CN112725483A - Specific primer, kit, application and multiplex PCR detection method for simultaneously detecting three kinds of aeromonas - Google Patents
Specific primer, kit, application and multiplex PCR detection method for simultaneously detecting three kinds of aeromonas Download PDFInfo
- Publication number
- CN112725483A CN112725483A CN202110081175.XA CN202110081175A CN112725483A CN 112725483 A CN112725483 A CN 112725483A CN 202110081175 A CN202110081175 A CN 202110081175A CN 112725483 A CN112725483 A CN 112725483A
- Authority
- CN
- China
- Prior art keywords
- aeromonas
- specific primer
- multiplex pcr
- primer pair
- pcr detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a specific primer, a kit, application and a multiplex PCR detection method for simultaneously detecting three kinds of aeromonas. The specific primers for detecting the aeromonas comprise a first specific primer pair consisting of an upstream primer Aehy _ F and a downstream primer Aehy _ R, a second specific primer pair consisting of an upstream primer Aeca _ F and a downstream primer Aeca _ R, and a third specific primer pair consisting of an upstream primer Aeve _ F and a downstream primer Aeve _ R. The specific primer can be used for multiplex PCR amplification of aeromonas, so that the specific primer can be used for detecting three pathogenic aeromonas in samples such as water, soil and the like, and further ensures the safety and reliability of the environments such as water, soil and the like. Meanwhile, the specific primer can be prepared into a multiple PCR detection kit, and is convenient to use.
Description
Technical Field
The invention relates to the field of bacteria detection, in particular to a specific primer, a kit, an application and a multiple PCR detection method for simultaneously detecting three kinds of aeromonas.
Background
With the improvement of living standard of people, the breeding industry has good development prospect, but in the process of artificial breeding, the disease outbreak caused by aeromonas usually causes farmers to suffer great loss. Research shows that Aeromonas causing diseases mainly comprise Aeromonas hydrophila (Aeromonas hydrophila), Aeromonas caviae (Aeromonas caviae) and Aeromonas veronii (Aeromonas veronii) and other strains. Therefore, the specific recognition of aeromonas species is critical for the treatment of disease in aquaculture. Therefore, research on specific primers of aeromonas species needs to be carried out for detecting the aeromonas infection of water bodies or aquatic animals.
Disclosure of Invention
In view of the above, there is a need to provide a specific primer, a kit, an application, and a multiplex PCR detection method for simultaneously detecting three types of aeromonas; the specific primer can be used for simultaneously detecting or assisting in detecting three kinds of aeromonas, and is strong in specificity and high in sensitivity.
A specific primer for simultaneously detecting three aeromonas species comprises a first specific primer pair consisting of an upstream primer Aehy _ F and a downstream primer Aehy _ R, a second specific primer pair consisting of an upstream primer Aeca _ F and a downstream primer Aeca _ R, and a third specific primer pair consisting of an upstream primer Aeve _ F and a downstream primer Aeve _ R; wherein the content of the first and second substances,
the upstream primer Aehy _ F is 5 'CGAGCAACAGCTCGAAGTGG 3',
the downstream primer Aehy _ R is 5 'GCTGGGATTGAACGAAGCCG 3',
the upstream primer Aeca _ F is 5 'CCGGAACTCGGACTGAGAC 3',
the downstream primer Aeca _ R is 5 'GGAGCCTGCCAAGAACGATA 3',
the upstream primer Aeve _ F is 5 'GGCCCTTCCGACAAAGGATT 3',
the downstream primer Aeve _ R is 5 'CTCCTTCATCACCCCCATCAG 3'.
In one embodiment, the molar ratio of the first specific primer pair, the second specific primer pair, and the third specific primer pair is 3:2: 4.
A multiplex PCR detection kit for simultaneously detecting three aeromonas species comprises a first specific primer pair, a second specific primer pair and a third specific primer pair as described above.
In one embodiment, the molar ratio of the first specific primer pair, the second specific primer pair, and the third specific primer pair is 3:2: 4.
In one embodiment, the multiplex PCR detection kit further comprises a template DNA comprising genomic DNA of at least one Aeromonas hydrophila, Aeromonas caviae, and Aeromonas veronii.
In one embodiment, the multiplex PCR detection kit further comprises 10 × amplification buffer, dNTP, MgCl2Taq polymerase and double distilled water.
Use of a multiplex PCR detection kit for aeromonas as described above for detecting aeromonas.
In one embodiment, the aeromonas comprises at least one of aeromonas hydrophila, aeromonas caviae, aeromonas veronii.
A multiplex PCR detection method for Aeromonas using the specific primers as described above, comprising:
extracting genome DNA of aeromonas of a sample to be detected as template DNA;
mixing the template DNA with specific primer, 10 Xamplification buffer solution, dNTP and MgCl2Preparing a PCR reaction system by using Taq polymerase and double distilled water, wherein the specific primers comprise a first specific primer pair, a second specific primer pair and a third specific primer pair;
the PCR reaction system is reacted to obtain an amplification product;
and carrying out gel electrophoresis on the amplification product according to the band analysis result.
In one embodiment, the aeromonas comprises at least one of aeromonas hydrophila, aeromonas caviae, aeromonas veronii.
In one embodiment, the molar ratio of the first specific primer pair, the second specific primer pair and the third specific primer pair in the PCR reaction system is 3:2: 4.
In one embodiment, the volume of the PCR reaction system is 10 to 50. mu.L, wherein the PCR reaction system comprises 1.5 to 3.0mmol/L MgCl20.10mmol/L-0.40mmol/L dNTP, 0.1 mu mol/L-1.5 mu mol/L specific primer, 0.5U-2.5U Taq polymerase, 0.5 mu L-4 mu L template DNA, 1 mu L-5 mu L10 Xamplification buffer solution, and the balance of double distilled water.
In one embodiment, the procedure for the reaction is: pre-denaturation at 94-98 deg.C for 1-3 min;
denaturation at 94-98 deg.C for 15s-30s, annealing at 59-62 deg.C for 20s-40s, and extension at 70-74 deg.C for 30s-60s for 30-37 cycles;
finally, extension is carried out for 5min-7min at 72 ℃.
The specific primer can be used for multiplex PCR amplification of aeromonas, so that the primer can be used for detecting aeromonas in samples such as water bodies, soil, aquatic products and the like, and particularly, when the samples contain at least one of aeromonas hydrophila, aeromonas caviae and aeromonas veronii, the specific primer can detect which kind or kinds of aeromonas specifically contained in the samples, so that the safety and reliability of the environments such as the water bodies, the soil and the like are ensured, the method is simple, and the guarantee can be provided for the breeding industry and the like. Meanwhile, the specific primer can be prepared into a multiple PCR detection kit, and is convenient to use.
Drawings
FIG. 1 is a diagram showing the results of the specific detection of the multiplex PCR detection method for simultaneously detecting three types of Aeromonas according to the present invention;
FIG. 2 is a diagram of the detection of intestinal bacteria samples of cultured Rana nigromaculata in example 1 of the present invention;
FIG. 3 is a diagram showing the detection of skin bacteria of cultured Rana nigromaculata in example 2 of the present invention.
Detailed Description
The specific primers, the kit, the application and the multiplex PCR detection method for simultaneously detecting three types of aeromonas provided by the invention are further described below.
The invention respectively uses Aeromonas hydrophila genome sequence (accession number CP 016989), Aeromonas caviae genome sequence (accession number CP062787) and Aeromonas veronii genome sequence (accession number CP059396) in GenBank database as reference sequences of various species, after sequence similarity comparison with other similar species in NCBI, specific sequence intervals of 65962 and 66275 of Aeromonas hydrophila, 5034005 and 4050860 of Aeromonas caviae and Aeromonas veronii 48355 and 49014 are respectively designed to be specific primers which can only amplify Aeromonas hydrophila, Aeromonas caviae and Aeromonas veronii by using online primer design software of NCBI.
Therefore, the specific primers for simultaneously detecting three types of aeromonas provided by the invention comprise a first specific primer pair consisting of an upstream primer Aehy _ F and a downstream primer Aehy _ R, a second specific primer pair consisting of an upstream primer Aeca _ F and a downstream primer Aeca _ R, and a third specific primer pair consisting of an upstream primer Aeve _ F and a downstream primer Aeve _ R; wherein the content of the first and second substances,
the upstream primer Aehy _ F is 5 'CGAGCAACAGCTCGAAGTGG 3',
the downstream primer Aehy _ R is 5 'GCTGGGATTGAACGAAGCCG 3',
the upstream primer Aeca _ F is 5 'CCGGAACTCGGACTGAGAC 3',
the downstream primer Aeca _ R is 5 'GGAGCCTGCCAAGAACGATA 3',
the upstream primer Aeve _ F is 5 'GGCCCTTCCGACAAAGGATT 3',
the downstream primer Aeve _ R is 5 'CTCCTTCATCACCCCCATCAG 3'.
The first specific primer pair is an aeromonas hydrophila specific primer, and the length of an amplification product is 314 bp; the second specific primer pair is a guinea pig aeromonas specific primer, and the length of an amplification product is 556 bp; the third specific primer pair is a specific primer of Aeromonas veronii, and the length of an amplification product is 660 bp.
Wherein the molar ratio of the first specific primer pair, the second specific primer pair and the third specific primer pair is 3:2: 4.
Wherein, specific primers are designed according to gene segments in genomes of aeromonas hydrophila, aeromonas caviae and aeromonas veronii, and are mainly used for PCR amplification of the three kinds of aeromonas.
Therefore, when a sample such as water, soil, aquatic products and the like contains at least one of aeromonas hydrophila, aeromonas caviae and aeromonas veronii, the specific primer consisting of the first specific primer pair, the second specific primer pair and the third specific primer pair can be used for detecting which kind or kinds of aeromonas contained in the sample.
The invention also provides a multiplex PCR detection kit for simultaneously detecting three kinds of aeromonas, which comprises the first specific primer pair, the second specific primer pair and the third specific primer pair.
Wherein, the multiplex PCR detection kit also comprises template DNA. Considering that the specific primer is mainly used for PCR amplification of Aeromonas hydrophila, Aeromonas caviae, and Aeromonas veronii, the template DNA mainly includes genomic DNA of at least one Aeromonas hydrophila, Aeromonas caviae, and Aeromonas veronii.
Since aeromonas hydrophila, aeromonas caviae and aeromonas veronii are the main three pathogenic bacteria of common aquatic animals such as frogs and fishes, the specific primer can be used for specifically identifying the aeromonas hydrophila, the aeromonas caviae and the aeromonas veronii in the sample, thereby ensuring the healthy development of the aquaculture industry of the frogs, the fishes and the like.
The multiplex PCR detection kit may further include 10 Xamplification buffer, dNTP (deoxyribonucleoside triphosphate), MgCl2Taq polymerase and double distilled water. When the kit is used, a PCR reaction system with corresponding concentration is prepared according to needs, wherein the molar ratio of the first specific primer pair, the second specific primer pair and the third specific primer pair in the PCR reaction system is 3:2: 4.
The invention also provides an application of the multiplex PCR detection kit for simultaneously detecting three kinds of aeromonas, and the multiplex PCR detection kit is used for detecting the aeromonas. Of course, other detection means can be combined to assist in the detection of Aeromonas.
It can be understood that the multiplex PCR detection kit is mainly used for detecting Aeromonas hydrophila, Aeromonas caviae and Aeromonas veronii, and when a sample contains at least one of the three Aeromonas caviae, the multiplex PCR detection kit can specifically identify which type or types of Aeromonas veronii is contained in the sample in the detection process.
The multiplex PCR detection method for simultaneously detecting three aeromonas is established as follows:
extracting a bacterial genome DNA template:
the genome DNA of three kinds of aeromonas species, i.e. aeromonas hydrophila, aeromonas caviae and aeromonas veronii, are respectively extracted by a bacterial genome DNA extraction kit.
Acinetobacter lofoenii, escherichia coli, pseudomonas flavus, proteus mirabilis, rice bacterial blight, pseudomonas aeruginosa, Citrobacter freundii, Edwardsiella tarda, Citrobacter buchneri, bacillus subtilis and the like are set as the control templates of the non-target pathogenic aeromonas exogenous species. Meanwhile, sterile water is used as a negative control; bacterial 16S rRNA universal primers (F: AGAGAGTTTGATCCTGGCTCAG; R: ACGGCTACCTTGTTACGACTT) were used as positive controls.
And (3) PCR amplification:
the PCR reaction system is 10-50 μ L, which comprises: 10 Xamplification buffer 1. mu.L-5. mu.L, 1.5mmol/L-3.0mmol/L MgCl20.10mmol/L-0.40mmol/L dNTP, 0.5U-2.5U Taq polymerase, 0.5 muL-4 muL DNA template, 0.1 mumol/L-1.5 mumol/L specific primer, wherein the molar ratio of the first specific primer pair, the second specific primer pair and the third specific primer pair in a PCR reaction system is 3:2: 4; double distilled water is added to 10-50. mu.L.
The PCR reaction conditions are as follows: pre-denaturation at 94-98 deg.C for 1-3 min;
denaturation at 94-98 deg.C for 15-30 s; annealing at 59-62 deg.c for 20-40 s; 30-60 s of extension at 70-74 ℃ for 30-37 cycles;
finally, extension is carried out for 5min-7min at 72 ℃.
Electrophoretic analysis:
preparing agarose gel plates, and preparing agarose gel according to the proportion of 1.5-2%. Weighing 0.6g-0.8g of agarose by using an analytical balance, adding the agarose into 40ml of 0.5 XTBE buffer solution, shaking up, heating the agarose in a microwave oven for 120s to completely dissolve the agarose, adding 1 microliter-3 microliter of nucleic acid dye into the agarose gel solution, uniformly mixing, pouring into a gel tank of a medium-made plate, inserting a comb with proper number of teeth, cooling and standing at room temperature for 30min-60min, after solidification, pulling out the comb from two sides simultaneously, and removing redundant gel at the edge to finish the preparation.
Electrophoresis and identification detection: the prepared agarose gel was placed in an electrophoresis tank, and 0.5 × TBE buffer was added to cover the gel. Adding 4-6 uL DNAmarker DM2000, and adding 4-6 uL sample amplification product. Performing nucleic acid electrophoresis at constant voltage of 120-180V for 10-30 min. And observing and recording the amplified bands of the samples to be detected through a gel imaging system, and analyzing and identifying results.
FIG. 1 shows the specific detection results of the multiplex PCR detection method for simultaneously detecting three types of Aeromonas according to the present invention. In the figure, M is a molecular weight standard DNAmaker DM 2000; in the figure, 1: hydrosphere monospore bacteria; 2: aeromonas caviae; 3: aeromonas veronii; 4: aeromonas hydrophila + Aeromonas caviae; 5: aeromonas hydrophila + Aeromonas veronii; 6: aeromonas caviae + Aeromonas veronii; 7: aeromonas hydrophila + Aeromonas caviae + Aeromonas veronii; 8: rice bacterial blight; 9: citrobacter buchneri; 10: pseudomonas flavescentis; 11: pseudomonas aeruginosa; 12: acinetobacter lofei; 13: proteus mirabilis; 14: citrobacter freundii; 15: edwardsiella tarda; 16: e.coli; 17: b, bacillus subtilis; 18: sterile water.
Based on the results of the PCR amplification products of the samples shown in FIG. 1, a diagnostic decision is made. When a band amplified by a first specific primer pair Aehy _ F/Aehy _ R, a second specific primer pair Aeca _ F/Aeca _ R and a third specific primer pair Aeve _ F/Aeve _ R in a multiplex PCR taking DNA of at least one of aeromonas hydrophila, aeromonas caviae and aeromonas veronii as a template is 314bp, 556bp or 660 bp; and has no amplification band in the multiple PCR amplification by taking genomic DNA of proteus mirabilis, pseudomonas shallownsis, citrobacter buchneri, pseudomonas aeruginosa, citrobacter freundii, acinetobacter lofoenii, edwardsiella tarda, escherichia coli, rice bacterial blight, bacillus subtilis and the like as templates; secondly, amplifying a band of about 1500bp in PCR by using the universal primer F/R in three types of pathogenic aeromonas, proteus mirabilis, pseudomonas flavus, citrobacter buchneri, pseudomonas aeruginosa, citrobacter freundii, acinetobacter lofoenii, edwardsiella tarda, escherichia coli, rice bacterial blight and bacillus subtilis as template DNA; and the first specific primer pair Aehy _ F/Aehy _ R, the second specific primer pair Aeca _ F/Aeca _ R, the third specific primer pair Aeve _ F/Aeve _ R and the universal primer F/R have no band in PCR amplification by taking sterile water as a template. And when the three conditions are simultaneously met, judging that the result is positive, otherwise, detecting and needing to be redone.
The invention also provides a multiplex PCR detection method for simultaneously detecting three kinds of aeromonas by applying the specific primers, which comprises the following steps:
s1, extracting genome DNA of aeromonas of a sample to be detected as template DNA;
s2, mixing the template DNA with specific primer, 10 Xamplification buffer solution, dNTP and MgCl2Preparing a PCR reaction system by using Taq polymerase and double distilled water, wherein the specific primers comprise a first specific primer pair, a second specific primer pair and a third specific primer pair;
s3, reacting the PCR reaction system to obtain an amplification product;
s4, carrying out gel electrophoresis on the amplification products, and analyzing the result according to the bands.
In step S1, the sample is not limited and may be water, soil, aquatic products, and the like, and the aeromonas includes at least one of aeromonas hydrophila, aeromonas caviae, and aeromonas veronii.
In step S2, the volume of the PCR reaction system is 10 to 50 μ L, wherein the reaction system comprises MgCl of 1.5 to 3.0mmol/L20.10mmol/L-0.40mmol/L dNTP, 0.1 mu mol/L-1.5 mu mol/L specific primer, 0.5U-2.5U Taq polymerase, 0.5 mu L-4 mu L template DNA, 1 mu L-5 mu L10 Xamplification buffer solution, and the balance of double distilled water; preferably, the volume of the PCR reaction system is 10-20. mu.L, wherein the PCR reaction system comprises 2.0-2.5 mmol/L MgCl20.20mmol/L-0.30mmol/L dNTP, 0.3 mu mol/L-0.8 mu mol/L specific primer, 1.0U-2.0U Taq polymerase, 1.0 mu L-3.0 mu L template DNA, 1 mu L-2 mu L10 Xamplification buffer solution, and the balance of double distilled water.
In step S2, the molar ratio of the first specific primer pair, the second specific primer pair and the third specific primer pair in the PCR reaction system is 3:2: 4.
In step S3, the reaction procedure is: pre-denaturation at 94-98 deg.C for 1-3 min; denaturation at 94-98 deg.C for 15s-30s, annealing at 59-62 deg.C for 20s-40s, and extension at 70-74 deg.C for 30s-60s for 30-37 cycles; finally, extending for 5min-7min at 72 ℃; preferably, the procedure for the reaction is: pre-denaturation at 94-95 deg.C for 2-3 min; denaturation at 94-95 deg.C for 20s-30s, annealing at 60-62 deg.C for 20s-30s, and extension at 72-74 deg.C for 30s-40s for 33-36 cycles; finally, extension is carried out for 5min-7min at 72 ℃.
In step S4, the amplification product is subjected to gel electrophoresis using 1.5% -2% agarose gel.
The detection method is rapid, simple and convenient, has high sensitivity and strong specificity, can simultaneously detect three kinds of aeromonas hydrophila, aeromonas caviae and aeromonas veronii, and can rapidly and specifically identify which kind or kinds of aeromonas.
The specific primers, the kit, the application and the multiplex PCR detection method for simultaneously detecting three types of aeromonas will be further described by the following specific examples.
Example 1: detection of cultured rana nigromaculata intestinal bacteria sample
1. Extraction of DNA from the sample: the sample is 6 groups of rana nigromaculata intestinal content samples collected from a certain farm, and the bacterial genome DNA in the sample is extracted by using a bacterial genome DNA extraction kit. Meanwhile, sterile water is set as a negative control sample, and a universal primer F/R is set as a positive control.
2. And (3) PCR amplification: preparing a PCR reaction system by using a first specific primer pair Aehy _ F/Aehy _ R, a second specific primer pair Aeca _ F/Aeca _ R and a third specific primer pair Aeve _ F/Aeve _ R, and respectively carrying out PCR amplification to obtain amplification products, wherein the specific steps are as follows:
the volume of the PCR reaction system is 20 mu L, wherein the PCR reaction system comprises 2.0mmol/L MgCl20.20mmol/L dNTP, 0.3. mu. mol/L specific primer, 1.0U Taq polymerase, 2. mu.L template DNA, 2. mu.L 10 × amplification buffer, and the balance double distilled water.
In the specific primers, the molar ratio of the first specific primer pair Aehy _ F/Aehy _ R, the second specific primer pair Aeca _ F/Aeca _ R and the third specific primer pair Aeve _ F/Aeve _ R is 3:2: 4.
The procedure for the reaction was: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 20s, annealing at 60 ℃ for 20s, and extension at 72 ℃ for 30s for 33 cycles; finally, extension was carried out at 72 ℃ for 7 min.
3. Electrophoretic analysis: performing gel electrophoresis on the amplification product, and analyzing the PCR amplification result, wherein the result is shown in FIG. 2, and in FIG. 2, M is molecular weight standard DNAker DM 2000; the figures in the figure are as follows: 1. 3, 5, 7, 9 and 11 are respectively the multiple PCR amplification results of 6 intestinal bacteria samples; 2. 4, 6, 8, 10 and 12 are positive controls; 13, negative control.
As can be seen from FIG. 2, three bands of 314bp, 556bp and 660bp are amplified in two cases of the intestinal bacteria samples, two bands of 314bp and 556bp are amplified in one case of the intestinal bacteria samples, two bands of 314bp and 660bp are amplified in one case of the intestinal bacteria samples, one band of 314bp is amplified in one case of the intestinal bacteria samples, and no band is generated in one case of the intestinal bacteria samples. In addition, the positive control showed that all 6 samples amplified a band of about 1500bp, while the negative control with sterile water as template DNA showed no band generation in the multiplex PCR amplification. The multiplex PCR detection method for simultaneously detecting three aeromonas established in the embodiment is proved to be effective.
Example 2: detection of cultured rana nigromaculata skin bacteria sample
1. Extraction of DNA from the sample: the samples are 6 groups of rana nigromaculata skin samples collected from a certain farm, and bacterial genome DNA in the samples is extracted by using a bacterial genome DNA extraction kit. Meanwhile, sterile water is set as a negative control sample, and a universal primer F/R is set as a positive control.
2. And (3) PCR amplification: preparing a PCR reaction system by using a first specific primer pair Aehy _ F/Aehy _ R, a second specific primer pair Aeca _ F/Aeca _ R and a third specific primer pair Aeve _ F/Aeve _ R, and respectively carrying out PCR amplification to obtain amplification products, wherein the specific steps are as follows:
the volume of the PCR reaction system is 20 mu L, wherein the PCR reaction system comprises 2.5mmol/L MgCl20.30mmol/L dNTP, 0.5. mu. mol/L specific primer, 2.0U Taq polymerase, 3.0. mu.L template DNA, 2. mu.L 10 × amplification buffer, and the balance double distilled water.
In the specific primers, the molar ratio of the first specific primer pair Aehy _ F/Aehy _ R, the second specific primer pair Aeca _ F/Aeca _ R and the third specific primer pair Aeve _ F/Aeve _ R is 3:2: 4.
The procedure for the reaction was: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 36 cycles; finally, extension was carried out at 72 ℃ for 7 min.
3. Electrophoretic analysis: performing gel electrophoresis on the amplification product, and analyzing the PCR amplification result, wherein the result is shown in FIG. 3, and in FIG. 3, M is molecular weight standard DNAker DM 2000; the figures in the figure are as follows: 1. 3, 5, 7, 9 and 11 are respectively the multiple PCR amplification results of 6 intestinal bacteria samples; 2. 4, 6, 8, 10 and 12 are positive controls respectively; 13, negative control.
As can be seen from FIG. 3, three bands of 314bp, 556bp and 660bp were amplified in all 6 samples, and the negative control using sterile water as template DNA showed that no band was generated in the multiplex PCR amplification, while the 1500bp band was generated in the multiplex PCR amplification using the bacterial universal primer F/R as positive control. The multiplex PCR detection method for simultaneously detecting three aeromonas established in the embodiment is proved to be effective.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> university of chessman in Zhejiang
<120> specific primer for simultaneously detecting three aeromonas, kit, application and multiplex PCR detection method
<160> 6
<170> SIPOSequenceListing 1.0
<210> 2
<211> 20
<212> DNA
<213> Aeromonas hydrophila (Aeromonas hydrophila)
<400> 2
cgagcaacag ctcgaagtgg 20
<210> 2
<211> 20
<212> DNA
<213> Aeromonas hydrophila (Aeromonas hydrophila)
<400> 2
gctgggattg aacgaagccg 20
<210> 3
<211> 20
<212> DNA
<213> Aeromonas caviae (Aeromonas caviae)
<400> 3
gctgggattg aacgaagccg 20
<210> 4
<211> 20
<212> DNA
<213> Aeromonas caviae (Aeromonas caviae)
<400> 4
ggagcctgcc aagaacgata 20
<210> 5
<211> 20
<212> DNA
<213> Aeromonas veroni (Aeromonas veronii)
<400> 5
ggcccttccg acaaaggatt 20
<210> 6
<211> 21
<212> DNA
<213> Aeromonas veroni (Aeromonas veronii)
<400> 6
ctccttcatc acccccatca g 21
Claims (10)
1. The specific primer for simultaneously detecting three types of aeromonas is characterized by comprising a first specific primer pair consisting of an upstream primer Aehy _ F and a downstream primer Aehy _ R, a second specific primer pair consisting of the upstream primer Aeca _ F and the downstream primer Aeca _ R, and a third specific primer pair consisting of the upstream primer Aeve _ F and the downstream primer Aeve _ R; wherein the content of the first and second substances,
the upstream primer Aehy _ F is 5 'CGAGCAACAGCTCGAAGTGG 3',
the downstream primer Aehy _ R is 5 'GCTGGGATTGAACGAAGCCG 3',
the upstream primer Aeca _ F is 5 'CCGGAACTCGGACTGAGAC 3',
the downstream primer Aeca _ R is 5 'GGAGCCTGCCAAGAACGATA 3',
the upstream primer Aeve _ F is 5 'GGCCCTTCCGACAAAGGATT 3',
the downstream primer Aeve _ R is 5 'CTCCTTCATCACCCCCATCAG 3'.
2. A multiplex PCR detection kit for simultaneously detecting three Aeromonas species, comprising the first specific primer pair, the second specific primer pair and the third specific primer pair according to claim 1.
3. The multiplex PCR detection kit for simultaneously detecting three Aeromonas species according to claim 2, further comprising a template DNA comprising genomic DNA of at least one Aeromonas species selected from the group consisting of Aeromonas hydrophila, Aeromonas caviae, and Aeromonas veronii.
4. The multiplex PCR detection kit for simultaneously detecting three aeromonas according to claim 2, wherein the multiplex PCR detection kit further comprises 10 x amplification buffer, dNTP, MgCl2Taq polymerase and double distilled water.
5. Use of the multiplex PCR detection kit for simultaneous detection of three Aeromonas species according to any one of claims 2 to 4, wherein the multiplex PCR detection kit is for detection of Aeromonas species.
6. The use of the multiplex PCR detection kit for simultaneously detecting three Aeromonas according to claim 5, wherein the Aeromonas comprises at least one of Aeromonas hydrophila, Aeromonas caviae, and Aeromonas veronii.
7. A multiplex PCR detection method for simultaneously detecting three types of Aeromonas using the specific primers of claim 1, comprising:
extracting genome DNA of aeromonas of a sample to be detected as template DNA;
mixing the template DNA with specific primer, 10 Xamplification buffer solution, dNTP and MgCl2The PCR reaction system is formed by preparing Taq polymerase and double distilled water, wherein the specific primers comprise a first specific primer pair, a second specific primer pair anda third specific primer pair;
the PCR reaction system is reacted to obtain an amplification product;
and carrying out gel electrophoresis on the amplification product according to the band analysis result.
8. The multiplex PCR detection method for simultaneously detecting three Aeromonas according to claim 7, wherein the Aeromonas includes at least one of Aeromonas hydrophila, Aeromonas caviae, and Aeromonas veronii.
9. The multiplex PCR detection method for simultaneously detecting three aeromonas according to claim 7, wherein the volume of the PCR reaction system is 10 μ L-50 μ L, and the PCR reaction system comprises MgCl of 1.5mmol/L-3.0mmol/L20.10mmol/L-0.40mmol/L dNTP, 0.1 mu mol/L-1.5 mu mol/L specific primer, 0.5U-2.5U Taq polymerase, 0.5 mu L-4 mu L template DNA, 1 mu L-5 mu L10 Xamplification buffer solution, and the balance of double distilled water.
10. The multiplex PCR detection method for simultaneously detecting three Aeromonas according to claim 7, wherein the reaction procedure is: pre-denaturation at 94-98 deg.C for 1-3 min;
denaturation at 94-98 deg.C for 15s-30s, annealing at 59-62 deg.C for 20s-40s, and extension at 70-74 deg.C for 30s-60s for 30-37 cycles;
finally, extension is carried out for 5min-7min at 72 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110081175.XA CN112725483B (en) | 2021-01-21 | 2021-01-21 | Specific primer, kit, application and multiplex PCR detection method for simultaneously detecting three kinds of aeromonas |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110081175.XA CN112725483B (en) | 2021-01-21 | 2021-01-21 | Specific primer, kit, application and multiplex PCR detection method for simultaneously detecting three kinds of aeromonas |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112725483A true CN112725483A (en) | 2021-04-30 |
| CN112725483B CN112725483B (en) | 2022-06-10 |
Family
ID=75594543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110081175.XA Active CN112725483B (en) | 2021-01-21 | 2021-01-21 | Specific primer, kit, application and multiplex PCR detection method for simultaneously detecting three kinds of aeromonas |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112725483B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925578A (en) * | 2012-11-15 | 2013-02-13 | 通威股份有限公司 | Detection reagent kit and detection method of aeromonas bacteria |
| CN104004842A (en) * | 2014-05-27 | 2014-08-27 | 中国水产科学研究院珠江水产研究所 | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals |
| CN105420373A (en) * | 2015-12-22 | 2016-03-23 | 于辉 | Multiple PCR primer set and probes and detecting method for simultaneously detecting three kinds of aeromonas |
| CN105734166A (en) * | 2016-05-11 | 2016-07-06 | 辽宁大学 | Multiplex-PCR primer and application thereof in cultivation process of turbots |
| CN106868198A (en) * | 2017-04-25 | 2017-06-20 | 扬州宏盛水产科技有限公司 | It is a kind of at the same detect SILURIFORMES four kinds of pathogenic bacteria of fish multiple PCR primer group and detection method |
| CN109554449A (en) * | 2019-01-18 | 2019-04-02 | 集美大学 | A kind of multiple PCR method that can detect 7 virulence genes of Aeromonas simultaneously |
| CN109929938A (en) * | 2019-04-17 | 2019-06-25 | 浙江师范大学 | Detect Aeromonas specific primer to, kit, application, PCR detection method |
-
2021
- 2021-01-21 CN CN202110081175.XA patent/CN112725483B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925578A (en) * | 2012-11-15 | 2013-02-13 | 通威股份有限公司 | Detection reagent kit and detection method of aeromonas bacteria |
| CN104004842A (en) * | 2014-05-27 | 2014-08-27 | 中国水产科学研究院珠江水产研究所 | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals |
| CN105420373A (en) * | 2015-12-22 | 2016-03-23 | 于辉 | Multiple PCR primer set and probes and detecting method for simultaneously detecting three kinds of aeromonas |
| CN105734166A (en) * | 2016-05-11 | 2016-07-06 | 辽宁大学 | Multiplex-PCR primer and application thereof in cultivation process of turbots |
| CN106868198A (en) * | 2017-04-25 | 2017-06-20 | 扬州宏盛水产科技有限公司 | It is a kind of at the same detect SILURIFORMES four kinds of pathogenic bacteria of fish multiple PCR primer group and detection method |
| CN109554449A (en) * | 2019-01-18 | 2019-04-02 | 集美大学 | A kind of multiple PCR method that can detect 7 virulence genes of Aeromonas simultaneously |
| CN109929938A (en) * | 2019-04-17 | 2019-06-25 | 浙江师范大学 | Detect Aeromonas specific primer to, kit, application, PCR detection method |
Non-Patent Citations (2)
| Title |
|---|
| SUZAN AL-SHUWELI等: "Identification of clinical aeromonas species by rpoB and gyrB sequencing and development of a multiplex PCR method for detection of Aeromonas hydrophila, A. caviae, A. veronii, and A. media", 《J CLIN MICROBIOL》, vol. 53, no. 2, 19 November 2014 (2014-11-19), pages 653 - 656 * |
| 韦小瑜等: "贵州省腹泻病例气单胞菌分离株种型鉴定及药物敏感性检测分析", 《医学动物防制》, vol. 32, no. 6, 31 December 2016 (2016-12-31), pages 591 - 593 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112725483B (en) | 2022-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| Oliveira et al. | Species identification using a small nuclear gene fragment: application to sympatric wild carnivores from South-western Europe | |
| Hsieh et al. | Establishing the pangolin mitochondrial D-loop sequences from the confiscated scales | |
| CN102304559B (en) | Fluorescence quantitative polymerase chain reaction (PCR) method for detecting bacillus coagulans quickly | |
| Bailey et al. | Use of a Multiplex PCR for the Detection of Toxin-Encoding Genes netB and tpeL in Strains of Clostridium perfringens | |
| JP7013190B2 (en) | A primer set for amplifying a fragment of insect-derived DNA, and a method for identifying an insect species using the primer set. | |
| CN112725483B (en) | Specific primer, kit, application and multiplex PCR detection method for simultaneously detecting three kinds of aeromonas | |
| CN112041441A (en) | Primer group for detecting candida auricula, candida auricula detection kit and candida auricula detection method | |
| CN103874766B (en) | Molecular Detection is determined | |
| Mohammed-Geba | Direct PCR as a rapid and simple forensic technique for detection of DNA profiles from human hair samples | |
| JP2015213439A (en) | Lamp primer for detecting staphylococcus aureus having enterotoxin b, c, d, or e gene, or genes thereof, and method for detecting staphylococcus aureus having enterotoxin b, c, d, or e gene, or genes thereof using the same | |
| KR101395938B1 (en) | Pcr diagnosis using specific primer for bacteria that cause diseases of allomyrina dichotoma | |
| Landolfi et al. | Development and validation of cytokine quantitative, real time RT-PCR assays for characterization of Asian elephant immune responses | |
| Kasivalu et al. | Molecular detection and characterization of Pasteurella multocida infecting camels in Marsabit and Turkana Counties, Kenya | |
| KR102009326B1 (en) | DEVELOPMENT OF SINGLEPLEX REAL-TIME PCR KIT FOR RAPID DETECTION OF CLOSTRIDIUM PERFRINGENS USING cpa, cpe TARGET GENE | |
| Kovačević-Grujičić et al. | Direct PCR amplification of the HVSI region in mitochondrial DNA from buccal cell swabs | |
| CN107904318B (en) | Molecular biology-based Caloglossa flavomarginata identification primer and method | |
| Kanchanaphum et al. | Development of Loop mediated isothermal amplification (LAMP) of SRY gene in human blood samples for sex determination | |
| CN111485014A (en) | Method for detecting live bacteria of escherichia coli | |
| Pang et al. | A new method for quantitative detection of Lactobacillus casei based on casx gene and its application | |
| CN106591464B (en) | Method for detecting gene expression quantity of fusarium oxysporum cellulase | |
| Pasookhush et al. | Single-strand conformation polymorphism fingerprint method for dictyostelids | |
| KR102611219B1 (en) | Primer set for detecting roseburia and use thereof | |
| CN114959083B (en) | Triple PCR detection primer set and kit | |
| Kovac et al. | DNA-based assays |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |