CN109988770B

CN109988770B - Heavy chain and light chain variable region gene of c-di-AMP synthetase monoclonal antibody, encoded polypeptide and application thereof

Info

Publication number: CN109988770B
Application number: CN201910021777.9A
Authority: CN
Inventors: 柏银兰; 宁唤唤; 周洁; 丁天兵; 许艳慧; 王莹; 康健; 路延之; 刘檗赟; 刘勇
Original assignee: Fourth Military Medical University FMMU
Current assignee: Fourth Military Medical University FMMU
Priority date: 2019-01-10
Filing date: 2019-01-10
Publication date: 2022-11-22
Anticipated expiration: 2039-01-10
Also published as: CN109988770A

Abstract

The invention relates to a heavy chain and light chain variable region gene of a c-di-AMP synthetase monoclonal antibody, a polypeptide coded by the gene and application of the polypeptide. The heavy chain variable region gene has the sequence of SEQ ID NO.1, and the light chain variable region gene has the sequence of SEQ ID NO. 3. The heavy chain variable region gene encoding polypeptide has the sequence of SEQ ID NO.2, and the light chain variable region gene encoding polypeptide has the sequence of SEQ ID NO. 4. The monoclonal antibody DisA-1B8 with the polypeptide coded by the variable region gene has high affinity with Rv3586, can specifically recognize c-di-AMP synthetase in different mycobacteria, but does not recognize the enzyme of other bacteria, and has better specificity. The gene and the polypeptide coded by the gene are applied to the preparation of a reagent, a vaccine and a medicament for infecting mycobacterium tuberculosis and other mycobacteria.

Description

Heavy chain and light chain variable region gene of c-di-AMP synthetase monoclonal antibody, encoded polypeptide and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and relates to the related fields of immunology and molecular biology. In particular to a heavy chain and light chain variable region gene of a monoclonal antibody of anti-c-di-AMP synthetase, coded polypeptide and application of the gene and the coded polypeptide in preparing a reagent, a vaccine and a medicament for infecting mycobacterium tuberculosis and other mycobacteria.

Background

1. Bacterial signal molecule c-di-AMP and its function

The small circular nucleotides are considered a milestone finding in the field of bacteriological research as a second signal molecule for bacteria. Bacteria regulate a series of physiological processes including bacterial growth, nutrient uptake, bacterial motility, biofilm formation and pathogenicity by regulating Cyclic Adenosine monophosphate (cAMP), guanosine tetraphosphate (ppGpp), cyclic diguanylic acid (c-di-GMP), etc. (Gomelsky, M., cAMP, c-di-GMP, c-di-AMP and new cGMP: bacterial use the all. Mol. Microbiol,2011.79 (3): p.562-5.).

Cyclic di-adenosine monophosphate (c-di-AMP) is a small nucleotide signal molecule newly found in 2008, and is only present in bacteria, and the nucleotide is not found in eukaryotic cells. Several studies have reported that c-di-AMP is involved in regulating bacterial DNA damage monitoring, bacterial growth, cell wall homeostasis, fatty acid synthesis, ion transport, and bacterial virulence physiological processes. In addition, c-di-AMP has been found to induce a host innate immune response, induce autophagy in host cells, and activate inflammatory bodies. c-di-AMP as a mucosal adjuvant in combination with antigens induces high levels of Th1/Th2/Th17 adaptive immune responses and directly promotes maturation of antigen-presenting cells, and is considered a pathogen-associated molecular pattern newly found in innate immune responses (PAMPs). Thus, c-di-AMP is becoming a new target in bacterial drug and vaccine research (Commichau FM, heidemann JL, ficner R, st. Lke J. Making and breaking of an addressing point: the cycles and phosphorus diseases at the product and the addressing of the addressing point cyclic di-AMP in bacterium.2018 Sep 17. Pii.

2. c-di-AMP synthetase

Bacillus subtilis DNA integrity checking protein (DisA) is the first found diadenylated cyclase (DAC) (Witte G, hartung S, buttner K, hopfner KP: structural biochemical of bacterial checkpoint protein variants activated by DNA recognition enzymes) mol cells 2008,30 (2): 167-178). After being activated, the DisA protein can catalyze 2 molecules of ATP molecules to synthesize c-di-AMP, and the c-di-AMP interacts with downstream related proteins to regulate related biological processes of bacteria. The DISA contains a diadenylated cyclase (DAC) domain, which is the main site of the enzyme activity of the DISA, is highly conserved in sequence, and widely distributed in bacterial and archaeal genomes, such as Staphylococcus aureus, streptococcus pyogenes, pseudomonas listeria, mycobacterium tuberculosis, etc. (Fahmi T, port GC, cho KH.c-di-AMP: an expression molecular in the signalling pathway at which the virus Regulate the virus activity and virus of Gram-Positive bacteria.

3. C-di-AMP synthetase from Mycobacterium tuberculosis

Tuberculosis (TB) is a chronic infectious disease caused by infection with Mycobacterium Tuberculosis (Mtb). According to the WHO report, about 1 040 ten thousand patients with TB are found globally in 2016, and 170 ten thousand people die of TB. China is one of the high TB burden countries, and the incidence is second to India and Indonesia. TB is one of major diseases which are mainly controlled nationwide by the Ministry of health of China.

The inventor Bai Yinlan and the like of the present patent application firstly reports that Rv3586 is DAC enzyme for synthesizing c-di-AMP in Mtb, and the structure and the function of the DAC enzyme are similar to those of DisA, and the DAC enzyme is named Mtb DisA. By analyzing the genome of Mtb, rv3586 was found to be the only c-di-AMP synthetase in Mtb. Mtb Rv3586 is composed of three domains of N (DAC), M and C (HhH), in which amino acids 1-140 are N-terminal Domain (Domain) and contain DAC Domain (DAC Domain), which is the main active Domain of C-di-AMP synthetase. Rv3586 has DGA and RHR conserved motifs consistent with the Bacillus subtilis DisA protein, in which following mutation of the RHR, the protein is unable to bind ATP and thus loses DAC activity. Both chemically and biologically synthesized c-di-AMP specifically binds to Rv3586 and is the sole substrate of Rv3586 (Bai Y, yang J, zhou X, ding X, eisele LE, bai g.2012.Mycobacterium tuberculosis Rv3586 (DacA) is a diadenylated cycle enzyme that is ATP or ADP endo c-di-AMP. Plos One 7 e 35206). Subject group preliminary studies showed that higher titers of Rv3586 antibodies were detected in sera from both Mtb-infected animals and TB patients, and that immunization with the dispa recombinant protein subunit vaccine induced a stronger humoral immune response in mice (Cao Tianyu, ji Saiyu, chu Yangguang, wang Limei, kangjian, wang Lifei, xu Zhikai, beauveria. Mycobacterium tuberculosis c-di-AMP synthase expression and purification and mouse polyclonal antiserum preparation [ J ]. Journal of chinese etiology, 2015, (08): 681-684 688.). Therefore, rv3586 is a good target for Mtb novel vaccine and drug research.

Searching a genome database, finding that the c-di-AMP synthetase contained in different bacteria of the mycobacterium has high homology, such as Mtb attenuated strain H37Ra, tuberculosis unique preventive vaccine BCG (Bacillus Calmette-Guerin, BCG) and the like, and the c-di-AMP synthetase contained in the mycobacterium has 99 percent of consistency with the sequence of Rv 3586. The c-di-AMP synthetase MSMEG-6080 contained in fast-growing, non-pathogenic Mycobacterium Smegmatis (MS) has 84% homology to Rv3586 and contains the DisA conserved motif. Thus, c-di-AMP synthetase is highly conserved among Mycobacterium, and antibodies recognizing Rv3586 can also recognize other Mycobacteria.

At present, no research on Mtb c-di-AMP synthetase monoclonal antibodies is reported at home and abroad.

Disclosure of Invention

The invention aims to provide a heavy chain and light chain variable region gene of a c-di-AMP synthetase monoclonal antibody, polypeptides encoded by the heavy chain and light chain variable region gene, and application of the gene and the polypeptides in preparation of reagents, vaccines and medicines for infection of mycobacterium tuberculosis and other mycobacteria.

The invention is realized by the following technical scheme:

adopting molecular biology technology, amplifying Rv3586 DAC structural domain gene from Mtb H37Rv genome by PCR method, cloning into prokaryotic expression vector, inducing expression target protein, purifying by affinity chromatography and obtaining recombinant Rv3586 DAC structural domain protein; the recombinant protein is used for immunizing mice conventionally, immune spleen cells are taken to be fused with myeloma cells SP2/0, and a hybridoma cell line is obtained by screening through an ELISA indirect method and is named as DisA-1B8. The hybridoma cells are inoculated in the abdominal cavity of a mouse to prepare ascites, and a monoclonal antibody obtained by purifying the ascites through a medium-pressure liquid chromatograph can be specifically combined with Mtb Rv3586 protein.

The heavy chain and light chain variable region genes of the cell strain secreting the anti-c-di-AMP synthetase Mtb Rv3586 monoclonal antibody are obtained by extracting RNA of the DisA-1B8 hybridoma cell and obtaining the heavy chain and light chain variable region genes of the monoclonal antibody through an RT-PCR method. After sequencing and BLAST comparison analysis in NCBI, the nucleotide sequence of the heavy chain variable region of the antibody was confirmed to have the sequence of SEQ ID No.1, and the encoded amino acid sequence thereof has the sequence of SEQ ID No. 2; the light chain variable region gene nucleotide sequence of the antibody has a sequence of SEQ ID NO.3, and the coded amino acid sequence thereof has a sequence of SEQ ID NO. 4.

The results of homology comparison and embryonic line gene source analysis of the monoclonal antibody heavy chain variable region gene and the monoclonal antibody light chain variable region gene of the anti-c-di-AMP synthetase Mtb 3586 successfully cloned by the invention and known antibody gene sequence databases (IMGT and NCBI) respectively show that the obtained gene sequences are from mouse embryonic line genes and are not completely consistent with various antibody gene sequences reported in the prior art.

The invention also relates to the application of the heavy chain and light chain variable region genes of the antibody and the polypeptide coded by the heavy chain and light chain variable region genes in the preparation of reagents, vaccines and medicines for infecting mycobacterium tuberculosis and other mycobacteria.

The heavy chain variable region gene and the light chain variable region gene (VH and VL) of the monoclonal antibody are successfully cloned by adopting an RT-PCR method. Based on the heavy chain and light chain variable region genes, the recombinant mycobacterium tuberculosis antigen can be used for constructing and expressing small molecular genetic engineering antibodies in various forms, such as ScFv antibodies, fab antibodies, F (ab) 2 antibodies, antibody fusion proteins and the like, and is used for preparing diagnostic reagents, medicines or vaccines for mycobacterium tuberculosis infection. As the c-di-AMP synthetase gene is highly conserved in mycobacteria, the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody obtained by the research also lay a foundation for the development of other mycobacteria infected reagents, vaccines and medicines.

Compared with the prior art, the invention has the following beneficial technical effects:

1. the sequence analysis of the heavy chain, light chain variable region gene and amino acid sequence of the monoclonal antibody of the anti-c-di-AMP synthetase Mtb 3586 cloned successfully proves the uniqueness of the antibody sequence.

2. The monoclonal antibody with the heavy chain and light chain variable region genes and the amino acid sequences can specifically recognize Rv3586 and carry out immunoreaction, can recognize DAC structural domain proteins in different mycobacteria, and has good specificity.

3. The variable region genes of the heavy chain and the light chain of the monoclonal antibody DisA-1B8 are analyzed to obtain the CDR region of the variable region, thereby providing support for laboratory Mtb and other mycobacterial bacteriological detection and clinical detection.

Drawings

FIG. 1 is a diagram showing the result of detecting the mAb subclass by indirect ELISA.

FIG. 2 is a diagram showing the result of detecting the affinity of mAb antibody by indirect ELISA method.

FIG. 3 is a graph showing the result of recognition of Rv3586 by Western-blot detection mAb.

FIG. 4 is a diagram showing the recognition results of different bacterial DAC domain proteins by Western-blot detection mAbs.

Detailed Description

The invention uses prokaryotic expression and purified DAC structural domain protein of Mtb Rv3586 to immunize female BALB/c mice, a group of monoclonal antibodies of mice to resist c-di-AMP synthetase is prepared, hybridoma cell strains which can stably secrete high-affinity anti-c-di-AMP synthetase monoclonal antibodies are screened out, total RNA of the cell strains is extracted, and the gene sequences of the monoclonal antibodies are obtained by an RT-PCR method; confirming the variable region sequence of the monoclonal antibody gene by sequencing, and determining the uniqueness and Complementary Determining Regions (CDR) sequence of the corresponding protein sequence by analysis; provides technical support for the development of the heavy and light chain variable region genes of the monoclonal antibody and the polypeptide coded by the heavy and light chain variable region genes for the infection of mycobacterium tuberculosis and other mycobacteria, as well as reagents, vaccines and medicaments. The heavy and light chain variable region genes of the monoclonal antibody, the preparation method of the polypeptide encoded by the genes, and the antibody sequence are only explained in detail below, which is to explain the invention but not to limit the invention.

The method is implemented by the following steps:

preparation of 1 mouse anti-c-di-AMP synthetase high affinity antibody

1.1 preparation and purification of monoclonal antibodies

According to the monoclonal antibody preparation method (practical monoclonal antibody technology, xu Zhikai main code, P9-P11), female BALB/c mice (purchased from laboratory animal center of air force military medical university) are immunized by using purified Mtb DAC structural domain protein, and 50 mu g/one primary subcutaneous immune antigen is added with Freund's incomplete adjuvant; two weeks apart, subcutaneous immunizations were performed twice; the third subcutaneous immunization antigen is 25 mug/mouse; and taking blood from tail vein one week after the third immunization is finished, and detecting the immunization effect. The immunized mice were boosted with 25. Mu.g of antigen per mouse, three days after completion, the mice were sacrificed and spleen lymphocyte suspensions of the immunized mice were prepared and counted.

Taking mouse myeloma cells SP2/0 in logarithmic growth phase and counting, and carrying out cell fusion on the myeloma cells and spleen lymphocytes according to the proportion of 5:1. Adding the fused cell suspension to a 96-well plate containing feeder cells (normal female BALB/c mouse peritoneal macrophages), at 37 deg.C, 5% ₂ And (5) culturing. After the cell clone appears, taking cell supernatant for indirect ELISA detection, and selecting positive clone. Cells containing positive clones were cloned by limiting dilution until a hybridoma cell line capable of stably secreting antibody was obtained, designated DisA-1B8. The Ig subclass of the antibody secreted by the hybridoma cell line is determined, and the result shows that the monoclonal antibody is of an IgG1 subclass and a kappa light chain (figure 1).

1.2 monoclonal antibody potency and affinity assays

The relative affinity of the monoclonal antibody DisA-1B8 is detected by an indirect ELISA method. The coating antigen is purified DisA protein, the sample to be detected is purified monoclonal antibody diluted in gradient, the detection antibody is HRP-goat anti-mouse IgG, the chromogenic substrate is TMB, and the chromogenic termination solution is 2M H ₂ SO ₄ . The ELISA result shows that the monoclonal antibody DisA-1B8 has the purified antibody titer of 1 ^-5 (FIG. 2).

1.3 recognition of Rv3586 protein by monoclonal antibody

Sequentially loading protein Marker, disA protein, DAC structural domain protein (DisA domain) and Mycobacterium smegmatis DisA (MS DisA) purified protein samples, and performing SDS-PAGE; after electrophoresis, turning the membrane and sealing; primary antibody was purified antibody DisA-1B8 (1; the secondary antibody was HRP-goat anti-mouse IgG (1; ECL luminescence method is used for detecting the recognition effect of the monoclonal antibody on different antigens. Western blot results show that the monoclonal antibody can specifically recognize Mtb DisA protein, mtb DAC structural domain protein and MS DisA purified protein which are expressed by escherichia coli in a recombinant mode, and the monoclonal antibody has good specificity (figure 3).

1.4 recognition of other bacterial c-di-AMP synthetases by monoclonal antibodies

Separately, the mycoprotein of Staphylococcus Aureus (SA), mycobacterium smegmatis, BCG, mtb attenuated strain (H37 Ra) and Mtb standard strain (H37 Rv) are prepared. Sequentially loading the protein Marker and each protein sample to be detected, and performing SDS-PAGE by using the purified DisA protein as a positive control; after electrophoresis, turning the membrane and sealing; primary antibody was purified monoclonal antibody (1; the secondary antibody was HRP-goat anti-mouse IgG (1; ECL luminescence was used to observe protein expression in different bacteria. Western blot results showed that the monoclonal antibody recognized the c-di-AMP synthetases of BCG, H37Ra and H37Rv, but not the enzymes in MS, SA, and thus had genus specificity (FIG. 4).

Cloning of heavy chain and light chain variable region genes of monoclonal antibody

2.1 amplification of heavy and light chain variable region sequences of monoclonal antibodies

The hybridoma cells secreting the monoclonal antibody were completely cultured in RPMI1640 containing 10% fetal bovine serum at 37 ℃ and 5% CO ₂ Culturing in incubator to logarithmic phase. Total RNA from hybridoma cells was extracted by TRIzol (Invitrogen) lysis method, and cDNA was synthesized using a reverse transcription kit (TaKaRa). The cDNA obtained by reverse transcription is taken as a PCR amplification template, a PCR amplification kit (TaKaRa company) is adopted for amplification, heavy chain variable region primers are VH F (upstream primer) and VH R (downstream primer), light chain variable region primers are VL F (upstream primer) and VL R (downstream primer), and VH and VL gene segments of the monoclonal antibody DisA-1B8 are respectively obtained.

The PCR reaction system is 50 μ L, and the amplification procedure is as follows: 1min at 95 ℃; circulating for 35 times at 95 ℃ for 5s,58 ℃ for 30s and 72 ℃ for 1min; 5min at 72 ℃. Primer sequences are (degenerate primers in parentheses):

2.2 cloning of heavy and light chain variable region sequences of monoclonal antibodies

The PCR product was electrophoresed through 1% agarose gel, the target gene fragment was recovered with a PCR clean recovery kit (Axygen Co.), the target gene recovery fragment was linked with pMD19-T Vector (TaKaRa Co.) respectively with a DNA ligation kit (TaKaRa Co.), the ligation product was transformed into E.coli DH 5. Alpha. Competent cells, spread on LB plate containing Amp antibiotics, and cultured overnight at 37 ℃.

Cloning on an LB (Luma-Martin) plate containing Amp antibiotics is selected as a PCR (polymerase chain reaction) template, primers VH F and VH R corresponding to a heavy chain and primers VL F and VL R corresponding to a light chain are respectively used as primers, E.coli DH5 alpha transformants which are positive in PCR identification and screening are subjected to amplification culture, plasmids are extracted by using a plasmid miniprep (Axygen company), and the plasmids are sent to a company Limited in the Biotechnology (Shanghai) for gene sequencing. The gene sequence of the heavy chain variable region obtained by sequencing is shown as SEQ ID NO.1, the gene sequence of the light chain variable region is shown as SEQ ID NO.3,

3 homology analysis of sequences of heavy chain and light chain variable regions of monoclonal antibody

3.1 homology analysis of nucleotide sequences of variable regions of monoclonal antibodies

After the variable region sequence is sequenced, the nucleotide sequence homology analysis is carried out on the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody DisA-1B8 by respectively applying NCBI (GenBank + EMBL + DDBJ + PDB) database (http:// www.ncbi.nlm.nih.gov/blast) and IMGT database (http:// www.imgt.org), the obtained sequences are compared with other reported antibody genes, and the germ line gene sources are analyzed.

The sequence alignment result shows that the light chain variable region gene sequence of the monoclonal antibody DisA-1B8 has the highest homology with the mouse Ig light chain variable region gene sequence with the GenBank of S61689.1, and reaches 313/321 (98%). The gene sequence of the heavy chain variable region of the monoclonal antibody DisA-1B8 has the highest homology with the gene sequence of the mouse Ig heavy chain variable region with the GenBank accession number of AY648645.1, and is 292/298 (98%). The results are shown below:

(1) The origin of the germ line gene of the monoclonal antibody heavy chain <400> < 1:

V-GENE：Musmus IGHV1S137*01

J-GENE：Musmus IGHJ2*01

D-GENE：Musmus IGHD2-10*02F

analysis by FR-IMGT and CDR-IMGT showed:

CDR1：ggctacacattcactgattatgct

CDR2：attagtacttactatggtgatgct

CDR3：gcaagaggggatggtaattacctctttgcttac

results of homology alignment in NCBI show:

RID:0CU6NS9T015

Query Length:354

Database Name:All non-redundant GenBank+EMBL+DDBJ+PDB sequences(no EST,STS,GSS or HTGS sequences)

Sequence ID:AY648645.1 Mus musculus clone SPLH23 immunoglobulin heavy chain variable region mRNA,partial cds

Length:414

Score:518 bits(280)

Expect:6e-143

Identities:292/298(98％)

Gaps:0/298(0％)

Strand:Plus/Plus

(2) The origin of the germ line gene of the monoclonal antibody light chain <400> < 3:

V-GENE：Musmus IGKV12-44*01

J-GENE：Musmus IGKJ4*01

analysis by FR-IMGT and CDR-IMGT showed:

CDR1：gagaatatttacagttat

CDR2：aatgcaaaa

CDR3：caacatcattatggtactccattcacg

results of homology alignment in NCBI show:

RID:0CJD9YNX014(Expires on 12-05 16:32pm)

Query Length:321

Sequence ID:S61689.1 anti-ferritin immunoglobulin light chain,mRNA Partial

Length:490

Score:549 bits(297)

Expect:2e-152

Identities:313/321(98％)

Gaps:0/321(0％)

Strand:Plus/Plus

sequence homology analysis shows that the nucleotide sequences of the heavy chain variable region and the light chain variable region of the encoding monoclonal antibody DisA-1B8 are derived from a mouse embryonic gene, but are not completely consistent with the gene sequences of various antibodies reported in the prior art, and the invention has uniqueness on the gene sequences.

3.2 homology analysis of amino acid sequences of variable regions of monoclonal antibodies

The amino acid sequence of the heavy chain variable region of the monoclonal antibody DisA-1B8 is shown in SEQ ID NO.2, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO. 4. Amino acid sequence homology analysis (Blastp) was performed in the non-redundant GenBank CDS translations + PDB + SwissProt + PIR + PRF protein database. The analysis result shows that the amino acid sequence of the light chain of the monoclonal antibody DisA-1B8 has the highest homology with the mouse Ig light chain variable region protein with the number of 1F6L _L, and the homology reaches 105/107 (98%). The amino acid sequence of the heavy chain of the monoclonal antibody DisA-1B8 has the highest homology with the mouse Ig heavy chain variable region protein with the number of BAN13750.1, which is 107/119 (90%). The results of the amino acid homology alignment of the heavy chain and the light chain are shown below:

(1) The heavy chain amino acid sequence of the monoclonal antibody <400> -2 alignment results:

RID:0T7095MW014

Query ID:lcl|Query_305570

Query Length:118

Database Name:All non-redundant GenBank CDS translations+PDB+SwissProt+PIR+PRF excluding environmental samples from WGS projects

Sequence ID:BAN13750.1 immunoglobulin heavy chain,partial[Mus musculus]

Length:120

Score:216bits(550)

Expect:1e-70

Identities:107/119(90％)

Positives:110/119(92％)

Gaps:3/119(2％)

(2) The monoclonal antibody light chain amino acid sequence <400> <4 homology alignment results:

RID:0T62E9NP015

Query ID:lcl|Query_87287

Query Length:107

Sequence ID:1F6L_L Chain L,variable light chain dimer of anti-ferritin antibody

Length:114

Score:219bits(557)

Expect:4e-72

Identities:105/107(98％)

Positives:106/107(99％)

Gaps:0/107(0％)

homology analysis shows that the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody DisA-1B8 are mouse-derived proteins, although the amino acid sequences of the monoclonal antibody are homologous with those of other proteins, the amino acid sequences which are completely identical with the amino acid sequences of the monoclonal antibody are not found, and the monoclonal antibody has uniqueness in the amino acid sequences.

3.3 determination of CDR regions

The sequences of the heavy chain and light chain variable regions of the monoclonal antibody DisA-1B8 obtained by sequencing are analyzed on a VBASE2 website (http:// www.vbase2.org/vbase2. Php) to obtain the CDR regions of the monoclonal antibody.

The 3 Complementary Determining Region (CDR) sequences of the variable region of the heavy chain of the monoclonal antibody DisA-1B8 are shown as the SEQ ID NO.2<222> part, and specifically comprise:

CDR1：Gly-Tyr-Thr-Phe-Thr-Asp-Tyr-Ala

CDR2：Ile-Ser-Thr-Tyr-Tyr-Gly-Asp-Ala

CDR3：Ala-Arg-Gly-Asp-Gly-Asn-Tyr-Leu-Phe-Ala-Tyr

the 3 Complementarity Determining Region (CDR) sequences of the variable region of the monoclonal antibody DisA-1B8 light chain are shown in SEQ ID NO.4<222>, and specifically comprise:

CDR1：Glu-Asn-Ile-Tyr-Ser-Tyr

CDR2：Asn-Ala-Lys

CDR3：Gln-His-His-Tyr-Gly-Thr-Pro-Phe-Thr

application of anti-Mtb c-di-AMP synthetase monoclonal antibody DisA-1B8 heavy and light chain variable region gene and encoded polypeptide product thereof

Genomic analysis showed that the c-di-AMP synthetase contained in different bacteria of Mycobacterium has high homology, and that the homology of this enzyme is higher than 90% in most Mtb strains, e.g.H 37Ra, BCG c-di-AMP synthetase amino acid sequences have 100% and 99% similarity to Rv3586, respectively, whereas the enzyme in fast growing, non-pathogenic MS has 84% homology to it. The monoclonal antibody DisA-1B8 containing the heavy chain and light chain variable region sequences can identify Mtb different virulence strains H37Rv and H37Ra, BCG vaccine strain and c-di-AMP synthetase in fast growth MS. Since c-di-AMP synthetase is highly conserved among Mycobacterium, it is presumed that a monoclonal antibody comprising the heavy and light chain variable region sequences of the present invention recognizes other mycobacteria other than those studied, but does not recognize c-di-AMP synthetase of other bacteria, and thus has genus specificity, and can be used for differential diagnosis of bacterial infection. The previous research also shows that the Rv3586 has strong antigenicity and can stimulate the body to generate higher immune response. Therefore, the variable region sequences of the heavy chain and the light chain can also be used for developing a mycobacterium tuberculosis vaccine.

The heavy and light chain variable region sequences of the anti-c-di-AMP synthetase monoclonal antibody successfully obtained by the invention can also be used for constructing and expressing small molecular genetic engineering antibodies or medicines in various forms, such as, for example: small molecule antibodies, such as main Fab antibodies, single-chain antibodies, fv fragment antibodies, single-domain antibodies and minimum recognition units consisting of single CDRs, and the like, are used for developing diagnostic reagents, medicaments or vaccines for mycobacterium tuberculosis infection. As the c-di-AMP synthetase gene is highly conserved in mycobacteria, the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody obtained by the research also lay a certain foundation for the research and development of diagnostic reagents, vaccines and medicaments for other mycobacteria infection.

Sequence listing

<110> fourth university of military medical science of liberty military of people's China

<120> heavy chain and light chain variable region gene of c-di-AMP synthetase monoclonal antibody, encoded polypeptide and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 354

<212> DNA

<213> Artificial sequence (unknown)

<400> 1

caggcccagc tgcagcagtc aggggctgag ctggtgaggc ctggggtctc agtgaagatt 60

tcctgcaagg tttctggcta cacattcact gattatgcta tgcactgggt gaagcagagt 120

catgcaaaga gtctagagtg gattggagtt attagtactt actatggtga tgctagctac 180

aaccagaagt tcaagggcaa ggccacaatg actgtagaca aatcctccag cacactctat 240

atggaacttg ccagactgac atctgaggat tctgccatct attactgtgc aagaggggat 300

ggtaattacc tctttgctta ctggggccaa gggaccacgg tcaccgtctc ctca 354

<210> 2

<211> 118

<212> PRT

<213> Artificial sequence (unknown)

<400> 2

Gln Ala Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Val

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Ala Met His Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile

35 40 45

Gly Val Ile Ser Thr Tyr Tyr Gly Asp Ala Ser Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Leu Tyr

65 70 75 80

Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Gly Asp Gly Asn Tyr Leu Phe Ala Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser

115

<210> 3

<211> 321

<212> DNA

<213> Artificial sequence (unknown)

<400> 3

gacattcaga tgacccagtc tccagcctcc ttatctgcat ctgtgggaga aactgtcacc 60

atcacatgtc gagcaagtga gaatatttac agttatttag catggtatca gcagaaacag 120

ggaaaatctc ctcagctcct ggtctataat gcaaaaacct tagcagaagg tgtgccatca 180

aggttcagtg gcagtggatc aggcacacag ttttctctga agatcaacag cctgcagcct 240

gaagattttg ggagatatta ctgtcaacat cattatggta ctccattcac gttcggctcg 300

gggaccaagg tggagatcaa a 321

<210> 4

<211> 107

<212> PRT

<213> Artificial sequence (unknown)

<400> 4

Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val

35 40 45

Tyr Asn Ala Lys Thr Leu Ala Glu Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Gln Phe Ser Leu Lys Ile Asn Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Gly Arg Tyr Tyr Cys Gln His His Tyr Gly Thr Pro Phe

85 90 95

Thr Phe Gly Ser Gly Thr Lys Val Glu Ile Lys

100 105

Claims

1. The variable region genes of the heavy chain and the light chain of the monoclonal antibody of the c-di-AMP synthetase are characterized in that: the heavy chain variable region gene has the sequence of SEQ ID NO.1, and the light chain variable region gene has the sequence of SEQ ID NO. 3.

2. A polypeptide encoded by the variable region genes of the heavy and light chains of the monoclonal antibody of claim 1, characterized by: the heavy chain variable region gene encoding polypeptide has the sequence of SEQ ID NO.2, and the light chain variable region gene encoding polypeptide has the sequence of SEQ ID NO 4.

3. Use of the heavy and light chain variable region genes of the monoclonal antibody of claim 1 for the preparation of reagents, vaccines and medicaments for infection by mycobacterium tuberculosis and other mycobacteria.

4. Use of the polypeptides encoded by the variable region genes of the heavy and light chains of the monoclonal antibody of claim 2 for the preparation of reagents, vaccines and medicaments for infection by mycobacterium tuberculosis and other mycobacteria.