CN112741823A - Application of vitamin D in preparation of medicine for regulating and controlling macrophages - Google Patents

Abstract

The invention relates to application of vitamin D in preparation of a medicament for regulating and controlling macrophages, discloses new application of vitamin D, and provides a new theory and potential medicament for preventing or clinically treating diseases related to macrophages.

Description

Application of vitamin D in preparation of medicine for regulating and controlling macrophages

Technical Field

The invention relates to the field of biological medicines, in particular to application of vitamin D in preparation of a medicine for regulating and controlling macrophages.

Background

Vitamin D (vitamin D) is a fat-soluble vitamin belonging to the cyclopentane polyhydrophenanthrene compounds. Vitamin D deficiency has been found to be closely related to the development of a variety of diseases (inflammatory response, asthma, cardiovascular disease, diabetes, hypertension, parkinson's disease, tumors, etc.). Vitamin D, which is closely related to human health, includes VD3 (cholecalciferol) and VD2 (ergocalciferol). The main physiological actions of vitamin D and its metabolites are mainly to promote the absorption of calcium and phosphorus in the intestinal tract, inhibit the release of parathyroid gland, maintain the normal levels of calcium and phosphorus in blood, and further ensure the health of bones and the normal functions of nerve and muscle. The extraskeletal role of vitamin D has also been extensively studied and appreciated in this year, and it is believed that vitamin D deficiency can lead to increased risk of infection, particularly respiratory infections. Recent studies have found that vitamin D can induce the differentiation of monocytes into macrophages, reducing the release of inflammatory cells and chemokines and thereby inhibiting the inflammatory response.

Particulate matter is a ubiquitous source of environmental stress, and can be suspended in air for long periods of time, with its concentration in air being positively correlated with air pollution. Due to its small particle size, it can directly enter the bronchioles via the respiratory tract, leading to respiratory diseases, mainly manifested as inflammatory cell infiltration and thickening of alveolar spaces. In addition, exposure of particulate matter can lead to decreased lung function, exacerbation of chronic respiratory diseases such as asthma and chronic obstructive pulmonary disease, and severe cases can lead to lung cancer. Research shows that vitamin D can relieve acute lung injury caused by particulate matters. However, its protective mechanism for slowing inflammation remains to be elucidated.

Macrophages are a special immune cell existing in a body, and different stimulation factors can show proinflammatory and anti-inflammatory effects, inflammation signals and other immune cells interact to eliminate infection, excessive cell and tissue damage can be caused when inflammation is out of control, and then a vicious circle which is difficult to reverse is caused. The existing research finds that various stimulating factors (such as an immune regulatory molecule TIPE2 and the like) can act on macrophages to inhibit inflammation, but the defects of few acquisition ways, complex operation, undefined side effect and the like exist.

Therefore, the development of new uses of vitamin D in relation to immune modulation functions is a problem that needs to be solved urgently by those skilled in the art.

Disclosure of Invention

In order to solve the technical problems, the invention aims to provide application of vitamin D in preparation of a medicament for regulating and controlling macrophages, discloses new application of vitamin D, and provides a new theory and potential medicament for preventing or clinically treating diseases related to macrophages.

The technical scheme of the invention is as follows:

the invention claims the application of vitamin D in the preparation of a medicament for regulating and controlling macrophages.

Further, the medicament is for modulating a functional phenotypic switch of macrophages.

Further, the medicament is used for inhibiting the polarization of macrophages to M1 type and/or promoting the polarization of macrophages to M2 type.

Further, the drug is used to activate autophagy of M2-type macrophages.

Further, the drug promotes macrophage polarization to M2 by activating Stat6-KLF4 pathway. The drug activates KLF4 at the protein level.

As a specific embodiment of the invention, the research of the invention finds that vitamin D is based on Stat6 and an autophagy signal pathway and activates Stat6-KLF4 to relieve acute pneumonia caused by particles. Provides a new theory and potential medicine for clinically treating acute pneumonia.

Further, the drug is an immunomodulator.

Further, the medicament is used for preventing and/or treating respiratory diseases caused by particulate matters.

Further, respiratory diseases include acute lung injury, asthma, or acute lung inflammation.

Further, vitamin D includes 25(OH) D, VD2 or VD 3.

Further, the injection dosage of the medicine is 1000IU/20 g.

By the scheme, the invention at least has the following advantages:

the invention discloses an application of vitamin D in preparing a medicament for regulating and controlling macrophages, which can be used for relieving acute pneumonia caused by particles. On one hand, the invention discloses that vitamin D is based on Stat6 and an autophagy signal pathway to relieve acute lung injury and provide a new theory and potential medicine for clinically treating acute pneumonia; in another aspect, the invention discloses vitamin D promotes macrophage polarization to M2 through Stat6-KLF4 to slow acute pneumonia; in the acute pneumonia model caused by the particles, the mouse acute pneumonia is improved by intraperitoneal injection of 25(OH) D, and a potential medicine and a new idea are provided for treating the acute pneumonia.

The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following description is made with reference to the preferred embodiments of the present invention and the accompanying detailed drawings.

Drawings

FIG. 1 shows the H & E staining results of the lung tissues of the mice of each group according to the present invention;

FIG. 2 shows the macrophage polarization of each group of mice of the present invention detected by flow cytometry;

FIG. 3 shows the immunofluorescence expression of inflammation-associated proteins in mice of various groups;

FIG. 4 shows Stat6 of the present invention^+/+、Stat6^-/-Mouse lung tissue H&E, dyeing results;

FIG. 5 shows the detection of macrophage cell Stat6 by flow cytometry in the invention^+/+、Stat6^-/-Macrophage polarization status in mice;

FIG. 6 shows the expression, immunohistochemistry and immunofluorescence staining of autophagy-related protein LC3 in mouse lung tissue according to the present invention;

FIG. 7 shows the results of immunofluorescence staining of macrophages and autophagy-related proteins of various groups of mice according to the present invention;

FIG. 8 shows Atg7 of the present invention^+/+、Atg7^-/-The QPCR of the mouse detects the expression of inflammation-related protein in alveolar lavage fluid and the expression result of anti-inflammatory factors and proinflammatory factors;

FIG. 9 shows that the expression level of KLF4 is detected by western blot after THP-1 cell siRNA KLF4 gene interference, 25(OH) D treatment and;

FIG. 10 shows that the dual-luciferase reporter gene detects Stat6 promoter activity through THP-1 cell siRNAKLF4 gene interference;

FIG. 11 shows the siRNA expression of siRNAKLF4 gene in THP-1 cells, treated with 25(OH) D, and tested by QPCR for anti-inflammatory and anti-inflammatory related gene expression;

FIG. 12 shows the detection of autophagy-related gene transcript levels by QPCR in THP-1 cells with siRNAKLF4 gene interference, 25(OH) D treatment;

FIG. 13 shows THP-1 cell siRNA KLF4 gene interference of the invention, given 25(OH) D treatment, and the level of apoptosis was detected by flow cytometry.

Detailed Description

The following examples are given to further illustrate the embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Healthy 6-8 week old male Stat6, ATG7 wild type (Stat 6)^+/+、Atg7^+/+) Mice were purchased from the laboratory animal center, academy of sciences, China, weighing 18-20g, SPF grade. Stat6^flox/floxMouse purchased from Atg7 Biotech Ltd^{flox /flox}From the Proc of Suzhou university medical college Wang Jian Rong professor topic group, weight 18-20g, SPF grade, Stat6^flox/flox、Atg7^{flox /flox}Mating with marrow line cell specific knockout tool mice to obtain Stat6^-/-、Atg7^-/-A mouse. The mice are all raised in SPF level experimental animal center in the school district of Duvilla lake of Suzhou university. The environment of the experimental animal is constant temperature and humidity, the room temperature (23 +/-2 ℃) is 50-60% of relative humidity, the illumination time is according to the circadian rhythm, and the animal can keep drinking water and ingesting food freely.

Vitamin D, 4% paraformaldehyde solution (bi yun), DAB color development solution Kit (kang as a century, SP Rabbit & Mouse HRP Kit (DAB), Rabbit/Mouse universal Streptavidin-HRP Kit (DAB), eosin alcohol solution (bi yun), hematoxylin staining solution (bi yun tian).

PBS solution: 10 XPBS solution is prepared, 100ml 10 XPBS solution is added into 900ml deionized water to prepare 1 XPBS solution.

4% chloral hydrate: chloral hydrate is ready for use. Accurately weighing 0.4g of chloral hydrate crystal by using an analytical balance, adding 10ml of deionized water, fully and uniformly shaking the chloral hydrate solution by using a shaking and mixing device, and storing in a dark place.

1 × citrate buffer: citrate buffer (100 × concentrate) was purchased from kang as a century.

Example 1

The method comprises the following steps of (1) establishing a granular dust induced acute pneumonia model and a vitamin D intervention model, wherein the steps are as follows:

4% chloral hydrate in an amount of 0.1ml/10g of abdominal cavityHealthy 6-8 week old male C57BL/6 mice were injected for anesthesia. A vitamin D intervention model was constructed by intraperitoneal injection of 25(OH) D (1000IU/20g) one week before dust particle treatment, and SiO was infused via non-exposed trachea₂(3 mg/mouse) A model of acute pneumonia was constructed and tissue and alveolar lavage fluid were recovered one week later.

Example 2

Four groups are set: control group (Ctrl group), which was healthy C57BL/6 mice, non-exposed organs were perfused with 50. mu.l of saline.

Other experimental groups and construction methods were as follows:

dust group (P group; SiO)₂3 mg/50. mu.l) by non-exposed tracheal infusion of SiO using C57BL/6 mice₂(3 mg/mouse) constructed acute pneumonia model.

Vitamin D group [25(OH) D group; 1000IU/20g ], which is a vitamin D intervention model constructed by intraperitoneal injection of 25(OH) D (1000IU/20g) using C57BL/6 mice.

Vitamin D intervention group [25(OH) D + P group]It is prepared according to the method of example 1 by intraperitoneal injection of 25(OH) D (1000IU/20g) one week before administration of the dust particle treatment, followed by SiO 2 infusion through the unexposed trachea₂(3 mg/mouse) constructed acute pneumonia model.

After the experiment is finished, lung tissues of mice are collected to be subjected to H & E staining, and the intervention effect of 25(OH) D on acute pneumonia is clarified. The method comprises the following specific steps:

(1) preparation of pathological section of lung tissue

After the lung tissue of the mouse is placed in a 4% paraformaldehyde solution for fixing for 1 week, the tissue is taken out for trimming, paraformaldehyde remained in the tissue is washed away, and gradient dehydration is carried out (85% ethanol solution is used for 2 hours, 95% ethanol solution is used for 1 hour and then is replaced by new 95% ethanol solution for 1 hour, and anhydrous ethanol solution is used for 0.5 hour and then is replaced by new anhydrous ethanol solution for 0.5 hour). After dehydration, the tissue was cleared by treatment with xylene for 30 minutes followed by a 10 minute further treatment with fresh xylene solution. The tissues were cleared and then treated with paraffin wax (paraffin was changed every hour for a total of 3 hours). The waxed tissue is then poured into a container along with melted paraffin and poured into cold water to solidify it immediately into a wax block. After the tissue is embedded, the tissue is sliced, then the tissue is attached to a glass slide, and finally the tissue is dried in an oven at 60 ℃ for 5 hours and then taken out for standby.

(2) Hematoxylin-Eosin (H & E) staining

Dewaxing and hydrating white paraffin slices of mouse lung tissues: soaking the mixture in xylene solution for 10min, taking out the xylene solution and replacing with new xylene, and soaking the xylene solution again for 10 min; soaking the mixture for 4 minutes by using absolute ethyl alcohol, and soaking the mixture for 4 minutes again after replacing new absolute ethyl alcohol; then soaking the mixture for 4 minutes by using 95% ethanol, and soaking the mixture for 4 minutes again by using 80% ethanol; finally, washing the fabric for 5 minutes by running water, drying the fabric in the shade, and waiting for dyeing. Placing the dehydrated slices into a hematoxylin water solution for dyeing for 5 minutes, washing with tap water, and sucking residual water on the slices; the slices are divided in hydrochloric acid ethanol for several seconds; washing with running water for 2 hours, and then putting into distilled water for a moment; then putting the mixture into 70 percent and 90 percent ethanol for dehydration for 10 minutes respectively; and (5) putting the mixture into alcohol eosin staining solution for staining for 2-3 minutes. Soaking in 95% ethanol, anhydrous ethanol, and anhydrous ethanol for 5 min, and dehydrating in gradient. Xylene soak for 5 minutes, and finally neutral gum blocking.

The results of H & E staining are shown in fig. 1, where black arrows indicate increased infiltration of inflammatory cells into the lung tissue and thickening of alveolar spaces, and the results in fig. 1 show: compared with Ctrl mice, P mice have increased infiltration of inflammatory cells in lung tissues and thickened alveolar spaces; and after the intervention of 25(OH) D, the pathological change of acute pneumonia caused by particles can be improved.

In addition, the phenotype of macrophages in the test mice was analyzed as follows:

(1) alveolar lavage fluid isolated macrophages (Macrophage in BALF)

The mice were sacrificed and fixed on a console, neck skin was disinfected with 70% ethanol, 1.0cm of skin was longitudinally incised along the median line of the neck skin, the trachea was exposed, a venous indwelling trocar was inserted, and bronchoalveolar lavage was performed with a 1mL syringe using physiological saline. During lavage, 1mL of normal saline is taken each time, the bronchoalveolar at both sides is washed by the tracheal cannula through the tracheal cannula, and the infusion and the suck-back are repeated for 2 timesBronchoalveolar lavage fluid (BALF) was then recovered 2 times with a recovery of greater than 80%. Mixing the recovered BALF, inoculating to culture solution containing 10% fetal calf serum, culturing in 5% C culture box for 2 hr, discarding culture supernatant and non-adherent cells, collecting purified adherent macrophage, and regulating cell number to 1 × 10⁶。

(2) Flow cytometry

Taking out cells, suspending the cells by using 0.3ml of PBS containing 10% calf serum after centrifugal precipitation, transferring the cells into a 1.5ml EP tube, adding 700 mu l of absolute ethyl alcohol, fixing the cells at the temperature of 20 ℃ below zero for 24h, centrifuging the cells for 30s at 3000r/min, removing supernatant, adding lml of PBS to resuspend the cells, centrifuging the cells again to wash the cells once, removing supernatant, suspending the precipitated cells by using 100 mu l of 1mg/ml RNase A, placing the cells at the temperature of 37 ℃ for 30min, adding 400 mu l of 50 mu g/ml PI, placing the cells in a dark place for 10min, and finally analyzing the cells by using a flow cytometer.

The flow cytometry results of figure 2 show that: compared with Ctrl group (fig. 2a1) mice, P group mice had a significant increase in the number of pro-inflammatory M1-type macrophages in alveolar lavage fluid (fig. 2a3), and after 25(OH) D intervention, the polarization of macrophages to M2 was significantly promoted, while the expression of M1-type macrophages was reduced (fig. 2a 4). FIGS. 2b1-b3 are the statistics of the macrophages M1 and M2 of different experimental groups.

In addition, the results of Immunofluorescence expression of inflammation-associated proteins in mice were tested using Indirect Immunofluorescence (IF) analysis, as follows:

live cell indirect immunofluorescence staining: taking out cells from the incubator, discarding the culture solution, adding 1ml of 1 XPBS to wash away the residual culture solution; after discarding PBS, 1ml of cold methanol was added for fixation, and after standing on ice for 15 minutes, the remaining liquid was washed off with 1ml of 1 XPBS twice, and then on the 2 nd washing, the mixture was placed on a shaker for 3 minutes. The round cover glass was taken out of the petri dish, 30 to 100. mu.l of primary antibody (Arg-1(sc-166920) and NOS-2(sc-7271)) was added and the mixture was washed with PBS three times in the dark at room temperature, secondary antibody (Kangji, SP Rabbit & Mouse HRP Kit (DAB), Rabbit/Mouse Universal Streptavidin-HRP Kit (DAB)) was added and the mixture was washed with PBS three times in the dark at room temperature, 70 to 80. mu.l of DAPI was added to stain nuclei of cells, and the mixture was allowed to stand for 15 minutes and then observed under a fluorescence microscope.

Tissue indirect immunofluorescence staining: dewaxing and hydrating white paraffin slices of mouse lung tissues: the same procedure as described above for H & E stain deparaffinization hydration. Placing the paraffin white sheet in a container filled with 1 × citric acid antigen repairing liquid, placing the container on an induction cooker, and heating to perform antigen repairing: boiling for 8 min, cooling for 5 min, and repeating for three times. Adding a proper amount of BSA blocking solution dropwise, carrying out blocking incubation for 30 minutes, placing the paraffin white tablets in a wet box, gently throwing off the blocking solution, adding 30-100 mu l of primary antibody (Arg-1(sc-166920) and NOS-2(sc-7271)), and carrying out incubation at 4 ℃ overnight. The cells were washed with PBS by shaking on a decolouring shaker for 3 times, each time for 5 minutes, after the sections were slightly dried, secondary antibodies (Kangji, SP Rabbit & Mouse HRP Kit (DAB), Rabbit/Mouse Universal Streptavidin-HRP Kit (DAB)) were added, incubated for 1 hour at room temperature in the dark, washed with PBS for 3 times, cell nuclei were stained with DAPI, allowed to stand for 15 minutes, washed with PBS for 3 times, dried, encapsulated with neutral resin, and the results were observed under an optical microscope.

FIGS. 3a1-a4 show indirect immunofluorescence results for bronchoalveolar lavage fluid, and b1-b4 show indirect immunofluorescence results for lung tissue. In contrast to group P, red fluorescence signals were enhanced in alveolar lavage fluid and lung tissue following 25(OH) D intervention, while green fluorescence signals were diminished, and the indirect immunofluorescence results of fig. 3 show: the pro-inflammatory M1-type macrophages in the alveolar lavage fluid and lung tissues of the P group of mice are obviously increased; the 25(OH) D intervention, given, significantly promoted the polarization of macrophages towards M2.

Example 3

Grouping and model construction were both as described in example 2, except that the study was replaced with Stat6^+/+Or Stat6^-/-Mice, 8 mice per group. After one week of rearing, each group of mice was sacrificed and bilateral lung tissues were recovered. The lung tissue was isolated into four ring sections, one quarter of which was stored in 4% paraformaldehyde for fixation for embedding into sections, and the remaining three quarters were frozen in a-80 ℃ freezer for future use.

To Stat6^+/+、Stat6^-/-Mouse lung tissue H&E staining, results are shown in FIG. 4, where the black arrows indicate lung tissueIncreased inflammatory cell infiltration, shown by Stat6^+/+Compared with the group mice, after Stat6 is knocked out by the particle group mice, infiltration of inflammatory cells of lung tissues is increased, and alveolar spaces are thickened; administration of 25(OH) D intervention improves Stat6^+/+Group mice inflamed, but at Stat6^-/-There was no significant effect in mice. In addition, by checking Stat6^+/+、Stat6^-/-Flow cytometry of mouse alveolar lavage fluid (FIG. 5), 25(OH) D intervention, Stat6^+/+Compared with the group mice, Stat6^-/-There was no significant change in the M2 type macrophages in the group mice.

Example 4

Study subjects: c57BL/6 mice; grouping and construction methods were the same as in example 2, with 8 mice per group. After one week of rearing, each group of mice was sacrificed, pulmonary alveolar lavage fluid was collected from the lung tissues of the mice, and bilateral lung tissues were recovered. The lung tissue was isolated into four ring sections, one quarter of which was stored in 4% paraformaldehyde for fixation for embedding into sections, and the remaining three quarters were frozen in a-80 ℃ freezer for future use.

Lung tissue from C57BL/6 mice was Immunohistochemically (IHC) and immunofluorescent stained as in example 2, IHC protocol as follows:

paraffin sections were routinely dewaxed and hydrated (see hematoxylin-eosin stain dewaxed and hydrated above). Placing the slices on a slice frame, placing the slices into a container filled with 1 Xcitrate buffer solution, boiling the slices on an electromagnetic oven until the slices are boiled, boiling the slices for 8 minutes, closing the electromagnetic oven, and cooling the slices for 5 minutes; this procedure (antigen retrieval) was repeated 3 times. After the antigen retrieval is finished, placing the slices on ice to cool for 20 minutes; cooling and washing with water for 5 minutes; the sections were placed in a staining jar containing 1 XPBS solution and washed on a shaker for 5 minutes. Wiping off water stain on the slices, adding 3% H₂O₂Methanol was applied dropwise to the tissue and allowed to act for 15 minutes (on wet box) to eliminate endogenous peroxidase activity. After washing with water for 5 minutes, the sections were placed in 1 XPBS solution and washed on a shaker for 5 minutes. The expression of LC3 was detected by adding murine LC3(sc-398822) and washing with PBS three times for 5 minutes after overnight incubation at 4 ℃. Adding a secondary antibody provided in the reagent kit (Kangji, SP Rabbit)&Mouse HRP Kit (DAB), rabbit/mouse Universal Streptavidin-HRP Kit (DAB)), incubated at 37 ℃ for 20 minutes in an incubator, washed three times with PBS, each for 5 minutes. Dripping DAB staining solution for 2 minutes, and washing after a staining effect is achieved; counterstain with hematoxylin for 1 min, and wash with water for 5 min. Gradient dehydration with ethanol (95%, 95%, 100%, 100% for 4 min each), xylene washing three times for 10min each, and oven drying the slices. And finally, sealing the sheet by using neutral resin, and observing the result under a microscope.

The results are shown in FIGS. 6-7. In fig. 6, immunohistochemistry results and immunofluorescence show: compared to group P, the brown particles increased and the red fluorescence signal increased after 25(OH) D intervention. IHC and alveolar lavage fluid immunofluorescence results show that 25(OH) D can remarkably up-regulate the expression of autophagy-related protein LC 3I/II, and further activate autophagy. Immunofluorescent staining was performed on lung tissue and alveolar lavage fluid from C57BL/6 mice, and the results are shown in FIG. 7. Figure 7 shows that there was an increase in yellow fluorescence signal from macrophages type M2 and no significant change in macrophages type M1 following 25(OH) D intervention compared to group P. Immunofluorescence shows that: 25(OH) D mainly activates autophagy of M2-type macrophages.

Example 5

Grouping and model construction were both as described in example 2, except that the study was replaced with ATG7^+/+、ATG7^-/-Mice, 8 mice per group. After one week of feeding, each group of mice was sacrificed and alveolar lavage fluid was collected from the mice for quantitative real-time polymerase chain reaction.

The Quantitative real time polymerase chain reaction (Q-PCR/qPCR/rt-qPCR) procedure was as follows:

absorbing the culture solution, washing with PBS once, directly adding a proper amount of TRI zon into the culture dish, standing for 2 minutes, and repeatedly blowing and absorbing with a gun head to fully lyse the cells. The lysed cells were transferred to a 1.5ml EP tube, added with an appropriate amount of chloroform, shaken vigorously 50 times and then allowed to stand for 2 minutes. Centrifuging at 12000rpm at 4 deg.C for 15 min, separating the sample into three layers, collecting the upper colorless aqueous layer, adding equal volume of isopropanol, and standing at room temperature for 10 min. Centrifuge at 12000rpm for 20 minutes at 4 ℃ and discard the supernatant. Washing with 75% ethanol for 3 times, each 1 time at 4 deg.C and 12000rpm, centrifuging for 5 min, and discarding the supernatant. Air-drying at room temperature, adding 30-100 microliter of RNase-free water, and fully dissolving RNA. After being placed in a water bath tank at 57 ℃ for 8 minutes, the mixture was allowed to stand on ice for 10 minutes.

RT reactions were prepared on ice using PrimeScript RT Master Mix Perfect Real Time kit, as indicated. Setting reverse transcription conditions: 15 minutes at 37 ℃; 5 seconds at 85 ℃; finally, the mixture was placed at 4 ℃. And adding the obtained RT reaction liquid into a Real Time reaction system in the next step. As SYBR Premix Ex Taq^TMThe Real time PCR reaction was carried out in Specification II (Perfect Real time) (Takara code: DRR 081). A PCR reaction solution was prepared as described using a Thermal Cycler Dice Real Time System (Takara Code: TP800) amplification apparatus, and a Real Time PCR reaction was carried out. Primer information is shown in table 1:

TABLE 1 primer information

Primer name	Forward primer	Reverse primer
			CD86	gaatgctgctgtgcttgtgt	gtgcaggttgcacatgtctt
NOS2	gggcaagtacacaggaggac	agatctctgccagtgttgcc
			CD206	caggcgaccaggaagaagag	cggaactgctggagaatggt
Arg-1	cgcctttctcaaaaggacag	tttttccagcagaccagctt
			STAT6	ctctgtggggcctaatttcca	catctgaaccgaccaggaact
TGFβ	gactctccacctgcaagacc	gactggcgagccttagtttg

The QPCR results are shown in FIG. 8, indicating interaction with ATG7^+/+ATG7 following 25(OH) D intervention in mice compared to^-/-The expression of proinflammatory related genes of the mouse is obviously increased, and the expression of anti-inflammatory related genes is obviously reduced. In addition, the results indicate that Stat6 signal is not activated following knockout autophagy.

Example 6:

study subjects: c57BL/6 mice; the grouping and construction method is the same as in example 2. Mice in each group were sacrificed one week after feeding, 8 mice per group. Mouse alveolar lavage fluid was collected after the end of the experiment to isolate macrophages, and the expression level of KLF4 was observed using Western Blot.

Western Blot: the gel was formulated according to the reagent instructions. Putting the prepared SDS-PAGE gel into an electrophoresis device, slowly pouring electrophoresis liquid, pulling out a comb in the gel, and adding a sample and a protein marker into gel pores, wherein each pore is 10 mu L. And adjusting the voltage to 75V, running the glue at constant voltage, and adjusting the voltage to 180V when a protein marker strip appears. Stopping electrophoresis when the sample runs to the bottom of the electrophoresis. And (5) turning off the power supply, taking out the gel plate, and flushing redundant glue running liquid by tap water. The PVDF membrane is activated by methanol for 15 seconds in advance, and is put into a membrane transferring solution together with filter paper and sponge required by membrane transferring. And (3) starting the gel, buckling the gel into a membrane transferring solution, and placing the gel according to the thick sponge, the thick filter paper, the gel, the PPVDF membrane, the thin filter paper and the thin sponge in sequence to prepare the membrane transferring. The voltage was adjusted to 75V and the membranes were spun for 2 hours. And taking out the transferred film, activating by methanol, rinsing by using triple distilled water, displaying protein after 5 minutes of ponceau dyeing, photographing and recording original data, and cutting a small corner at the upper right corner of the film according to the sample adding direction to show a mark. Primary antibody incubation was performed overnight at 4 ℃ and PBST washed 4 times for 5 minutes each. After incubation for 1 hour, the PBST was washed 4 times for 5 minutes each. Finally, the membrane is swept.

Western blot antibody information: KLF4(sc-393462), GAPDH (sc-32233); HRP secondary antibodies were purchased from immunology: plano, TX: RS0001 (mouse), RS0002 (rabbit).

The results are shown in fig. 9, which indicate that 25(OH) D intervention activates KLF4 at the protein level.

Example 7:

THP-1 cell Si RNA gene interference KLF4 expression (siKLF4: target sequence: gcagcuucaccuauccgautt; Ctrl siRNA: target sequence: uucuccgaacgugucacgutt,) gene interference experimental steps and reagents: cells were seeded in 6-well plates (3X 10 per well)⁵2ml RPMI1640+ 10% FBS). At the same time of inoculation, 2. mu.l of Ctrl siRNA and specific gene KLF4 siRNA (stock concentration: 20. mu.M) and 12. mu.l of Hiperfect Transfection Reagent (Qiagen, 301702) were mixed in 100. mu.l of serum-free RPMI1640, mixed well, left at room temperature for 10 minutes and then added to the inoculated cell mixture and cultured at 37 ℃ for 24 hours. After 24h of serum-free culture, SiO was given to group P₂(100. mu.g/ml) treatment for 24h, 25(OH) D + P group to SiO₂And 25(OH) D (100. mu.g/ml each) for 24 h. Dual luciferase reporter genes and QPCR detect the level of transcription of the associated genes.

Dual luciferase reporter: inserting Ctrl siRNA (Non-target) and specific gene KLF4 siRNA into a reporter gene vector to construct a reporter gene plasmid, transfecting cells with the plasmid, specifically, respectively and uniformly mixing Ctrl siRNA (Non-target) and specific gene KLF4 siRNA with corresponding transfection reagents, adding 20 mul of serum-free culture medium, incubating at normal temperature for 20min, adding a corresponding 12-well plate, transfecting for 6h, replacing fresh culture medium, co-transfecting for 36-48h, discarding the culture medium, washing the cells with 100 mul of PBS, adding 50 mul of 1xPLB into each well, placing the cells in a shaker for 20-30min to ensure that a lysis buffer solution completely lyses the cells, finally adding 10 mul of the supernatant into each well of a white opaque 96-well enzyme-labeled plate, adding 100 mul of Luciferase Assay I, detecting Luciferase reaction intensity by using an enzyme-labeled analyzer, reading the first numerical value, adding 100 mul of Luciferase Assay Reagent II into each well, and (3) measuring the luciferase reaction intensity of the internal reference Renilla.

The dual luciferase reporter, flow cytometry and QPCR results are shown in FIGS. 10-13.

The dual-luciferase reporter gene results show that: after gene interference of KLF4, the synergistic effect of KLF4 and Stat6 is obviously reduced. The QPCR results show that: after 25(OH) D intervention, expression of anti-inflammatory and autophagy-related genes was suppressed and expression of pro-inflammatory related genes was significantly increased after gene interference with KLF4 compared to Ctrl siRNA group. Apoptosis flow data indicate: compared with the Ctrl siRNA group, the gene interference KLF4 group has higher apoptosis level in the particle treatment group, and the apoptosis level is not obviously changed after 25(OH) D intervention.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, it should be noted that, for those skilled in the art, many modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.

Claims (10)

1. Application of vitamin D in preparing medicine for regulating and controlling macrophage is provided.

2. The use according to claim 1, wherein the medicament is for modulating a functional phenotypic switch of macrophages.

3. The use of claim 2, wherein the medicament is for inhibiting polarization of macrophages to M1 type and/or promoting polarization of macrophages to M2 type.

4. The use according to claim 2, wherein the medicament is for activating autophagy of macrophages type M2.

5. The use of claim 3, wherein the medicament promotes macrophage polarization to M2 through Stat6-KLF4 pathway.

6. The use of claim 1, wherein the medicament is an immunomodulator.

7. Use according to claim 1 or 6, wherein the medicament is for the prevention and/or treatment of a respiratory disease caused by particulate matter.

8. The use of claim 7, wherein the respiratory disease comprises acute lung injury, asthma, or acute lung inflammation.

9. The use of claim 1 or 6, wherein said vitamin D comprises 25(OH) D, VD2 or VD 3.

10. The use according to claim 1 or 6, wherein the injectable dose of the drug is 1000IU/20 g.

Images