CN112553301A - Mouse DNA identification method - Google Patents
Mouse DNA identification method Download PDFInfo
- Publication number
- CN112553301A CN112553301A CN202011247637.2A CN202011247637A CN112553301A CN 112553301 A CN112553301 A CN 112553301A CN 202011247637 A CN202011247637 A CN 202011247637A CN 112553301 A CN112553301 A CN 112553301A
- Authority
- CN
- China
- Prior art keywords
- dna
- mouse
- tris
- solution
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention relates to the field of genetic engineering, in particular to a mouse DNA identification method, which aims at the problem that the existing mouse DNA extraction process has consumables and various reagents which increase the experiment cost and the time cost, and provides the following scheme, which comprises a mouse DNA extraction method, a detection primer for identifying the mouse DNA, a mouse toenail DNA extraction kit and a kit preparation method, and comprises the following steps: putting the toenails of the mice into a container; adding 50mM NaOH solution into the container, and heating at constant temperature of 96 ℃ for 10 min; firstly, cooling to 40 ℃, and then naturally cooling to 25 ℃; adding 1M Tris, 5mM EDTA solution with pH of 8.0, and vortexing for 5 s; centrifuging at 12000rpm for 3min, and collecting supernatant; the mouse DNA was subjected to PCR reaction. The DNA extraction process takes about 15min, DNA can be rapidly obtained, the process of extracting DNA is shortened, the reagent cost is saved, and the efficiency is obviously improved.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a method for identifying mouse DNA.
Background
In biological studies, transgenic technology can be used for studies on gene overexpression, gene expression silencing, expression of genes in specific cell populations, expression of exogenous or mutated genes, and the like. The transgenic animal refers to an animal in which an exogenous gene is artificially introduced into a fertilized egg or an early embryonic cell of a human animal by a genetic engineering method, and the exogenous gene is integrated with the genome of the animal, proliferated by cell division, and stably inherited to offspring. The establishment of transgenic mice is time-saving and labor-saving compared with the establishment of other large transgenic mammals, is an important tool for researching human diseases, and is more and more widely applied in the field of life science.
Before a transgenic mouse is adopted to carry out scientific research, the mouse needs to be propagated, the genotype of the mouse needs to be identified, and the mouse with a specific genotype is selected for subsequent research. Mouse genotype identification, including mouse genome DNA extraction, DNA target segment amplification and DNA electrophoresis. The existing common DNA extraction methods comprise a high-salt extraction method and a phenol/chloroform extraction method, and the methods have the defects of more complicated operation steps and longer time, such as more centrifugation times, overnight digestion by proteinase K and the like; the related reagents are more, such as proteinase K, chloroform, ethanol and the like. In some commercial kits (Promega, Vazyme, Beyotime, etc.), the time of the DNA extraction part is 30min to several hours, the contained consumables and various reagents increase the experiment cost and the time cost, and the efficiency of mouse genotype identification is limited to a certain extent.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides a method for identifying mouse DNA.
In order to achieve the purpose, the invention adopts the following technical scheme:
a detection Primer for identifying mouse DNA, which comprises at least one group of Primer1F/R, Primer2F/R primers:
Primer1F：CAGCAGGGTGATTTAAAGGGTTC；
Primer1R：GGACGTCGCAGAGTAAAGCCA；
Primer2F：GGCTGTGCTTCAGTGTTAGAGAC；
Primer2R：CTACAGAGTCATTCCACGGAGC。
a method for identifying mouse DNA, comprising the following steps:
s1: putting the toenails of the mice into a container;
s2: adding 25-50 mM NaOH solution into the container, and heating at constant temperature of 96 ℃ for 10 min;
s3: firstly, cooling to 40 ℃, and then naturally cooling to 25 ℃;
s4: adding 1M Tris, 5mM EDTA solution with pH of 8.0, and vortexing for 5 s;
s5: centrifuging for 3min, and collecting supernatant;
s6: PCR reactions were performed with Primer1F/R, Primer2F/R primers.
A kit for extracting mouse toenail DNA comprises Primer1F/R, Primer2F/R, 25-50 mM NaOH solution, 1M Tris solution with the pH value of 8.0 and 2-5 mM EDTA solution.
A preparation method of a kit for extracting mouse toenail DNA comprises the step of dissolving 0.1-0.2 g of NaOH in 100mL of ddH2In O, preparing 25-50 mM NaOH solution;
12.114g Tris, 0.05845-0.14612 g EDTA are dissolved in ddH2And in O, regulating the pH to 8.0 by hydrochloric acid, and diluting to 100mL to prepare a 1M Tris and 2-5 mM EDTA solution with the pH of 8.0.
Further, the volume of the components of the PCR reaction is:
further, the conditions of the PCR reaction include:
pre-denaturation: 94 ℃, 5min and 1 cycle;
and (3) PCR reaction: denaturation at 94 ℃, annealing at 30s and 56 ℃, extension at 30s and 72 ℃, and 45s and 35 cycles;
and (3) complete extension: 72 ℃ for 10 min.
Further, the identification method further comprises electrophoretic detection: the products of the PCR reaction were subjected to 1% agarose gel electrophoresis at constant pressure of 130V for 30 min.
Further, the volume of the 25-50 mM NaOH solution is 100 muL, and the volume of the 1M Tris and 2-5 mM EDTA solution with the pH value of 8.0 is 20 muL.
The invention has the beneficial effects that:
according to the invention, a 25-50 mM NaOH solution is adopted to treat mouse toenails, the mouse toenails are heated to boil and neutralized with acid, so that nucleic acid in cells is released into an aqueous solution, a cleavage product can be directly used for PCR detection, corresponding primers are designed, and isopropanol or ethanol is not required for purification.
Drawings
FIG. 1 shows the results of gene identification of NDUFA7 transgenic knockout mice and littermate wild-type mice according to the methods disclosed in the embodiments of the present invention;
FIG. 2 shows the results of mouse genotype identification by high salt method for DNA extraction;
wherein "+/+" indicates a wild-type mouse, "+/-" indicates a heterozygous knockout mouse, and "-/-" indicates a homozygous knockout mouse. Primer1 was targeted to amplify wild type mice and Primer2 was targeted to amplify transgenic mice.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments.
The following examples of the extraction of mouse toenail DNA are examples 2-5, example 2 using a reagent concentration of 50mM NaOH solution, 1M Tris, 5mM EDTA solution at pH 8.0 as an example; example 3 reagents using 50mM NaOH solution, 1M Tris, 2mM EDTA solution at pH 8.0; example 4 reagents using 25mM NaOH solution, 1M Tris, 2mM EDTA solution at pH 8.0; example 5 the method of the invention is illustrated using reagent concentrations of 25mM NaOH solution, 1M Tris, 5mM EDTA solution at pH 8.0.
Example 1: the reagent concentrations of 50mM NaOH solution, 1M Tris solution with pH 8.0, and 5mM EDTA solution are used as examples, and other concentrations can be prepared according to the method of this example.
50mM NaOH solution: 0.2g NaOH was dissolved in 100mL ddH2O (double distilled water);
1M Tris, 5mM EDTA solution at pH 8.0: weighing 12.114g Tris, 0.14612g EDTA dissolved in ddH2In O, the pH value is adjusted to 8.0 by hydrochloric acid, and the volume is adjusted to 100 mL.
Example 2: extraction of mouse genomic DNA
Cutting 2mM toenails at the toe heels of the mice, putting the toenails into a clean centrifugal tube, adding 100 mu L of 50mM NaOH solution into the centrifugal tube, putting the centrifugal tube into a metal bath, and heating at the constant temperature of 96 ℃ for 10 min;
cooling to about 40 ℃ in a metal bath, naturally cooling to room temperature (25 ℃), cracking, adding a 1M Tris solution with the pH of 8.0 and a 5mM EDTA solution into a centrifuge tube, and vortexing for 5s to neutralize strong base on the one hand and provide a protective environment for DNA (deoxyribonucleic acid) by using Tris solution with the pH of 8.0 on the other hand, wherein EDTA can chelate Mg2+Inhibiting the activity of DNase (deoxyribonuclease) so that the DNA is in a stable state under the environment;
the tube was placed in a centrifuge at 12000rpm for 3min at room temperature (25 ℃ C.), and the supernatant was collected over about 15 min.
Example 3: extraction of mouse genomic DNA
Cutting 2mM toenails at the toe heels of the mice, putting the toenails into a clean centrifugal tube, adding 100 mu L of 50mM NaOH solution into the centrifugal tube, putting the centrifugal tube into a metal bath, and heating at the constant temperature of 96 ℃ for 10 min;
cooling to about 40 ℃ in a metal bath, naturally cooling to room temperature (25 ℃), cracking, adding a 1M Tris solution with the pH of 8.0 and a 2mM EDTA solution into a centrifuge tube, and vortexing for 5s to neutralize strong base on the one hand and provide a protective environment for DNA (deoxyribonucleic acid) by using Tris with the pH of 8.0 on the other hand, wherein EDTA can chelate Mg2+Inhibiting the activity of DNase (deoxyribonuclease) so that the DNA is in a stable state under the environment;
the tube was placed in a centrifuge at 12000rpm for 3min at room temperature (25 ℃ C.), and the supernatant was collected over about 15 min.
Example 4: extraction of mouse genomic DNA
Cutting 2mM toenails at the toe heels of the mice, putting the toenails into a clean centrifugal tube, adding 100 mu L of 25mM NaOH solution into the centrifugal tube, putting the centrifugal tube into a metal bath, and heating at the constant temperature of 96 ℃ for 10 min;
cooling to about 40 ℃ in a metal bath, naturally cooling to room temperature (25 ℃), cracking, adding a 1M Tris solution with the pH of 8.0 and a 2mM EDTA solution into a centrifuge tube, and vortexing for 5s to neutralize strong base on the one hand and provide a protective environment for DNA (deoxyribonucleic acid) by using Tris with the pH of 8.0 on the other hand, wherein EDTA can chelate Mg2+Inhibiting the activity of DNase (deoxyribonuclease) so that the DNA is in a stable state under the environment;
the tube was placed in a centrifuge at 12000rpm for 3min at room temperature (25 ℃ C.), and the supernatant was collected over about 15 min.
Example 5: extraction of mouse genomic DNA
Cutting 2mM toenails at the toe heels of the mice, putting the toenails into a clean centrifugal tube, adding 100 mu L of 25mM NaOH solution into the centrifugal tube, putting the centrifugal tube into a metal bath, and heating at the constant temperature of 96 ℃ for 10 min;
cooling to about 40 ℃ in a metal bath, naturally cooling to room temperature (25 ℃), cracking, adding a 1M Tris solution with the pH of 8.0 and a 5mM EDTA solution into a centrifuge tube, and vortexing for 5s to neutralize strong base on the one hand and provide a protective environment for DNA (deoxyribonucleic acid) by using Tris solution with the pH of 8.0 on the other hand, wherein EDTA can chelate Mg2+Inhibiting the activity of DNase (deoxyribonuclease) so that the DNA is in a stable state under the environment;
the tube was placed in a centrifuge at 12000rpm for 3min at room temperature (25 ℃ C.), and the supernatant was collected over about 15 min.
Example 6: the DNA of the mouse extracted in the above examples 2 to 5 was subjected to PCR reaction
Primers for identifying mouse genotypes are designed, in the embodiment, Primer1 (Primer 1) and Primer2 (Primer 2) are respectively designed for detecting a wild mouse and an NDUFA7 transgenic knockout mouse:
primer design
Primer design software Primer Premier 5.0 is adopted for design, and the design principle is as follows: the length of the primers is 18-25 bp, GC% is about 40-60%, the difference of Tm values between the two primers is small, and the primers capable of covering target fragments are selected. Two pairs of primers Primer1F/R and Primer2F/R are designed together, the Primer information is shown in Table 1, and the sequence numbers in the sequence table are SEQ ID NO 1-SEQ ID NO 4. After all primers were designed, the synthesis was entrusted to Nanjing Kingsrei Biotech GmbH.
TABLE 1 primer sequence information
The designed primers for identifying mouse genotype are used for PCR experiment, and the PCR reaction system is shown in the following table 2:
table 2 the component volumes of the PCR reaction are:
the PCR reaction conditions are as follows: pre-denaturation: 94 ℃, 5min and 1 cycle;
and (3) PCR reaction: denaturation at 94 ℃, annealing at 30s and 56 ℃, extension at 30s and 72 ℃, and 45s and 35 cycles;
and (3) complete extension: 72 ℃ for 10 min.
Example 7: DNA electrophoresis detection
The PCR product was subjected to 1% agarose gel electrophoresis at a constant pressure of 130V for 30 min. Observing in a gel imager and taking pictures;
the photographs of the DNA of the mice extracted in examples 2-5 were identical and are shown in FIG. 1.
Example 8: comparative experiment
The mouse DNA is extracted by a high-salt method, and impurities which cannot be dissolved in high salt are removed by dissolving the DNA by NaCl with high salt concentration, and the specific steps are as follows:
1. the mouse toenails of 2mm were excised, and 500. mu.L of a digestive juice (formulation: 6.7mL of 5M NaCl, 0.4mL of 0.5M EDTA, 0.8mL of 1M Tris-HCl, pH 8, 0.7mL of 20mg/mL protease) was addedK，3.5mL 20％SDS,ddH2O is added to 100mL), and digested at 55 ℃ overnight;
2. adding 130 μ L of 5M NaCl, mixing, standing for 10min, centrifuging at 13000rpm for 10min at 4 deg.C;
3. taking the supernatant, adding 2.5 times volume of 95% ethanol, mixing uniformly, centrifuging at 4 ℃, 13000rpm for 10min, and precipitating DNA;
4. the supernatant was discarded, and 500. mu.L of 70% ethanol was added to the DNA for washing, and centrifuged at 12000rpm for 5min at 4 ℃;
discarding the supernatant, drying in air for 10min, adding ddH2O, fully dissolving the DNA, completing the extraction of the DNA, and consuming about 1h except digesting overnight;
5. the final electrophoretic pictures were taken as shown in fig. 2, following the methods of example 3 and example 4.
And (4) analyzing results: as shown in FIGS. 1 and 2, DL1000 DNA Marker is shown in the first lane, Primer1 can amplify 771bp fragment of wild mouse gene, and Primer2 can amplify 450bp fragment of knock-out mouse. Only the 771bp band in the PCR result is a wild mouse, only the 450bp band is a homozygous knockout mouse, the two fragments can be amplified to form a heterozygous knockout mouse, the DNA genotype identification results of the mice extracted by the two methods have no difference, and the method can be used for quickly identifying the genotype of the mice and has few related reagents;
the high-salt method for extracting the DNA of the mouse involves more reagents, has complicated steps and long time consumption, and needs about 30min to 1h for other operations except digestion overnight.
The invention can rapidly carry out genotype identification, has few related reagents, has about 15min of DNA extraction operation, and is suitable for high-throughput or large-batch mouse genotype identification.
Example 9, a kit for extracting DNA from mouse toenails, comprising the Primer1F/R, Primer2F/R, 25 to 50mM NaOH solution, and 1M Tris, 2 to 5mM EDTA solution at pH 8.0;
the preparation of the kit comprises dissolving 0.1-0.2 g NaOH in 100mL ddH2In O, preparing 25-50 mM NaOH solution;
get 12.114g Tris, 0.05845-0.14612 g EDTA dissolved in ddH2And in the O, adjusting the pH to 8.0 by hydrochloric acid, and diluting to 100mL to prepare a 1M Tris and 2-5 mM EDTA solution with the pH of 8.0, wherein the volume of the 25-50 mM NaOH solution is 100 muL, and the volume of the 1M Tris and 2-5 mM EDTA solution with the pH of 8.0 is 20 muL.
In the above examples, the unit M represents mol/L and mM represents mmol/L.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.
Claims (8)
1. A detection primer for identifying mouse DNA is characterized in that: comprises at least one group of Primer1F/R, Primer2F/R primers:
Primer1F：CAGCAGGGTGATTTAAAGGGTTC；
Primer1R：GGACGTCGCAGAGTAAAGCCA；
Primer2F：GGCTGTGCTTCAGTGTTAGAGAC；
Primer2R：CTACAGAGTCATTCCACGGAGC。
2. a method for identifying mouse DNA, comprising: the method comprises the following steps:
s1: putting the toenails of the mice into a container;
s2: adding 25-50 mM NaOH solution into the container, and heating at constant temperature of 96 ℃ for 10 min;
s3: firstly, cooling to 40 ℃, and then naturally cooling to 25 ℃;
s4: adding 1M Tris with the pH value of 8.0 and 2-5 mM EDTA solution, and whirling for 5 s;
s5: centrifuging for 3min, and collecting supernatant;
s6: a PCR reaction is carried out using the primers of claim 1.
3. The method of claim 2, wherein the PCR reaction comprises the following components:
4. the method of claim 3, wherein the PCR reaction conditions comprise:
pre-denaturation: 94 ℃, 5min and 1 cycle;
and (3) PCR reaction: denaturation at 94 ℃, annealing at 30s and 56 ℃, extension at 30s and 72 ℃, and 45s and 35 cycles;
and (3) complete extension: 72 ℃ for 10 min.
5. The method of claim 2, further comprising detecting by electrophoresis: the products of the PCR reaction were subjected to 1% agarose gel electrophoresis at constant pressure of 130V for 30 min.
6. A kit for extracting DNA from mouse toenails, which comprises the primer of claim 1, 25-50 mM NaOH solution, and 1M Tris, 2-5 mM EDTA solution with pH of 8.0.
7. The method for preparing the kit for extracting DNA from toenails of mice of claim 6, wherein the kit comprises 0.1-0.2 g NaOH dissolved in 100mL ddH2In O, preparing 25-50 mM NaOH solution;
12.114g Tris, 0.05845-0.14612 g EDTA are dissolved in ddH2In O, regulating pH to 8.0 with hydrochloric acid, diluting to 100mL, and preparing to pH8.0 of 1M Tris, 2-5 mM EDTA solution.
8. The method for identifying mouse DNA or the kit for extracting mouse toenail DNA according to claim 2 or 7, wherein the volume of the 25 to 50mM NaOH solution is 100 μ L, and the volume of the 1M Tris solution having pH of 8.0 and the 2 to 5mM EDTA solution is 20 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011247637.2A CN112553301A (en) | 2020-11-10 | 2020-11-10 | Mouse DNA identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011247637.2A CN112553301A (en) | 2020-11-10 | 2020-11-10 | Mouse DNA identification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112553301A true CN112553301A (en) | 2021-03-26 |
Family
ID=75041754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011247637.2A Pending CN112553301A (en) | 2020-11-10 | 2020-11-10 | Mouse DNA identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112553301A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317767A (en) * | 2021-12-21 | 2022-04-12 | 斯贝福（北京）生物技术有限公司 | Primer, kit and method for distinguishing C57BL/6 subline mouse |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110408686A (en) * | 2019-08-09 | 2019-11-05 | 中新国际联合研究院 | A kind of method of Rapid identification murine genes type |
| CN110551691A (en) * | 2018-05-31 | 2019-12-10 | 华中科技大学 | construction of idiopathic basal ganglia calcification pathogenic gene mutation mouse model |
| CN110904241A (en) * | 2018-09-14 | 2020-03-24 | 广州铂晋生物科技有限公司 | Rapid identification method for transgenic mouse genotype |
-
2020
- 2020-11-10 CN CN202011247637.2A patent/CN112553301A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110551691A (en) * | 2018-05-31 | 2019-12-10 | 华中科技大学 | construction of idiopathic basal ganglia calcification pathogenic gene mutation mouse model |
| CN110904241A (en) * | 2018-09-14 | 2020-03-24 | 广州铂晋生物科技有限公司 | Rapid identification method for transgenic mouse genotype |
| CN110408686A (en) * | 2019-08-09 | 2019-11-05 | 中新国际联合研究院 | A kind of method of Rapid identification murine genes type |
Non-Patent Citations (1)
| Title |
|---|
| 李振华;张英展;周应毕;刘斌;: "碱性裂解液提取DNA法在环氧化酶亚型基因敲除小鼠基因型鉴定中的应用", 中国医学创新, no. 06 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317767A (en) * | 2021-12-21 | 2022-04-12 | 斯贝福（北京）生物技术有限公司 | Primer, kit and method for distinguishing C57BL/6 subline mouse |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11898149B2 (en) | Methods and compositions for identifying and enriching for cells comprising site specific genomic modifications | |
| JP2021168659A (en) | Methods for next generation genome walking and related compositions and kits | |
| WO2006126040A1 (en) | Bacterial and bacterial associated mirnas and uses thereof | |
| CN110541002A (en) | method for constructing zebra fish asap1b gene knockout mutant by using CRISPR/Cas9 technology | |
| CN111154758A (en) | Method for knocking out zebra fish slc26a4 gene | |
| CN104962643B (en) | Stablize reference gene, its screening technique and the application of expression in white backed planthopper different tissues position | |
| CN109280666A (en) | A kind of method of gene knockout breeding bai2 Gene Deletion zebra fish | |
| CN108315444A (en) | A kind of multiple PCR primer and discrimination method differentiating layer of green-shell egg genotype | |
| CN110894510A (en) | Method for breeding Lgr6 gene-deleted zebra fish through gene knockout | |
| CN112553301A (en) | Mouse DNA identification method | |
| CN113862375A (en) | SNP (Single nucleotide polymorphism) marker of AANAT (ananas site-directed translation) and ASMT (antisense-fluorescent marker) genes of cattle and application thereof | |
| CN110724735B (en) | SNP locus and primer for rapidly identifying individual sex of fugu obscurus and method thereof | |
| CN110894511A (en) | Method for breeding ppm1g gene mutant zebra fish by gene editing | |
| CN108624589B (en) | Circular RNA circ-ERBB2, detection reagent and application thereof | |
| CN110904241A (en) | Rapid identification method for transgenic mouse genotype | |
| CN111705144B (en) | SINE transposon polymorphic molecular marker in ZNF2 gene related to pig backfat thickness and detection method thereof | |
| CN110628919B (en) | Method for detecting g. +6723 locus genotype of sheep MSTN gene | |
| CN114480497A (en) | Construction method and application method of ep400 gene knockout zebra fish heart failure model | |
| CN110938681A (en) | Allele nucleic acid enrichment and detection method | |
| CN111808934A (en) | Circular RNA full-length identification method and kit thereof | |
| CN112654710A (en) | Methods and systems for directing RNA design and use | |
| CN114182025B (en) | SNP molecular marker related to pig feed conversion rate and application thereof | |
| KR20180118454A (en) | Method for mass production of Cot-1 DNA | |
| WO2023001235A1 (en) | Indel marker of pig growth rate-related gene rps27l and application thereof | |
| CN114317685B (en) | Kit for detecting mRNA variable shear variation, library building method and sequencing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |