B2 as primary antibody; the secondary antibody is HRP-goat anti-mouse IgG; the recognition of the MPT64-A5B2 monoclonal antibody to the purified antigen was detected by ECL luminescence. The Western blot result shows that the MPT64-A5B2 monoclonal antibody can specifically recognize the purified recombinant MPT64 protein, and a specific band is arranged at 25kDa (left in figure 2, lane 1).

1.3 recognition of bacterial proteins by monoclonal antibodies

Respectively preparing Mtb strain (H37Rv), BCG, Mycobacterium Smegmatis (MS), Staphylococcus Aureus (SA) mycoprotein and recombinant Ag85B protein, and performing SDS-PAGE; after electrophoresis is finished, transferring a PVDF membrane, and sealing with 5% of skimmed milk powder; the MPT64-A5B2 monoclonal antibody (FIG. 2 left) and the Ag85B polyclonal antibody (FIG. 2 right) are primary antibodies; the secondary antibody is HRP-goat anti-mouse IgG; and detecting by an ECL luminescence method. Western blot results show that the MPT64-A5B2 monoclonal antibody can recognize that the molecular weight of the MPT64 protein in Mtb is about 25kDa, and the lysate of Mycobacterium BCG and MS strains which lack the MPT64 protein has no cross reaction with MPT64-A5B 2; MPT64-A5B2 and SA mycoprotein are subjected to non-specific binding, and the molecular weight is about 38 kDa; the MPT64-A5B2 monoclonal antibody has no cross reaction with the recombinant Ag85B protein (left in figure 2). The recognition result of the internal reference antigen shows that the anti-Ag 85B polyclonal antibody recognizes Ag85B protein (about 30kDa) in mycobacteria in the sample, and also non-specifically binds to SA mycoprotein, and has a molecular weight of about 38kDa (right in FIG. 2). The MPT64-A5B2 monoclonal antibody is shown to have good reaction specificity on MPT 64.

Cloning of heavy chain and light chain variable region genes of monoclonal antibody

2.1 amplification of heavy and light chain variable region sequences of monoclonal antibodies

The hybridoma cells secreting the monoclonal antibody MPT64-A5B2 were cultured in RPMI 1640 containing 10% fetal bovine serum at 37 ℃ in the presence of 5% CO₂Incubate to logarithmic growth phase. Total RNA of hybridoma cells was extracted by TRIzol (Invitrogen corporation) lysis method, and after quantification, reverse transcription was performedThe cDNA was synthesized using a kit (TaKaRa). The cDNA obtained by reverse transcription is taken as a PCR amplification template, a PCR amplification kit (TaKaRa company) is adopted for amplification, heavy chain variable region primers are VH F (upstream primer) and VH R (downstream primer), light chain variable region primers are VL F (upstream primer) and VL R (downstream primer), and VH and VL gene segments of the monoclonal antibody MPT64-A5B2 are respectively obtained.

The PCR reaction system is 50 μ L, and the amplification procedure is as follows: 1min at 95 ℃; circulating for 35 times at 95 deg.C for 5s, 58 deg.C for 30s, and 72 deg.C for 1 min; 5min at 72 ℃. The primer sequence is (simple primer in parentheses):

2.2 cloning of heavy and light chain variable region sequences of monoclonal antibodies

The PCR amplification product was subjected to 1% agarose gel electrophoresis, the target gene fragment was recovered using a PCR clean recovery kit (Axygen Co.), the target gene fragment was ligated to pMD19-T Vector (TaKaRa Co.) using a DNA ligation kit (TaKaRa Co.), and the ligation product was transformed into E.coli DH 5. alpha. competent cells, spread on LB plates containing Amp antibiotics, and cultured overnight at 37 ℃.

Selecting clones on an LB (Luma-Martin) plate containing Amp antibiotics as PCR (polymerase chain reaction) templates, respectively taking primers VH F and VH R corresponding to a heavy chain and primers VL F and VL R corresponding to a light chain as primers, carrying out PCR identification and screening on positive E.coli DH5 alpha transformants for amplification culture, extracting plasmids by using a plasmid small-amount extraction kit (Axygen company), and sending the plasmids to the Protechinics Limited company for gene sequencing. The gene sequence of the heavy chain variable region obtained by sequencing is shown as SEQ ID NO.1, and the gene sequence of the light chain variable region is shown as SEQ ID NO. 3.

3 homology analysis of sequences of heavy chain and light chain variable regions of monoclonal antibody

3.1 homology analysis of nucleotide sequences of variable regions of monoclonal antibodies

After the variable region sequence is sequenced, the nucleotide sequence homology analysis is carried out on the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody MPT64-A5B2 by respectively applying NCBI (GenBank + EMBL + DDBJ + PDB) database (http:// www.ncbi.nlm.nih.gov/blast) and IMGT database (http:// www.imgt.org), the obtained sequences are compared with other reported antibody genes for homology, and the germ line gene sources are analyzed.

The sequence alignment shows that the gene sequence of the heavy chain variable region of the monoclonal antibody MPT64-A5B2 has the highest homology with the gene sequence of the mouse Ig heavy chain variable region with the GenBank accession number AF163738.1, which is 326/342 (95%). The gene sequence of the light chain variable region of the monoclonal antibody MPT64-A5B2 has the highest homology with the gene sequence of the mouse Ig light chain variable region with the number of GenBank: EF030736.1, and reaches 326/333 (98%). The results are shown below:

(1) monoclonal antibody heavy chain <400>1 embryonic line gene source

V-GENE：Musmus IGHV14-4*02 F

J-GENE：Musmus IGHJ3*01 F

D-GENE：No results

Analysis by FR-IMGT and CDR-IMGT showed:

CDR1：GGCTTCAACATTAAAGACTACTAT

CDR2：ATTGATCCTGACAATGGTGATACT

CDR3：AATTTGTTCGCTTAC

results of homology alignment in NCBI show:

RID:YE82HFST013

Query Length:332

Database Name:All non-redundant GenBank+EMBL+DDBJ+PDB sequences(no EST,STS,GSS or HTGS sequences)

Sequence ID:AF163738.1Mus musculus mAb 8.5.1 immunoglobulin heavy chain variable region mRNA,partial cds

Length:346

Score:534bits(289)

Expect:1e-147

Identities:326/342(95％)

Gaps:10/342(2％)

Strand:Plus/Plus

(2) the germ line gene source of the monoclonal antibody light chain <400> 3:

V-GENE：Musmus IGKV1-135*01 F

J-GENE：Musmus IGKJ4*01 F

analysis by FR-IMGT and CDR-IMGT showed:

CDR1：CAGAGCTTCTTAGATAGTGATGGAAAGACATAT

CDR2：CTGGTGTCT

CDR3：TGGCAAGGTACACATTTTCCATTCACG

results of homology alignment in NCBI show:

RID:YE8EJRAS013

Query Length:337

Sequence ID:EF030736.1 Mus musculus hybridoma F24F2 immunoglobulin light chain variable mRNA,partial cds

Length:342

Score:577 bits(312)

Expect:2e-160

Identities:326/333(98％)

Gaps:0/333(0％)

Strand:Plus/Plus

sequence homology analysis shows that the nucleotide sequences of the heavy chain variable regions and the light chain variable regions of the monoclonal antibody MPT64-A5B2 are derived from a mouse embryonic gene, but are not completely consistent with the gene sequences of various single-clone antibodies reported in the prior art, and the gene sequences are unique.

3.2 homology analysis of amino acid sequences of variable regions of monoclonal antibodies

The amino acid sequence of the heavy chain variable region of the monoclonal antibody MPT64-A5B2 is shown as SEQ ID NO.2, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 4. Amino acid sequence homology analysis (Blastp) was performed in the non-redundant GenBank CDS transitions + PDB + SwissProt + PIR + PRF protein database. The analysis result shows that the amino acid sequence of the heavy chain of the monoclonal antibody MPT64-A5B2 has the highest homology with the heavy chain variable region protein of a mouse Ig with the number of BAN13604.1, and the homology is 103/114 (90%). The light chain amino acid sequence of monoclonal antibody MPT64-A5B2 has the highest homology, up to 104/112 (93%), with the mouse Ig light chain variable region protein numbered ABK 41137.1. The results of the amino acid homology alignment of the heavy chain and the light chain are shown below:

(1) the heavy chain amino acid sequence of the monoclonal antibody <400>2 alignment result:

RID:YEB0V7ND01R

Query ID:lcl|Query_87359

Query Length:336

Database Name:All non-redundant GenBank CDS translations+PDB+SwissProt+PIR+PRF excluding environmental samples from WGS projects

Sequence ID:BAN13604.1 immunoglobulin heavy chain, partial[Mus musculus]

Length:115

Score:213 bits(541)

Expect:3e-69

Identities:103/114(90％)

Positives:108/114(2％)

Gaps:3/114(2％)

(2) the monoclonal antibody light chain amino acid sequence <400>4 homology alignment result:

RID:YEBGYZME016

Query ID:lcl|Query_83963

Query Length:337

Sequence ID:ABK41137.1 immunoglobulin light chain variable,partial[Mus musculus]

Length:114

Score:194 bits(493)

Expect:6e-62

Identities:104/112(93％)

Positives:109/112(97％)

Gaps:0/112(0％)

homology analysis shows that the amino acid sequences of the heavy chain variable regions and the light chain variable regions of the monoclonal antibody MPT64-A5B2 are murine proteins, although the amino acid sequences of the monoclonal antibody MPT64-A5B2 have homology with other protein amino acid sequences, completely identical amino acid sequences with the amino acid sequences of the monoclonal antibody MPT are not found, and the amino acid sequences of the monoclonal antibody MPT64-A5B2 are unique.

3.3 determination of CDR regions

The heavy chain and light chain variable region sequences of the monoclonal antibody MPT64-A5B2 obtained by sequencing are analyzed on a VBASE2 website (http:// www.vbase2.org/vbase2.php), and CDR regions of the monoclonal antibody are obtained.

The 3 Complementarity Determining Regions (CDR) sequences of the heavy chain variable region of the monoclonal antibody MPT64-A5B2 are shown in a part SEQ ID NO.2 and specifically include:

CDR1:Gly-Phe-Asn-Ile-Lys-Asp-Tyr-Tyr

CDR2:Ile-Asp-Pro-Asp-Asn-Gly-Asp-Thr

CDR3:Asn-Leu-Phe-Ala-Tyr

the variable region 3 Complementarity Determining Regions (CDR) sequences of monoclonal antibody MPT64-A5B2 are shown in SEQ ID NO.4, and specifically include:

CDR1:Gln-Ser-Phe-Leu-Asp-Ser-Asp-Gly-Lys-Thr-Tyr

CDR2:Leu-Val-Ser

CDR3:Trp-Gln-Gly-Thr-His-Phe-Pro-Phe-Thr

heavy chain and light chain variable region genes of mycobacterium tuberculosis MPT64 protein monoclonal antibody, encoded polypeptide and application thereof

Neither the MPT64 protein was present in BCG nor MS, therefore MPT64 was an Mtb-specific antigen. The monoclonal antibody MPT64-A5B2 prepared by the invention can specifically recognize MPT64 of Mtb, and does not generate non-specific binding with BCG and MS strains of mycobacterium, which shows that the monoclonal antibody MPT64-A5B2 prepared by the invention can be used for diagnosing Mtb infection. MPT64, a protein lost early in the passage of BCG, was thought to be associated with the virulence of BCG. In addition, the MPT64 can induce an enhanced immune response as a subunit vaccine, and is helpful for resisting Mtb infection, so that the monoclonal antibody MPT64-A5B2 prepared by the invention is possibly used for emergency prevention of Mtb infection or immunotherapy of TB.

The monoclonal antibody MPT64-A5B2 prepared by the invention has good specificity to Mtb MPT64, can be used for identification research of MPT64 interaction protein, and provides important support for separation, purification, identification and TB diagnosis and prevention of Mtb MPT64 and interaction antigen. The invention successfully obtains heavy and light chain variable region genes (VH and VL) of the monoclonal antibody MPT64-A5B2, and can be used for constructing and expressing small molecular genetic engineering antibodies or medicines in various forms, such as: the small molecule antibody, mainly Fab antibody, single chain antibody, Fv fragment antibody, single domain antibody and the minimum recognition unit composed of single CDR, etc., is used for the development of diagnostic reagent, medicine or vaccine for Mtb infection.

Sequence listing

<110> China people liberation military and military medical university

<120> heavy chain and light chain variable region gene of mycobacterium tuberculosis MPT64 protein monoclonal antibody, encoded polypeptide and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 332

<212> DNA

<213> Artificial sequence (unknown)

<400> 1

gaggttcagc tgcagcagtc tggggcagag cttgtgaggt caggggcctc agtcaagtcg 60

tcctgcacag cttctggctt caacattaaa gactactata tgaactgggt gaagcagagg 120

cctcaacagg gcctggagtg gattggatgg attgatcctg acaatggtga tactgaatat 180

gccccgaagt tccagggcaa ggccactatg actgcagaca catcctccaa cacagcctac 240

ctgcagctca gcagcctgac atctgaggac actgccgtct attactgtaa tttgttcgct 300

tactggggcc aagggactct ggtcaccgtc tc 332

<210> 2

<211> 112

<212> PRT

<213> Artificial sequence (unknown)

<220>

<221> V_region

<222> (26)..(.32)

<223> heavy chain CDR1 region

<220>

<221> V_region

<222> (51)..(.58)

<223> heavy chain CDR2 region

<220>

<221> V_region

<222> (97)..(.101)

<223> heavy chain CDR3 region

<400> 2

Gln Val Gln Leu Gln Glu Ser Gly Ala Glu Leu Val Arg Ser Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Lys Asp Tyr

20 25 30

Tyr Met Asn Trp Val Lys Gln Arg Pro Gln Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Asp Pro Asp Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe

50 55 60

Gln Gly Lys Ala Thr Met Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Leu Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Thr

100 105 110

<210> 3

<211> 337

<212> DNA

<213> Artificial sequence (unknown)

<400> 3

gacattgtgc tgacccagtc tacactcact ttgtcggtta ccattggaca accagcctcc 60

atctcttgca agtcaagtca gagcttctta gatagtgatg gaaagacata tttgagttgg 120

ttgttacaga ggccaggcca gtctccaaag cgcctaatct atctggtgtc taaactggac 180

tctggagtcc ctggcaggtt cactggcagt ggatcaggga cagatttcac actgaaaatc 240

agcagagtgg aggctgagga attgggagtt tattattgct ggcaaggtac acattttcca 300

ttcacgttcg gctcggggac aaagttggaa ataaaac 337

<210> 4

<211> 112

<212> PRT

<213> Artificial sequence (unknown)

<220>

<221> V_region

<222> (27)..(.37)

<223> light chain CDR1 region

<220>

<221> V_region

<222> (55)..(.57)

<223> light chain CDR2 region

<220>

<221> V_region

<222> (94)..(.102)

<223> light chain CDR3 region

<400> 4

Asp Ile Val Leu Thr Gln Ser Thr Leu Thr Leu Ser Val Thr Ile Gly

1 5 10 15

Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Phe Leu Asp Ser

20 25 30

Asp Gly Lys Thr Tyr Leu Ser Trp Leu Leu Gln Arg Pro Gly Gln Ser

35 40 45

Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro

50 55 60

Gly Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Glu Leu Gly Val Tyr Tyr Cys Trp Gln Gly

85 90 95

Thr His Phe Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

100 105 110

Claims

1. A monoclonal antibody against Mycobacterium tuberculosis MPT64 protein, namely mAb MPT64-A5B2, characterized in that: the heavy chain variable region gene has the sequence of SEQ ID NO.1, and the light chain variable region gene has the sequence of SEQ ID NO. 3.

2. A polypeptide encoded by the heavy chain and light chain variable region genes of the monoclonal antibody of claim 1, wherein: the heavy chain variable region gene encoding polypeptide has the sequence of SEQ ID NO.2, and the light chain variable region gene encoding polypeptide has the sequence of SEQ ID NO. 4.

3. The use of the heavy and light chain variable region genes of the monoclonal antibody of claim 1 as a therapeutic agent, vaccine and detection reagent for tuberculosis.

4. The use of the polypeptide encoded by the heavy chain and light chain variable region genes of the monoclonal antibody of claim 2 as a therapeutic agent, vaccine and detection reagent for tuberculosis.