CN112725538B - Primer probe composition and kit for high-sensitivity HBV RNA quantitative detection based on HBV S region and application of primer probe composition and kit - Google Patents
Primer probe composition and kit for high-sensitivity HBV RNA quantitative detection based on HBV S region and application of primer probe composition and kit Download PDFInfo
- Publication number
- CN112725538B CN112725538B CN202110198820.6A CN202110198820A CN112725538B CN 112725538 B CN112725538 B CN 112725538B CN 202110198820 A CN202110198820 A CN 202110198820A CN 112725538 B CN112725538 B CN 112725538B
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- rna
- virus
- primer probe
- hbv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention provides a primer probe composition for high-sensitivity HBV RNA quantitative detection based on an HBV S region, a kit and application thereof, wherein a target gene of the primer probe composition is positioned in the S region of a hepatitis B virus genome. The invention takes the gene of the S region of the hepatitis B virus genome as a target spot, designs a specific primer probe, and the fluorescence quantitative PCR HBV RNA detection method constructed based on the primer probe has sensitive and accurate effects on detecting serum HBV RNA of patients with low viral load, realizes accurate prediction of drug withdrawal relapse, liver cancer occurrence and HBsAg negative conversion effects of patients with chronic hepatitis B based on the methodology, can evaluate and predict the drug treatment effect, and has wide clinical application prospect.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and relates to a primer probe composition for high-sensitivity HBV RNA quantitative detection based on an HBV S region, a kit and application thereof.
Background
Hepatitis B Virus (HBV) DNA levels are an independent risk factor for the development of hepatocellular carcinoma (HCC), and the higher the HBV DNA levels, the higher the patient's risk of developing HCC. Therefore, for Chronic Hepatitis B (CHB) patients with liver injury caused by high HBV DNA level, the chronic hepatitis B prevention and treatment guidelines at home and abroad recommend that the patients receive nucleotide (acid) drugs (NAs) or polyethylene glycol interferon (Peg-IFN) for treatment so as to control virus replication, delay disease progression and reduce the risk of HCC. Since it is currently difficult to achieve cure of chronic HBV infection (HBsAg turning negative, clearance of cccDNA in liver), scientists have turned HBV DNA negative (virological response), and HBeAg serological conversion (HBeAg serological response) as response indicators of antiviral therapy to evaluate the efficacy of antiviral therapeutic drugs. Research has shown that in the course of antiviral treatment, patients who realize virology response and HBeAg serology response have significantly reduced risk of HCC occurrence compared with non-responsive patients/patients who have poor response, suggesting that HBV DNA and HBeAg are important clinical indicators for monitoring the curative effect of antiviral treatment and the progression of chronic liver disease in patients with chronic hepatitis B.
In recent years, with the common application of nucleoside antiviral drugs in patients with chronic hepatitis B, many patients obtain good virus inhibition effect, most patients achieve the treatment effects of undetectable serum HBV DNA and serological conversion of HBeAg, and the HBsAg level does not change greatly. In this case, a new index capable of reflecting the change of the disease state is required. Wherein HBV RNA as the direct downstream product of cccDNA is more representative of the state of cccDNA in liver than HBV DNA. Research has shown that serum HBV RNA is related to the transcription activity of cccDNA in liver, is an early prediction index of the antiviral treatment response of patients with chronic hepatitis B, and can predict the disease relapse after NAs withdrawal.
In fact, the forms of serum HBV RNA present are more complex than HBV DNA. Scientists found that serum HBV RNA is mainly HBV pregenomic RNA (pgRNA) (Wang J, Shen T, Huang X, et al. serum Hepatitis B Virus RNA is encapsidated pregenome RNA that is associated with viral infection and rebounded. J Hepatol. 2016; 65(4): 700. quadrature. 710. pgg.), RNA that is not identical in length, both intact full-length and 3' -end truncated RNAs and differently spliced forms of RNA (Liu S, Zhou B, values JD, Sun J, Gupg H. serum Hepatitis B Virus RNAs: A New genomic DNA vaccine for (Biomark) 18269; 2016. 1827). In the previous clinical research on HBV RNA, different research teams have different HBV RNA detection methods, so that the detected HBV RNA species may be different, which may lead to different research results, for example, the HBV RNA level determined by a certain detection method can predict the HBV RNA responding to the antiviral treatment of patients with chronic hepatitis B, but can not necessarily predict the disease recurrence after drug withdrawal. HBV RNA positive, indicating that cccDNA is still actively transcribed in the liver of the patient, the patient is at a very high risk of relapse after drug withdrawal and may increase the risk of disease progression. Therefore, the development of serum HBV RNA detection methods is particularly concerned with the detection sensitivity and the positive rate for low viral load samples to avoid false negatives and increase the risk of chronic liver disease progression in patients.
Disclosure of Invention
Aiming at the defects and actual requirements of the prior art, the invention provides a primer probe composition for high-sensitivity HBV RNA quantitative detection based on an HBV S region, a kit and application thereof, wherein a target gene of the primer probe composition is positioned in the S region of an HBV genome, so that sensitive and specific HBV RNA quantitative detection is realized, the detection positive rate of a low-viral load sample is improved, and the primer probe composition has important application prospects in the aspects of predicting drug withdrawal relapse, liver cancer occurrence, HBsAg negative conversion and the like.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer probe composition for detecting hepatitis B virus RNA, wherein a target gene of the primer probe composition is located in an S region of a hepatitis B virus genome, and preferably in an interval of 160-780 nt of the S region of the hepatitis B virus genome.
In the invention, the S region of the hepatitis B virus genome is positioned in the middle region of the genome, the stability is good, the degradation or deletion is not easy, the HBV RNA detection is carried out by adopting the primer probe designed based on the S region, the S region gene can be detected, and genes which are easy to degrade and delete in the liver cells of chronic hepatitis patients with low viral load, such as 5 'tail end (PreC/Core region), 3' tail end (X region) and the like, can be detected, therefore, the primer probe composition specifically targeting the S region realizes the high-sensitivity detection of the HBV RNA in the liver cells of the chronic hepatitis patients with low viral load.
Preferably, the target gene comprises a common HBV subtype genomic S region, which may be, for example, any of HBV subtype A, B, C, D, E, F, G or the genomic S region of the H genotype.
Preferably, the target gene comprises a nucleic acid sequence shown as SEQ ID NO. 1 or a nucleic acid sequence having more than 92% identity with SEQ ID NO. 1;
SEQ ID NO:1：
gavcacaaccatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatctt。
preferably, the primer comprises a nucleic acid sequence shown as SEQ ID NO 2-9, wherein SEQ ID NO 2-5 is an upstream primer, and SEQ ID NO 6-9 is a downstream primer;
SEQ ID NO:2：CATCAGGAYTCCTAGGACC；
SEQ ID NO:3：CCTGCTCGTGTTACAGGC；
SEQ ID NO:4：GGTTTTTCTTGTTGACAA；
SEQ ID NO:5：TGTCCTCCAATTTGTCCT；
SEQ ID NO:6：ATGATAAAACGCCGCAGAC；
SEQ ID NO:7：TGAGGCATAGCAGCAGGATG；
SEQ ID NO:8：GTACAGCAACAWGAGGGAA；
SEQ ID NO:9：CCCAAGATGATGGGATGGGAATA。
preferably, the probe comprises a nucleic acid sequence shown in SEQ ID NO 10-13, and is used for capturing HBV genome S regions of different genotypes in a targeted mode;
SEQ ID NO:10：CCACAGAGTCTAGACTCGTGGTGGACT；
SEQ ID NO:11：CCACGTGTCCTGGCCAAAAT；
SEQ ID NO:12：AAGGTATGTTGCCCGTTTGTCCTCTA；
SEQ ID NO:13：TCAACTACCAGCACvGGACCATGCA。
preferably, the probe comprises a TaqMan probe and/or a hybridization probe.
Preferably, the probe is labeled with a fluorescent group and/or a quenching group, and preferably, the 5 'end of the probe is labeled with a fluorescent group and the 3' end of the probe is labeled with a quenching group.
Preferably, the fluorophore comprises any one of FAM, CYS, CY5, VIC, TET, JOE, HEX, or ROX.
Preferably, the quencher group comprises any one of TAMRA, BHQ1, BHQ2, BHQ3, NFQ, DABCYL or Eclipse.
In a second aspect, the present invention provides a kit for detecting hepatitis B virus RNA, comprising the primer probe composition of the first aspect.
In the invention, the qPCR system for detecting the hepatitis B virus RNA is constructed by adopting the primer probe composition of the first aspect, so that the effect of sensitively and accurately detecting the hepatitis B virus RNA is realized, the detection positive rate of the low-copy-number hepatitis B virus RNA is obviously improved compared with the existing hepatitis B virus RNA detection method, the system can accurately monitor the antiviral treatment effect of patients with chronic hepatitis B, predict the treatment response effect, predict the drug withdrawal relapse, the liver cancer generation and the HBsAg negative conversion, and has important application value.
Preferably, the kit further comprises any one of an enzyme mixture, a dNTP mixture, or a PCR buffer, or a combination of at least two of them.
Preferably, the enzyme mixture comprises a DNA polymerase and/or a reverse transcriptase.
Preferably, the dNTP mixture comprises dATP, dCTP, dGTP and dUTP.
Preferably, the PCR buffer contains Mg2+。
Preferably, the kit also comprises a negative quality control product and a positive quality control product.
Preferably, the positive quality control material comprises a plasmid containing the S region of the hepatitis B virus genome.
In a third aspect, the present invention provides a system for detecting hepatitis B virus RNA, wherein the system comprises the primer probe composition of the first aspect.
Preferably, the final concentration of the primer in the primer probe composition in the system is 0.1-1 pmol/. mu.L, such as 0.1 pmol/. mu.L, 0.2 pmol/. mu.L, 0.3 pmol/. mu.L, 0.4 pmol/. mu.L, 0.5 pmol/. mu.L, 0.6 pmol/. mu.L, 0.7 pmol/. mu.L, 0.8 pmol/. mu.L, 0.9 pmol/. mu.L or 1 pmol/. mu.L, preferably 0.5 pmol/. mu.L.
Preferably, the final concentration of the probe in the primer probe composition in the system is 0.1-1 pmol/. mu.L, such as 0.1 pmol/. mu.L, 0.2 pmol/. mu.L, 0.3 pmol/. mu.L, 0.4 pmol/. mu.L, 0.5 pmol/. mu.L, 0.6 pmol/. mu.L, 0.7 pmol/. mu.L, 0.8 pmol/. mu.L, 0.9 pmol/. mu.L or 1 pmol/. mu.L, preferably 0.5 pmol/. mu.L.
Preferably, the system further comprises an RNA sample, reverse transcriptase, DNA polymerase, dNTPs and Mg2+。
Preferably, the final concentration of the RNA template in the system is 10 ng/. mu.L to 100. mu.g/. mu.L, and may be, for example, 10 ng/. mu.L, 100 ng/. mu.L, 1. mu.g/. mu.L, 10. mu.g/. mu.L, or 100. mu.g/. mu.L.
Preferably, the final concentration of the reverse transcriptase in the system is 0.5-10U/. mu.L, for example, 0.5U/. mu.L, 1U/. mu.L, 5U/. mu.L or 10U/. mu.L.
Preferably, the final concentration of the DNA polymerase in the system is 0.005-0.05U/. mu.L, for example, 0.005U/. mu.L, 0.01U/. mu.L or 0.05U/. mu.L.
Preferably, the final concentration of the dNTPs in the system is 20-200 mu mol/L, for example, 20 mu mol/L, 50 mu mol/L, 100 mu mol/L or 200 mu mol/L.
Preferably, said Mg2+The final concentration in the system is 0.5 to 3.0mmol/L, and may be, for example, 0.5mmol/L, 1mmol/L, 2mmol/L or 3 mmol/L.
In a fourth aspect, the present invention provides a method for detecting hepatitis B virus RNA for the purpose of non-disease diagnosis and/or treatment, the method comprising:
and (2) carrying out fluorescence quantitative PCR on the RNA sample by adopting the primer probe composition of the first aspect, the kit of the second aspect or the system of the third aspect, and detecting the level of hepatitis B virus RNA.
Preferably, the conditions of the fluorescent quantitative PCR are as follows:
pre-denaturation at 92-98 ℃ for 10-30 s;
denaturation at 92-98 ℃ for 10-20 s, annealing at 55-65 ℃ for 40-60 s, and extension at 70-75 ℃ for 10-30 s, wherein 35-45 cycles are performed.
Preferably, before the pre-denaturation, the method further comprises a step of reverse transcription at 45-55 ℃ for 5-8 min.
In a fifth aspect, the present invention provides an apparatus for detecting hepatitis b virus RNA, the apparatus comprising:
a reverse transcription unit: used for reverse transcription of hepatitis B virus RNA sample into DNA sample;
fluorescent quantitative PCR unit: the method is used for carrying out fluorescence quantitative PCR on an RNA sample by adopting the primer probe composition of the first aspect, the kit of the second aspect or the system of the third aspect to detect the level of hepatitis B virus RNA.
In a sixth aspect, the invention provides the primer probe composition of the first aspect, the kit of the second aspect, the system of the third aspect or the device of the fifth aspect, for use in preparing a liver disease diagnostic reagent, a HBV diagnostic reagent for evaluating the efficacy of antiviral therapy for chronic hepatitis b and/or stopping drug safety and monitoring the endpoint of therapy.
Preferably, the liver disease comprises any one of acute and chronic hepatitis B, hepatitis B-related liver failure, liver cirrhosis or liver cancer or a combination of at least two of the two.
Compared with the prior art, the invention has the following beneficial effects:
(1) the invention takes the S region gene of the hepatitis B virus genome as a target spot and designs a specific primer probe, thereby realizing the effect of sensitively and accurately detecting the low-copy hepatitis B virus;
(2) compared with the prior art, the HBV RNA positive rate of the HBV RNA detection method based on the HBV S region is obviously improved for detecting serum HBV RNA of a patient with low viral load;
(3) the HBV RNA detection system and the detection method based on the HBV S region can detect the virus nucleic acid with low copy number, provide a reliable method for predicting medium-term curative effect judgment and disease development endpoint events such as hepatitis B drug withdrawal relapse, liver cancer occurrence, surface antigen disappearance and the like, and have potential application value in aspects of predicting drug withdrawal relapse, liver cancer occurrence, HBsAg negative conversion and the like of patients with chronic hepatitis B.
Drawings
FIG. 1 is a schematic diagram of the location of a primer probe targeting the S region of the hepatitis B virus genome;
FIG. 2 is a RT-qPCR amplification curve of positive quality control substances with different concentrations, wherein the concentration of the positive quality control substances represented by the amplification curve from left to right is 5.0 × 107Copy/. mu.L, 5.0X 106Copy/. mu.L, 5.0X 105Copy/. mu.L, 5.0X 104Copy/. mu.L, 5.0X 103Copy/. mu.L, 5.0X 102Copy/. mu.L, 5.0X 101Copy/. mu.L;
FIG. 3 is a standard curve for RT-qPCR;
FIG. 4A is a result of comparing positive rates of highly sensitive HBV RNA (S-RNA), PreC-RNA, X-RNA and RACE based on HBV S region, and FIG. 4B is a result of comparing positive rates of RACE method and commercial kit Sansure;
FIG. 5 is a graph showing the results of predicting withdrawal relapse in patients with chronic hepatitis B based on hypersensitive HBV RNA (S-RNA) of HBV S region and RACE;
FIG. 6A is a graph showing the relationship between the level of HBV RNA in serum and the occurrence of liver cancer in patients with chronic hepatitis B based on the result of quantitative determination of HBV RNA in HBV S region, and FIG. 6B is a graph showing the relationship between the level of HBV RNA in serum and the occurrence of liver cancer in patients with chronic hepatitis B based on the result of quantitative determination of HBV RNA in HBV PreC region;
FIG. 7 is a graph showing the result of HBsAg turning negative after the patient is discontinued based on the result of quantitative detection of highly sensitive HBV RNA in HBV S region;
FIG. 8 is a graph showing the results of predicting HBeAg serological response in patients with chronic hepatitis B based on the highly sensitive HBV RNA (S-RNA) of HBV S region and the HBV DNA level for 24 weeks;
FIG. 9A is the dynamic change of HBV DNA and HBV RNA during the treatment with nucleotide analogs in patients with RNA response, and FIG. 9B is the dynamic change of HBV DNA and HBV RNA during the treatment with nucleotide analogs in patients with poor RNA response.
Detailed Description
To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.
The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.
Example 1 design of primer Probe compositions
In the embodiment, different subtype HBV genome S regions SEQ ID NO 1 are taken as target genes, specific primer probes SEQ ID NO 2-13 are designed, wherein SEQ ID NO 2-5 is an upstream primer, SEQ ID NO 6-9 is a downstream primer, SEQ ID NO 10-13 is a probe, and a schematic diagram is shown in figure 1.
Example 2 extraction of HBV RNA
The embodiment first utilizes
Virus Spin kit (QIAGEN, Germany) extracts nucleic acids from serum samples of hepatitis B patients and then digests the DNA with DNase I (Thermo Fisher Scientific) to obtain HBV RNA, as follows:
(1) sucking 888 μ L AL buffer solution into 24.6 μ L carrier RNA, and blowing and beating uniformly;
(2) adding 25 μ L protease into 1.5mL EP tube, adding 200 μ L normal temperature serum to be extracted (blowing and mixing the serum before subpackaging), adding 200 μ L AL (carrier RNA concentration is 28 μ g/mL), vortex shaking for 15s, and heating at 56 deg.C for 15 min;
(3) instantly centrifuging the sample, adding 250 μ L of anhydrous ethanol, vortex and shaking for 15s, and standing at room temperature for 5 min;
(4) placing the filter column containing the sample in a new collection tube, adding 500 μ L Buffer AW1, and centrifuging at 8000rpm for 1 min;
(5) placing the filter column in a new collection tube, adding 500 μ L Buffer AW2, and centrifuging at 8000rpm for 1 min;
(6) placing the filter column in a new collecting tube, adding 500 μ L anhydrous ethanol, and centrifuging at 8000rpm for 1 min;
(7) placing the filter column in a new collecting tube, and centrifuging at 14000rpm for 3 min;
(8) placing the filter column in a new collection tube, opening the cover, heating at 56 deg.C for 3min, and preheating AVE buffer solution;
(9) placing the filter column in a new 1.5mL EP tube, adding 50 μ L AVE buffer solution, and standing at room temperature for 5 min;
(10) centrifuging at 14000rpm for 1min, and subjecting 30 μ L of the extracted nucleic acid to DNase I digestion, wherein 40 μ L of DNase I digestion system is shown in Table 1;
(11) HBV RNA was obtained by heating at 37 ℃ for 40min, then adding 2. mu.L EDTA (50mM), and heating at 65 ℃ for 10 min.
TABLE 1
| Reagent | Volume (μ L) |
| 10 Xdigestion buffer (10 Xdigestion buffer) | 4 |
| Non-enzyme water (clean-free water) | 4 |
| DNase I(2U/μL) | 2 |
| Sample(s) | 30 |
Example 3 quantitative detection of HBV RNA targeting the S region of the HBV genome
In the embodiment, the primer pairs shown in SEQ ID NO 2-9 and the probes shown in SEQ ID NO 10-13 are adopted to carry out HBV RNA quantitative detection on the HBV RNA positive quality control product, and the RT-qPCR reagent is
Fast Virus1-Step Master Mix (Applied Biosystems) (major components include reverse transcriptase, DNA polymerase, dNTPs, Mg2+) The system is shown in Table 2, and the fluorescent quantitative PCR conditions are shown in Table 3.
TABLE 2
TABLE 3
The preparation method of the positive quality control product comprises the following steps:
the target gene (SEQ ID NO:1) of the primer probe composition was artificially synthesized, cloned into pGEM Easy plasmid (Promega), and transfected into Escherichia coli JM109(TAKARA) for mass amplification; high quality DNA plasmids containing the target gene were purified using Qiagen plasmid Midi kit (Qiagen), linearized with Nde I (TAKARA), and further linearized with T7 RiboMAXTMExpress RNA kit (Promega) for RNA transcription; residual DNA template in the transcribed RNA was digested with DNase I, and the transcribed RNA standard was purified by QIAmp MinElute Virus purification kit (Qiagen), and finally quantified (Thermo scientific) using NanoDrop ND-2000 as HBV RNA positive quality control.
Positive quality control substances at different concentrations (5.0 × 10)1～5.0×107Copy/. mu.L) is shown in figure 2, the log value of the concentration of the positive quality control product is taken as the abscissa, the Ct value is taken as the ordinate, and a standard curve is established as shown in figure 3, which indicates that the primer probe composition shown in SEQ ID NO: 2-13 is adopted to successfully construct the HBV RNA detection system of the targeted HBV genome S region.
Example 4 Positive Rate detection
In this example, 188 cases of chronic hepatitis B patients with low viral load serum HBV RNA levels were detected by RNA detection based on the PreC/Core region, the S region (primers SEQ ID NO:2 and SEQ ID NO:6, and probe SEQ ID NO:10), the X region and the 3' poly A tail (RACE method) of the hepatitis B virus genome, as shown in FIG. 4A, it was found that the RNA positive rate obtained by the detection based on the S region was the highest, and the positive rate obtained by the RACE method was the lowest (66% vs 10%, p < 0.05).
This example further compares the quantitative results of the RACE method and the commercial kit (Sansure) for the serum HBV RNA of another 100 patients with chronic hepatitis B, as shown in FIG. 4B, the positive rate of HBV RNA detected by the RACE method is higher than that detected by the commercial kit, and further highlights the detection advantages of the method of the present invention for low viral load samples (positive rate: S region method > RACE method > commercial kit).
Example 5 implementation procedure for predicting drug withdrawal relapse in patients with chronic hepatitis B
In a real world drug withdrawal queue (n is 50) of patients with chronic hepatitis B, serum HBV RNA level of the patients is detected in parallel by adopting the primers of SEQ ID NO:3 and SEQ ID NO:7 and the probe of SEQ ID NO:11 in example 3 and an HBV RNA detection method based on RACE, and the HBV RNA level obtained by the ROC curve test method is used for predicting the hepatitis relapse efficacy after drug withdrawal.
As shown in FIG. 5, the HBV RNA level measured by the highly sensitive HBV RNA quantitative determination method based on HBV S region of example 3 could well predict the recurrence of hepatitis 4 years after drug withdrawal, while the RACE method could not predict the recurrence of hepatitis well after drug withdrawal.
Example 6 implementation procedure for predicting liver cancer
Among patients with chronic hepatitis B who receive antiviral therapy, a part of patients still develop liver cancer. In this example, the method for quantitatively detecting highly sensitive HBV RNA based on HBV S region (primers SEQ ID NO:4 and SEQ ID NO:8, and probe SEQ ID NO:12) of example 3 was used to detect the serum HBV RNA level of 345 patients with chronic hepatitis B who received antiviral therapy, and the relationship between the serum HBV RNA level and the occurrence of liver cancer in patients with chronic hepatitis B was analyzed by Kaplan-Meier curve. The results are shown in fig. 6A, and the risk of developing liver cancer in patients with negative HBV RNA is significantly lower than that in patients with positive HBV RNA.
In this example, the HBV RNA level of these patients is detected by the HBV PreC region-based HBV RNA detection method, and the result is shown in fig. 6B, and most patients do not detect HBV RNA, and the correlation between the HBV RNA level and the occurrence of liver cancer is not statistically different.
Example 7 implementation procedure for predicting HBsAg clearance
At present, no medicine can cure chronic HBV infection or eliminate HBsAg, and only a small number of patients can realize HBsAg negative conversion (functional cure) after long-time antiviral treatment, so that chronic hepatitis B patients who can realize functional cure at a high probability can be identified, antiviral treatment strategies can be optimized, and clinical resource allocation efficiency is improved.
In this example, the highly sensitive HBV RNA quantitative detection method based on HBV S region (primers SEQ ID NO:5, SEQ ID NO:9, and probe SEQ ID NO:13) in example 3 was used to detect HBV RNA levels when 170 patients with chronic hepatitis b were taken off, and the results are shown in fig. 7, which shows that patients with HBV RNA negative were found, and the chance of achieving HBsAg negative conversion after drug withdrawal was significantly increased compared with patients with HBV RNA positive, and thus HBV RNA is an early prediction index of HBsAg negative conversion in patients with chronic hepatitis b.
Example 8 implementation of a procedure for predicting the response of patients with chronic hepatitis B to antiviral therapy
During the antiviral treatment process, the serological conversion of HBeAg of patients with chronic hepatitis B means that the patients have better anti-hepatitis B immune response capability, and the transcription activity of the intrahepatic cccDNA is lower. Serum HBV RNA is a noninvasive substitute index of cccDNA in livers, and can effectively predict serological conversion of HBeAg of patients with chronic hepatitis B after receiving antiviral treatment for patients with HBeAg positivity. Taking nucleotide analogs as an example, in a treatment cohort of patients with chronic hepatitis B (n ═ 69), the HBV RNA level in serum was measured at baseline and 24 weeks using the HBV S region-based high-sensitivity quantitative HBV RNA detection method of example 3, and the ROC curve was used to test the HBV RNA level to predict the seroconversion efficacy of HBeAg 2 years after NAs treatment.
The results are shown in fig. 8, the HBV RNA level detected by the highly sensitive HBV RNA quantitative detection method based on HBV S region for 24 weeks can better predict that HBeAg turns negative for NAs antiviral therapy, and the prediction efficacy is better than HBV DNA.
Example 9 serum HBV RNA as a novel index for monitoring the efficacy of antiviral therapy in patients with chronic hepatitis B
Based on the results of example 6, it can be seen that high levels of serum HBV RNA increase the risk of developing liver cancer in patients with chronic hepatitis B. Therefore, effective reduction of serum HBV RNA levels can be used as one of the efficacy monitoring indicators for classical antiviral therapies (including IFN and NAs) and novel antiviral therapies (e.g., nucleocapsid inhibitors, siRNA, hepatitis b virus entry inhibitors, immunomodulatory drugs, etc.). Meanwhile, as the nucleic acid substance of hepatitis B virus, HBV RNA is the direct downstream product of cccDNA in liver, and represents the transcription state of cccDNA better than HBV DNA. When evaluating the antiviral effect of a new hepatitis B drug, except for taking the traditional HBV DNA negative conversion and HBeAg serological conversion as measurement indexes, the serum HBV RNA negative conversion reflects the low activity state of cccDNA in the liver and directly reflects the degree of hepatitis B virus inhibition. Taking classical NAs antiviral therapy as an example, in the course of NAs therapy, when serum HBV DNA is rapidly inhibited, serum HBV RNA can still be continuously at a higher level (based on the detection result of the high-sensitivity HBV RNA quantitative detection method in example 3), as the duration of antiviral therapy increases, as shown in fig. 9A and 9B, the HBV RNA level of some patients can gradually decrease (fig. 9A), while the HBV RNA level of some patients can be maintained at a higher level (fig. 9B), which indicates that the responses of the two patients to the NAs antiviral therapy are different, and also indicates that patients whose HBV RNA does not turn negative continuously may need to improve the antiviral therapy strategy to obtain better therapeutic effect. Similarly, HBV RNA in serum can also be used as one of the therapeutic effect monitoring indexes in the research and development of new drugs for hepatitis B.
In conclusion, the invention designs the specific primer probe by taking the common HBV subtype genome S region as the target gene, and the fluorescence quantitative PCR HBV RNA detection method constructed based on the primer probe realizes the sensitive and specific detection of serum HBV RNA of patients with low viral load, and shows clinical application potential in the aspects of predicting the drug withdrawal relapse, liver cancer occurrence, HBsAg negative conversion effect and the like of patients with chronic hepatitis B.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
Claims (28)
1. A primer probe composition for detecting hepatitis B virus RNA in serum is characterized in that a target gene of the primer probe composition is positioned in an S region of a hepatitis B virus genome;
the primer comprises a nucleic acid sequence shown as SEQ ID NO. 2-9;
the probe comprises a nucleic acid sequence shown in SEQ ID NO 10-13.
2. The primer probe composition of claim 1, wherein the target gene comprises the genomic S region of hepatitis B virus subtype A, B, C, D, E, F, G or H genotype.
3. The primer probe composition of claim 2, wherein the target gene comprises the nucleic acid sequence set forth in SEQ ID NO. 1.
4. The primer probe composition of claim 1, wherein the probe comprises a TaqMan probe and/or a hybridization probe.
5. The primer probe composition of claim 1, wherein the probe is labeled with a fluorophore and/or a quencher.
6. The primer probe composition of claim 5, wherein the fluorescent group comprises any one of FAM, CYS, CY5, VIC, TET, JOE, HEX, or ROX.
7. The primer probe composition of claim 5, wherein the quencher group comprises any one of TAMRA, BHQ1, BHQ2, BHQ3, NFQ, DABCYL, or Eclipse.
8. A kit for detecting RNA from hepatitis b virus, comprising the primer probe composition according to any one of claims 1 to 7.
9. The kit according to claim 8, further comprising any one of an enzyme mixture, a dNTP mixture, and a PCR buffer, or a combination of at least two thereof.
10. The kit of claim 9, wherein the enzyme cocktail comprises a DNA polymerase and/or a reverse transcriptase.
11. The kit of claim 9, wherein the dNTP mixture comprises dATP, dCTP, dGTP, and dUTP.
12. The kit of claim 9, wherein the PCR buffer comprises Mg2+。
13. The kit of claim 8, further comprising a negative quality control and a positive quality control.
14. The kit of claim 13, wherein the positive quality control comprises a plasmid comprising the S region of the hepatitis b virus genome.
15. A system for detecting RNA from hepatitis b virus, comprising the primer probe composition of any one of claims 1 to 7.
16. The system for detecting RNA of hepatitis B virus according to claim 15, wherein the final concentration of the primer in the primer probe composition in the system is 0.1 to 1pmol/μ L.
17. The system for detecting RNA of hepatitis B virus according to claim 15, wherein the final concentration of the probe in the primer probe composition in the system is 0.1 to 1pmol/μ L.
18. The system for detecting hepatitis B virus RNA of claim 15, further comprising an RNA template, reverse transcriptase, DNA polymerase, dNTPs, and Mg2+。
19. The system for detecting hepatitis B virus RNA of claim 18, wherein the final concentration of the RNA template in the system is 10ng/μ L to 100 μ g/μ L.
20. The system for detecting hepatitis B virus RNA of claim 18, wherein the final concentration of the reverse transcriptase in the system is 0.5-10U/μ L.
21. The system for detecting RNA of hepatitis B virus according to claim 18, wherein the final concentration of the DNA polymerase in the system is 0.005-0.05U/μ L.
22. The system for detecting RNA of hepatitis B virus according to claim 18, wherein the final concentration of dNTPs in the system is 20-200 μmol/L.
23. The system for detecting hepatitis B virus RNA of claim 18, wherein the Mg is present in the sample2+The final concentration in the system is 0.5-3.0 mmol/L.
24. A method for detecting hepatitis b virus RNA for non-disease diagnosis and/or treatment purposes, comprising:
performing fluorescent quantitative PCR on an RNA sample by using the primer probe composition of any one of claims 1 to 7, the kit of any one of claims 8 to 14 or the system of any one of claims 15 to 23 to detect the level of hepatitis B virus RNA.
25. The method of claim 24, wherein the conditions of the fluorescent quantitative PCR are:
pre-denaturation at 92-98 ℃ for 10-30 s;
denaturation at 92-98 ℃ for 10-20 s, annealing at 55-65 ℃ for 40-60 s, and extension at 70-75 ℃ for 10-30 s, wherein 35-45 cycles are performed.
26. The method of claim 25, further comprising a step of reverse transcription at 45-55 ℃ for 5-8 min before the pre-denaturation step.
27. Use of the primer probe composition of any one of claims 1 to 7, the kit of any one of claims 8 to 14 or the system of any one of claims 15 to 23 for the preparation of a diagnostic reagent for hepatitis b virus, a diagnostic reagent for evaluating the efficacy of chronic hepatitis b antiviral therapy and/or for stopping the safety of drug delivery, and monitoring the therapeutic endpoint of hepatitis b virus.
28. The use of claim 27, wherein the liver disease comprises any one or a combination of at least two of acute and chronic hepatitis b, hepatitis b-related liver failure, liver cirrhosis or liver cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110198820.6A CN112725538B (en) | 2021-02-22 | 2021-02-22 | Primer probe composition and kit for high-sensitivity HBV RNA quantitative detection based on HBV S region and application of primer probe composition and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110198820.6A CN112725538B (en) | 2021-02-22 | 2021-02-22 | Primer probe composition and kit for high-sensitivity HBV RNA quantitative detection based on HBV S region and application of primer probe composition and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112725538A CN112725538A (en) | 2021-04-30 |
| CN112725538B true CN112725538B (en) | 2021-12-14 |
Family
ID=75596911
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110198820.6A Active CN112725538B (en) | 2021-02-22 | 2021-02-22 | Primer probe composition and kit for high-sensitivity HBV RNA quantitative detection based on HBV S region and application of primer probe composition and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112725538B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113249526A (en) * | 2021-06-30 | 2021-08-13 | 瑞博奥(广州)生物科技股份有限公司 | PCR reaction sequence combination for detecting hepatitis B virus and kit thereof |
| CN116732243A (en) * | 2023-04-04 | 2023-09-12 | 赛立安生物技术(广州)有限公司 | Primer group, detection method and kit for detecting HBV pre-S/S region gene mutation |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997003211A1 (en) * | 1995-07-13 | 1997-01-30 | Isis Pharmaceuticals, Inc. | Antisense inhibition of hepatitis b virus replication |
| CN105420410A (en) * | 2015-12-08 | 2016-03-23 | 珠海丽珠试剂股份有限公司 | Primer set, probe, reagent kit and detection method for detecting hepatitis B virus nucleic acid |
| CN106435018A (en) * | 2016-09-05 | 2017-02-22 | 北京大学 | Double channel real time fluorescence quantitative PCR measuring method for quantitatively measuring HBV DNA and RNA in blood |
| CN107058623A (en) * | 2016-04-01 | 2017-08-18 | 北京大学 | A kind of High sensitivity and special blood HBV pgRNA fluorescence quantitative PCR detections systems and detection method |
| CN108950082A (en) * | 2018-08-13 | 2018-12-07 | 郑州安图生物工程股份有限公司 | A kind of hbv nucleic acid immue quantitative detection reagent box |
| CN109321679A (en) * | 2018-10-24 | 2019-02-12 | 北京大学 | Detect oligonucleotide composition, kit and the method and purposes of hepatitis B rcDNA and/or cccDNA |
-
2021
- 2021-02-22 CN CN202110198820.6A patent/CN112725538B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997003211A1 (en) * | 1995-07-13 | 1997-01-30 | Isis Pharmaceuticals, Inc. | Antisense inhibition of hepatitis b virus replication |
| CN105420410A (en) * | 2015-12-08 | 2016-03-23 | 珠海丽珠试剂股份有限公司 | Primer set, probe, reagent kit and detection method for detecting hepatitis B virus nucleic acid |
| CN107058623A (en) * | 2016-04-01 | 2017-08-18 | 北京大学 | A kind of High sensitivity and special blood HBV pgRNA fluorescence quantitative PCR detections systems and detection method |
| CN106435018A (en) * | 2016-09-05 | 2017-02-22 | 北京大学 | Double channel real time fluorescence quantitative PCR measuring method for quantitatively measuring HBV DNA and RNA in blood |
| CN108950082A (en) * | 2018-08-13 | 2018-12-07 | 郑州安图生物工程股份有限公司 | A kind of hbv nucleic acid immue quantitative detection reagent box |
| CN109321679A (en) * | 2018-10-24 | 2019-02-12 | 北京大学 | Detect oligonucleotide composition, kit and the method and purposes of hepatitis B rcDNA and/or cccDNA |
Non-Patent Citations (8)
| Title |
|---|
| Hepatitis B Viral DNA Decline at Loss of HBeAg Is Mainly Explained by Reduced cccDNA Load-Down-Regulated Transcription of PgRNA Has Limited Impact;Sebastian Malmstrom等;《Plos one》;20120720;第7卷(第7期);e36349 * |
| Hepatitis B virus isolate CHN-SD-HBV2011030 S protein (S) gene, partial cds;KX067672.1;《Genbank》;20160620;参见序列 * |
| Hepatitis B virus isolate KXF76-b polymerase (P) gene, partial cds;FJ751514.1;《Genbank》;20160724;参见序列 * |
| Hepatitis B Virus RNA Profiles in Liver Biopsies by Digital Polymerase Chain Reaction;Kasthuri Prakash等;《Hepatology Communications》;20200329;第4卷(第7期);973-982页 * |
| Sebastian Malmstrom等.Hepatitis B Viral DNA Decline at Loss of HBeAg Is Mainly Explained by Reduced cccDNA Load-Down-Regulated Transcription of PgRNA Has Limited Impact.《Plos one》.2012,第7卷(第7期), * |
| Serum HBV RNA: a New Potential Biomarker for Chronic Hepatitis B Virus Infection;Shi Liu等;《Hepatology》;20181025;第69卷(第4期);1816-1827页 * |
| 两种检测HBV RNA方法在核苷（酸）类似物经治和初治慢性乙型肝炎患者中的相关性和一致性评价;王雪刚 等;《病毒性肝炎》;20200731;第25卷(第7期);736-742页 * |
| 慢性乙型肝炎患者血清HBV RNA检测的临床意义;鲁凤民 等;《临床肝胆病杂志》;20180531;第34卷(第5期);934-938页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112725538A (en) | 2021-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107058623B (en) | High-sensitivity and specific blood HBV pgRNA fluorescent quantitative PCR detection system and detection method | |
| CN112725538B (en) | Primer probe composition and kit for high-sensitivity HBV RNA quantitative detection based on HBV S region and application of primer probe composition and kit | |
| CN104450963B (en) | A kind of HBV DNA digital pcrs immue quantitative detection reagent box and its application | |
| EP2258878A1 (en) | A method for detecting HBV using real time PCR | |
| CN109321679B (en) | Oligonucleotide composition, kit and method for detecting hepatitis B virus rcDNA and/or cccDNA and application | |
| US20180073087A1 (en) | Qualitative and absolute quantification kit for detecting hepatitis b virus cccdna | |
| Lee et al. | Predominance of hepatitis B virus YMDD mutants is prognostic of viral DNA breakthrough | |
| Clarke et al. | Molecular genotyping of hepatitis B virus | |
| CN103710465A (en) | Hepatitis B virus (HBV) gene typing PCR (polymerase chain reaction) detection kit | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN112725535A (en) | Fluorescent quantitative PCR kit for simultaneously detecting full-length and truncated HBV pgRNA and application thereof | |
| CN105039599A (en) | Primers, probes and kit for typing qualitative detection of hepatitis B virus (HBV) | |
| CN100422344C (en) | Fluorescent PCR detecting method for hepatitis B virus gene parting and reagent kit | |
| CN109457049B (en) | Composition, kit and method for genotyping detection of hepatitis B virus | |
| CN111154920A (en) | Kit for detecting hepatitis B virus and special primer probe set thereof | |
| CN115323075B (en) | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit | |
| CN111057791A (en) | Kit for detecting HBV pgRNA in blood | |
| CN102115796A (en) | HBV (hepatitis B virus) fluorescence quantitative PCR (Polymerase Chain Reaction) detection kit containing internal reference | |
| CN106011308B (en) | Hepatitis C virus genotyping detection kit, oligonucleotide and application thereof | |
| CN116445659A (en) | Kit for detecting novel coronavirus and Omicron variant typing and application | |
| CN114182046B (en) | Pathogen nucleic acid detection primer probe combination of human herpesvirus, kit and application thereof | |
| CN107475444B (en) | PCR primer, kit and method for selectively amplifying RNA from total nucleic acid of hepatitis B virus | |
| CN108676919B (en) | HBV pgRNA fluorescent quantitative PCR detection kit | |
| CN107034312B (en) | Nucleotide composition, kit and application thereof | |
| CN109593887B (en) | Kit for quantitative detection of hepatitis C virus nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |