CN112691193A - Drug for treating dilated cardiomyopathy and screening method and application - Google Patents
Drug for treating dilated cardiomyopathy and screening method and application Download PDFInfo
- Publication number
- CN112691193A CN112691193A CN202110025260.4A CN202110025260A CN112691193A CN 112691193 A CN112691193 A CN 112691193A CN 202110025260 A CN202110025260 A CN 202110025260A CN 112691193 A CN112691193 A CN 112691193A
- Authority
- CN
- China
- Prior art keywords
- znf593
- dilated cardiomyopathy
- drug
- treating
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Pathology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Cardiology (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- Veterinary Medicine (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Heart & Thoracic Surgery (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a drug for treating dilated cardiomyopathy, which takes lncRNAZNF593-AS AS a drug target point AS a drug effective component, expresses the drug effect of ZNF593-AS by up-regulation, plays a role in treating dilated cardiomyopathy, a screening method of an anti-dilated cardiomyopathy drug and application of a full-length sequence or a functional fragment of ZNF593-AS in preparing the drug for treating dilated cardiomyopathy. The invention has the following advantages and effects: the applicant originally found a highly conserved ZNF593-AS in heart tissues of patients with dilated cardiomyopathy, and the ZNF593-AS is mainly located in myocardial cells and is remarkably reduced in the myocardial cells of the patients with dilated cardiomyopathy. Then, animal experiments prove that the up-regulated ZNF593-AS has the effects of improving the central function damage of a heart expansion model induced by thoracic aortic constriction, the reduction of the contractility of cardiac muscle cells and the calcium ion homeostasis.
Description
Technical Field
The invention relates to a novel medical application of long-chain non-coding RNA (lncRNA), in particular to an application of lncRNA in diagnosis, prognosis evaluation and treatment of dilated cardiomyopathy, belonging to the field of diagnosis, prevention and treatment of cardiovascular diseases.
Background
Heart failure is a complex group of syndromes caused by various structural or functional disorders of the heart resulting in impaired ventricular filling and/or ejection capability. Although the treatment of heart failure remains a problem with advances in scientific research and treatment, there are over 580 million patients in the united states and over 2300 million heart failure patients worldwide. Global epidemiological studies of global diseases in 2015 show that cardiovascular diseases account for the first mortality of global non-infectious diseases, but the five-year survival rate of the cardiovascular diseases is similar to that of malignant tumors, and the cardiovascular diseases are an important public health problem. Dilated cardiomyopathy is a clinical syndrome of different cardiovascular diseases developing to the terminal stage, has the main pathophysiological characteristics of impaired ventricular filling and ejection capacity, finally low ventricular blood pumping function, poor prognosis and high mortality, is one of the most main causes threatening human health and causing increased medical burden, and is particularly important for China with increasingly-aging population. Dilated cardiomyopathy ranks third in various cardiovascular diseases leading to heart failure and is the leading cause of heart transplant surgery.
In cardiac muscle cells, Ca2+The process of intracellular signal transduction that mediates the association of cell membrane depolarization and cell contraction is called excitation-contraction coupling. Excitation-contraction coupling is the fundamental mechanism of mechanical activity of the heart, during which calcium ions play a key role and are the key responsible for causing systole and diastole. Intracellular free Ca2+The concentration, rate of rise, rate of fall directly affect the systolic and diastolic activity of the myocardium. And intracellular Ca2+Is central to the pathogenesis of heart failure and is the major cause of reduced myocardial contractile function. Ca in cardiomyocytes in dilated cardiomyopathy2+Against Ca2+The therapeutic measures of the regulatory mechanisms have also been widely used in the treatment of dilated cardiomyopathy and heart failure, and these studies also suggest that we maintain Ca in cardiomyocytes2+Can be used as a new target for treating heart failure.
The long-chain non-coding RNA is a non-coding RNA which is newly discovered in recent years and has a nucleotide sequence of more than 200nt and an important gene expression regulation effect. Recently, more and more studies have found lncRNA to play an important role in a variety of cardiovascular diseases, including myocardial metabolism, myocardial hypertrophy, cardiac conduction system and cardiac development, among others. Elucidation of the molecular mechanisms of lncRNA function is a major challenge in this field. In recent years, more and more studies have shown that lncRNA is involved in various processes of gene expression during disease, including transcriptional regulation, post-transcriptional regulation, and epigenetic regulation, among others. LncRNA function can regulate the expression level of downstream target genes by cis (cis) or trans (trans) action. The mechanisms of action of lncRNA localized by different subcellular structures are different. The localization of the cytoplasmic nuclei of LncRNA helps us to determine the mode of action of LncRNA. Localized lncrnas in the nucleus may affect transcription of genes by a variety of mechanisms, including epigenetic modifications, interactions with transcription factors, and affect mRNA processing or export. The modes of action of lncRNA distributed in the cytoplasm mainly include: affect the stability of mRNA, affect translation initiation, act as a competitor for endogenous RNA, or affect post-translational modifications, etc. Due to the lack of conservation of lncrnas between species, little is known about their role in the human heart, although many studies report the function and mechanism of action of long non-coding RNAs in mouse models.
Disclosure of Invention
The inventor discovers the relationship between ZNF593-AS and an occurrence mechanism of the dilated cardiomyopathy accidentally according to the problems and the defects objectively existing in the field, further performs molecular experiments to develop an anti-dilated cardiomyopathy medicament taking ZNF593-AS AS a medicament target point, simultaneously performs animal experiments to verify the effect, and discovers that the cardiac function damage and the myocardial cell contractility reduction during dilated cardiomyopathy can be obviously improved by taking ZNF593-AS AS a medicament action target point and up-regulating the molecules expressing ZNF 593-AS. The technical scheme of the invention is as follows:
the drug for treating the dilated cardiomyopathy comprises drug effective components, wherein lncRNA ZNF593-AS is used AS a drug target point, and the drug effect for treating the dilated cardiomyopathy is achieved by up-regulating and expressing the ZNF 593-AS.
The invention is further provided with: the drug effect component comprises a full-length sequence fragment containing ZNF593-AS or a sequence functional fragment containing NF593-AS, wherein the sequence of ZNF593-AS is shown AS SEQ ID NO.1, and the sequence functional fragment of ZNF593-AS is shown AS SEQ ID NO. 2.
By adopting the technical scheme, the drug effective component of the drug comprises the full length or functional fragment of the ZNF593-AS sequence, thereby playing the role of increasing the expression level and further treating.
The invention is further provided with: also comprises pharmaceutically acceptable auxiliary materials.
By adopting the technical scheme, the anti-dilated cardiomyopathy medicament can be added with various pharmaceutically acceptable auxiliary agents/auxiliary materials to prepare various dosage forms according to objective requirements by technical personnel in the field, and the medicament is convenient to sell or popularize.
The invention is further provided with: reagents for buffering, and/or synthesizing, and/or purifying the ZNF593-AS are also included.
The invention also provides a medicine for treating dilated cardiomyopathy, and the medicinal effective components of the medicine have degradation or inhibition effects on substances for down-regulating the sequence of ZNF 593-AS.
The invention also provides a screening method of the anti-dilated cardiomyopathy drug, and whether the substance to be selected can up-regulate and express ZNF593-AS is detected.
The invention also provides application of the substance capable of up-regulating and expressing ZNF593-AS in preparing an anti-dilated cardiomyopathy medicament.
The invention also provides an application of the full-length sequence fragment of ZNF593-AS in preparing a medicament for treating dilated cardiomyopathy, wherein the full-length sequence fragment of ZNF593-AS is shown AS SEQ ID NO. 1.
The invention also provides application of the sequence functional fragment of ZNF593-AS in preparing a medicament for treating dilated cardiomyopathy, wherein the sequence functional fragment of ZNF593-AS is shown AS SEQ ID NO. 2.
The invention also provides application of a substance capable of up-regulating and expressing the ZNF593-AS in preparing an anti-dilated cardiomyopathy medicament. The act of loading each of the above-described substances into commercial packaging labeled for anti-dilated cardiomyopathy use on any scale falls within the scope of the claimed invention.
The invention has the beneficial effects that:
in the invention, the applicant originally discovers the highly conserved ZNF593-AS in the heart tissue of the patient with the dilated cardiomyopathy, and the ZNF593-AS is mainly positioned in the myocardial cells and is obviously reduced in the myocardial cells of the patient with the dilated cardiomyopathy. Then, animal experiments prove that the up-regulated ZNF593-AS has the effects of improving the central function damage of a heart expansion model induced by thoracic aortic constriction, the reduction of the contractility of cardiac muscle cells and the calcium ion homeostasis.
In order to realize the treatment purpose of the dilated cardiomyopathy, the ZNF593-AS is used for animal experiments, and the animal experiments prove that the ZNF593-AS or the composition of a functional area can obviously improve the cardiac function damage, the myocardial cell contractility disorder and the calcium ion homeostasis induced by thoracic aorta constriction, thereby achieving the purpose of auxiliary treatment of the dilated cardiomyopathy. Therefore, the invention provides a medicine for treating clinical dilated cardiomyopathy by taking ZNF593-AS AS a treatment target based on the findings and results.
The invention designs a sequence for expressing ZNF593-AS and synthesizes the sequence based on the base sequence of ZNF 593-AS. The ZNF593-AS composition can obviously improve the cardiac function damage, myocardial cell contractility disorder and calcium ion homeostasis induced by thoracic aorta constriction. Thus, ZNF593-AS is shown to have the potential effect of improving dilated cardiomyopathy.
According to the invention, experiments show that the ZNF593-AS expression of the heart tissue of the patient with the dilated cardiomyopathy is reduced (shown in figure 1A), and the ZNF593-AS is mainly and obviously reduced in the myocardial cells of the patient with the dilated cardiomyopathy. In vivo experiments show that the composition of ZNF593-AS full length and functional region can obviously improve cardiac function damage, myocardial cell contractility disorder and calcium ion homeostasis induced by thoracic aortic stenosis, and achieve the purpose of adjuvant therapy of dilated cardiomyopathy.
Drawings
FIG. 1A shows the total expression of ZNF593-AS in the heart tissue of patients with dilated cardiomyopathy and control group in experiment 1 of the present invention, and the amount of ZNF593-AS in the patient sample is found to be reduced. B is the expression quantity of ZNF593-AS in heart tissues of the dilated cardiomyopathy patients and the control population in the experiment 1 in the myocardial cells, endothelial cells and fibroblasts, and the ZNF593-AS is found to be mainly positioned in the myocardial cells and obviously reduced in the myocardial cells.
FIG. 2 shows the therapeutic effect of ZNF593-AS on dilated cardiomyopathy in experiment 2 of the present invention. A is that the full length and the functional area of ZNF593-AS are found to have the function of improving the ejection fraction reduction in a heart expansion model induced by thoracic aortic constriction by mouse ultrasonic detection. And B, the full-length and functional regions of ZNF593-AS are detected by using a cardiac catheter to have the function of improving the central function damage of a cardiac dilatation model induced by thoracic aortic constriction. C is detected by an IonOptix myocardial cell contraction measuring system, and the overall length and the functional area of ZNF593-AS have the function of improving the contractility of the primary myocardial cells of the heart-expanded mice induced by thoracic aortic constriction:
Detailed Description
The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It is to be understood that the described embodiments are merely a few embodiments of the invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments of the present invention without any inventive step, are within the scope of the present invention.
Instrumentation and equipment
ABI 9700 PCR instrument
ABI 7900HT fluorescence real-time quantitative PCR instrument
Beckman X-15R low-temperature high-speed centrifuge
IonOptix myocardial cell contraction and ion concentration synchronous measurement system
Reagent and consumable
TRIZOL was purchased from Invitrogen;
reverse transcription kits were purchased from Thermofisher;
SYBR Green available from Thermofisiher;
the EasyPure Plasmid MiniPrep Kit Plasmid extraction Kit is purchased from Beijing Quanyujin;
sources of biological material
Peripheral blood of patients with dilated cardiomyopathy comes from hospitalized patients in Wuhan Tongji hospital in 2012 and 2018 and is signed with informed consent;
c57BL/6 was from the Experimental animals center of Wuhan university;
group 1 examples:
in a first group of embodiments of the invention, there is provided a medicament for the treatment of dilated cardiomyopathy, the following characteristics being present in each of the groups of embodiments: the drug effect component of the drug for treating the dilated cardiomyopathy takes ZNF593-AS AS a drug target, and the drug effect of treating the dilated cardiomyopathy is achieved by up-regulating and expressing the ZNF 593-AS. Experiments show that the sequence of ZNF593-AS is highly conserved, the content of ZNF593-AS in an expanded cardiomyopathy patient is obviously lower than that of a control group, and the ZNF593-AS in main myocardial cells is obviously reduced. Later, animal experiments prove that the up-regulated ZNF593-AS has the effects of improving the central function damage of a heart expansion model induced by thoracic aortic constriction, reducing the contractility of cardiac muscle cells and destabilizing calcium ions, and achieves the aim of adjuvant therapy of the dilated cardiomyopathy.
In a further embodiment, the pharmacodynamic component of the medicament comprises a substance up-regulating the expression of ZNF 593-AS; or the drug effect component of the drug plays a role in degrading or inhibiting the substance which expresses the ZNF593-AS by down-regulating, the ZNF593-AS is used AS a section of RNA which is obtained from an external source in an animal body, the expression of the ZNF593-AS can be up-regulated by a molecular biological means so AS to play a role in treatment, and other means, such AS certain chemical molecules, can be adopted to inhibit the degradation of the ZNF593-AS and also can achieve the purpose of up-regulating the level of the ZNF 593-AS.
In a preferred embodiment, the drug effect component of the drug comprises a full-length fragment or a functional fragment of the sequence of ZNF593-AS, so that the expression level of the drug is increased and the drug effect component further acts AS a treatment.
In other embodiments, the medicament further comprises pharmaceutically acceptable excipients, and/or reagents for buffering, synthesizing, and/or purifying the ZNF593-AS sequence fragment. The anti-dilated cardiomyopathy medicament can be added with various pharmaceutically acceptable auxiliary agents/auxiliary materials to prepare various dosage forms according to objective requirements by a person skilled in the art, and the medicament is convenient to sell or popularize.
Group 2 examples:
the invention provides application of a substance capable of up-regulating and expressing ZNF593-AS in preparing an anti-dilated cardiomyopathy medicament. The act of loading each of the above-described substances into commercial packaging labeled for anti-dilated cardiomyopathy use on any scale falls within the scope of the claimed invention.
the embodiment of group 3 of the invention provides a screening method of an anti-dilated cardiomyopathy drug, which is used for detecting whether a substance to be selected can up-regulate and express ZNF593-AS and screening out a substance which can promote the expression of ZNF 593-AS.
The specific experimental procedures of this group of examples can be referred to in Experimental example 2 and/or Experimental example 3.
Example set 4:
the invention provides a preparation method of an anti-dilated cardiomyopathy medicament, which comprises the following steps:
a substance up-regulating the expression of ZNF593-AS is used AS an active ingredient of the anti-dilated cardiomyopathy medicament.
The specific experimental procedures for this set of examples are shown in experimental example 2 below.
Experimental example 1 detection of Virus ZNF593-AS in myocardial tissue of patients with dilated cardiomyopathy
1. Cardiac tissues from 14 patients with dilated cardiomyopathy and 7 healthy heart transplant donors were collected and stored in a freezer at-80 ℃. 1ml of TRIZOL (Invitrogen) was added to 50mg of heart, and the mixture was ground to extract RNA. Use of
ND-1000 RNA quality determination.
2. Real-time PCR detection of ZNF593-AS expression was performed using SYBR Green from Thermofish:
reverse transcription:
reverse transcription Primer (RT Primer Mix) configuration:
Oligo RT Primer 1μl
Random RT Primer 1μl
RNase free H2O 78μl
reverse transcription reaction system:
RNA template 2μg
RT Primer Mix 4μl
RNase free H2O up to 19μl
mixing the above systems, centrifuging instantly, incubating at 70 deg.C for 10min, incubating with ice for 2min, and adding the following reagents:
2×TS reaction buffer 25μl
TS enzyme 2.5μl
RNase free H2O 3.5μl
reverse transcription reaction procedure:
60min at 42 ℃ and 10min at 70 ℃; after stopping, 4 ℃ for standby and the product is stored at-20 ℃.
real-time PCR：
Reaction system: 2 × SYBR Green Mix 9 μ l
RT product 2μl
ZNF593-AS Forward Primer 2μl
ZNF593-AS Reverse Primer 2μl
RNase-free H2O 5μl
Reaction procedure:
95℃30sec--(95℃10sec--60℃20sec--70℃1sec)×40cycles--Melting Curve
the primer sequence is as follows:
ZNF593-AS Forward Primer：TTCGCCTTCATCTGCCG
ZNF593-AS Reverse Primer：CCTTCAGTGGGCACACTTCTG
the results show that: a reduction in ZNF593-AS expression in heart tissue of a patient with dilated cardiomyopathy (FIG. 1A); ZNF593-AS was predominantly localized in cardiomyocytes in cardiac tissue (fig. 1B) and was significantly reduced in cardiomyocytes.
Experimental example 2 testing of the therapeutic Effect of ZNF593-AS on dilated cardiomyopathy
The ZNF593-AS has the protection effect on the heart function of a mouse subjected to chest aortic constriction induced cardiac dilatation:
after high expression of ZNF593-AS in mouse heart, the heart function is detected by using ultrasonic and cardiac catheter, and the result shows that: the full length and functional regions of ZNF593-AS have the effect of ameliorating central functional impairment in a thoracic aortic constriction-induced cardiac dilation model (fig. 2A and B).
The ZNF593-AS has the protective effect on the contractility of primary myocardial cells of a heart expansion mouse induced by thoracic aortic constriction:
after ZNF593-AS is highly expressed in the heart of a mouse, primary myocardial cells of the mouse are separated and detected by an IonOptix myocardial cell contraction measuring system, and the results show that: the full length and functional area of ZNF593-AS has the function of improving the reduction of myocardial cell contractility induced by thoracic aortic coarctation. (FIG. 2C).
The full-length sequence of SEQ ID NO. 1ZNF593-AS:
GGCAGGCGCGGGTGAGCATCCTCTGAGAGCTTGGGTCTTGCGTATGTGGAAGGTCAGAGACCCCTCTACCCTAGTTTCCACTTCTTGGTGTCATGAAGACCACTGGTCTTCACGTCCGCTCCCACCCTACAGGCCGCCAGGGAGACCAGTGCCGCCCACCATGCGATTTCGACGCTTGACCCCTGGTTACTTCCGGGTGTTACAGATGCAGGTAGCTGGTGAGCTGAAGGCAGAGCCCCGGAGTCTGCTGGCAGGAGTTGTGGCTACAGTGCTAGCTGTCCTCGGCCTGGGTGGCTCCTGCTATGCCGTCTGGAAGATGGTGGGGCAGCGGCGGGTGCCACGGGCCCCGTAACGAAGAAGAGAGACTCTCACTTGGATGCTGGGGGGCTCGACGCTCAGCTGCTTCAGCCTGGGAGAAAGAAAAACAGGAGTTGGGAGCTGACCAGGTGAGAGCCCTATCTGCTGAGCACCCATCCATCAATCCTCTCCTTACTCCTTCATACCTTTTCTTGTGGTCTTTGGATCGGAAGTGGGTCTTCAGGTTGGTGGAATCGATGAAGTACCTCCTGTAGGAATGGAAGTGAGAAGGAGAGTGAGGAGGTGATAGTCTCCCAAGTGCACCTATCTCCCTAGCCCTAGCTTGTCCCTGACGCCAGGATCCGGGTCTGAGAAACGGGAGGCGGGCGGACCCACGGGTCCCAAGAGAGAAGACTCTGCGCTGCCTGGGGCTTCAACTTCACATCTCCCGGCCGGTACCGCGGACCCTCCTCCGCCCCAGGCCGGGCTCGTCCGGGACTCACGCGCAGGCCAGACAGCGGTGCAGACCGCCCCCTGGCAGGTCGGGGTCGAACTCGGCGTTTGGGTCGGGGCTGGGGTCGTGCGGATCCCTGAGGCCGCAGCTCGCGGTGAATCTCATCCAAGTCCGGCCGCCGCCGCTTCGCCTTCATCTGCCGGGCTAGAGAGTGCGCTCGGTGCGCGCCTGTCCGGCGGGAGCGACCCATGGCCAGAAACAGCCCGGCCGGCCAAGGGGCCAGGAGCAGGGCAGGGAGCACACGTGTGAGCACTTCCGGGCCGATCAGCTACGTCAGGCCACGCCGGGGGGCTAGGCAGGCTCGGCCGGACCGCCTCTGATGACGTCACTCTCGGCCAGCGGCTCGAGCGCCGCCAGGCGGCCGTCGACGTCAGTGACCGAGCTCAGGACGGGCTCCCAGAAGTGTGCCCACTGAAGGGCATGGCCCCGCGGGCCCTCGCTGGGGAGGCGCGGGGTGGTGCGTGCGCCTGGGGGTTTCGGGGCCGTCTTGCTGCCCTGCTCTTCCTGGCCTGGTCCAACCAGTATCAGTGCCAACCTGTACTCCTGTCATCCCTTCCTGTTTCCCAGACCTTGGACTCCGCGGTGGGGGTGGGATGCTTTATCTCTGGAAAGCACTGATAAATGTCTGTGTCATGAATAAATTAGTAAATGACTGAGA
SEQ ID NO. 2ZNF593-AS-functional fragment sequence:
GGCAGGCGCGGGTGAGCATCCTCTGAGAGCTTGGGTCTTGCGTATGTGGAAGGTCAGAGACCCCTCTACCCTAGTTTCCACTTCTTGGTGTCATGAAGACCACTGGTCTTCACGTCCGCTCCCACCCTACAGGCCGCCAGGGAGACCAGTGCCGCCCACCATGCGATTTCGACGCTTGACCCCTGGTTACTTCCGGGTGTTACAGATGCAGGTAGCTGGTGAGCTGAAGGCAGAGCCCCGGAGTCTGCTGGCAGGAGTTGTGGCTACAGTGCTAGCTGTCCTCGGCCTGGGTGGCTCCTGCTATGCCGTCTGGAAGATGGTGGGGCAGCGGCGGGTGCCACGGGCCCCGTAACGAAGAAGAGAGACTCTCACTTGGATGCTGGGGGGCTCGACGCTCAGCTGCTTCAGCCTGGGAGAAAGAAAAACAGGAGTTGGGAGCTGACCAGGTGAGAGCCCTATCTGCTGAGCACCCATCCATCAATCCTCTCCTTA
sequence listing
<110> affiliated Tongji hospital of Tongji medical college of Huazhong university of science and technology
<120> drug for treating dilated cardiomyopathy, screening method and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1469
<212> DNA/RNA
<213> human (Homo sapiens)
<220>
<221> misc_RNA
<222> (1)..(1469)
<223> ZNF593-AS full-length sequence
<400> 1
ggcaggcgcg ggtgagcatc ctctgagagc ttgggtcttg cgtatgtgga aggtcagaga 60
cccctctacc ctagtttcca cttcttggtg tcatgaagac cactggtctt cacgtccgct 120
cccaccctac aggccgccag ggagaccagt gccgcccacc atgcgatttc gacgcttgac 180
ccctggttac ttccgggtgt tacagatgca ggtagctggt gagctgaagg cagagccccg 240
gagtctgctg gcaggagttg tggctacagt gctagctgtc ctcggcctgg gtggctcctg 300
ctatgccgtc tggaagatgg tggggcagcg gcgggtgcca cgggccccgt aacgaagaag 360
agagactctc acttggatgc tggggggctc gacgctcagc tgcttcagcc tgggagaaag 420
aaaaacagga gttgggagct gaccaggtga gagccctatc tgctgagcac ccatccatca 480
atcctctcct tactccttca taccttttct tgtggtcttt ggatcggaag tgggtcttca 540
ggttggtgga atcgatgaag tacctcctgt aggaatggaa gtgagaagga gagtgaggag 600
gtgatagtct cccaagtgca cctatctccc tagccctagc ttgtccctga cgccaggatc 660
cgggtctgag aaacgggagg cgggcggacc cacgggtccc aagagagaag actctgcgct 720
gcctggggct tcaacttcac atctcccggc cggtaccgcg gaccctcctc cgccccaggc 780
cgggctcgtc cgggactcac gcgcaggcca gacagcggtg cagaccgccc cctggcaggt 840
cggggtcgaa ctcggcgttt gggtcggggc tggggtcgtg cggatccctg aggccgcagc 900
tcgcggtgaa tctcatccaa gtccggccgc cgccgcttcg ccttcatctg ccgggctaga 960
gagtgcgctc ggtgcgcgcc tgtccggcgg gagcgaccca tggccagaaa cagcccggcc 1020
ggccaagggg ccaggagcag ggcagggagc acacgtgtga gcacttccgg gccgatcagc 1080
tacgtcaggc cacgccgggg ggctaggcag gctcggccgg accgcctctg atgacgtcac 1140
tctcggccag cggctcgagc gccgccaggc ggccgtcgac gtcagtgacc gagctcagga 1200
cgggctccca gaagtgtgcc cactgaaggg catggccccg cgggccctcg ctggggaggc 1260
gcggggtggt gcgtgcgcct gggggtttcg gggccgtctt gctgccctgc tcttcctggc 1320
ctggtccaac cagtatcagt gccaacctgt actcctgtca tcccttcctg tttcccagac 1380
cttggactcc gcggtggggg tgggatgctt tatctctgga aagcactgat aaatgtctgt 1440
gtcatgaata aattagtaaa tgactgaga 1469
<210> 2
<211> 492
<212> DNA/RNA
<213> human (Homo sapiens)
<220>
<221> misc_RNA
<222> (1)..(492)
<223> ZNF 593-AS-functional fragment sequence
<400> 2
ggcaggcgcg ggtgagcatc ctctgagagc ttgggtcttg cgtatgtgga aggtcagaga 60
cccctctacc ctagtttcca cttcttggtg tcatgaagac cactggtctt cacgtccgct 120
cccaccctac aggccgccag ggagaccagt gccgcccacc atgcgatttc gacgcttgac 180
ccctggttac ttccgggtgt tacagatgca ggtagctggt gagctgaagg cagagccccg 240
gagtctgctg gcaggagttg tggctacagt gctagctgtc ctcggcctgg gtggctcctg 300
ctatgccgtc tggaagatgg tggggcagcg gcgggtgcca cgggccccgt aacgaagaag 360
agagactctc acttggatgc tggggggctc gacgctcagc tgcttcagcc tgggagaaag 420
aaaaacagga gttgggagct gaccaggtga gagccctatc tgctgagcac ccatccatca 480
atcctctcct ta 492
Claims (9)
1. The drug for treating the dilated cardiomyopathy is characterized in that the drug effective component of the drug takes lncRNA ZNF593-AS AS a drug target point, and the drug effect of treating the dilated cardiomyopathy is achieved by up-regulating and expressing the ZNF 593-AS.
2. The medicament for treating dilated cardiomyopathy according to claim 1, wherein: the drug effect component comprises a full-length sequence fragment containing ZNF593-AS or a sequence functional fragment containing NF593-AS, wherein the sequence of ZNF593-AS is shown AS SEQ ID NO.1, and the sequence functional fragment of ZNF593-AS is shown AS SEQ ID NO. 2.
3. The medicament for treating dilated cardiomyopathy according to claim 1 or 2, wherein: also comprises pharmaceutically acceptable auxiliary materials.
4. The medicament for treating dilated cardiomyopathy according to claim 3, wherein: reagents for buffering, and/or synthesizing, and/or purifying the ZNF593-AS are also included.
5. A medicament for the treatment of dilated cardiomyopathy, comprising: the drug effect components of the drug have degradation or inhibition effect on substances of the sequence of the down-regulated expression ZNF 593-AS.
6. A method for screening an anti-dilated cardiomyopathy drug is characterized by comprising the following steps: and detecting whether the candidate substance can up-regulate the expression ZNF 593-AS.
7. The application of up-regulating ZNF593-AS expression substance in preparing anti-dilated cardiomyopathy medicine.
Use of a full-length sequence fragment of ZNF593-AS for the preparation of a medicament for the treatment of dilated cardiomyopathy, characterized in that: the full-length sequence fragment of ZNF593-AS is shown AS SEQ ID NO. 1.
Use of a functional fragment of sequence ZNF593-AS for the preparation of a medicament for the treatment of dilated cardiomyopathy, characterized in that: the sequence functional fragment of ZNF593-AS is shown AS SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110025260.4A CN112691193B (en) | 2021-01-08 | 2021-01-08 | Drug for treating dilated cardiomyopathy and screening method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110025260.4A CN112691193B (en) | 2021-01-08 | 2021-01-08 | Drug for treating dilated cardiomyopathy and screening method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112691193A true CN112691193A (en) | 2021-04-23 |
| CN112691193B CN112691193B (en) | 2022-06-24 |
Family
ID=75513484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110025260.4A Active CN112691193B (en) | 2021-01-08 | 2021-01-08 | Drug for treating dilated cardiomyopathy and screening method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112691193B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004091476A2 (en) * | 2003-04-16 | 2004-10-28 | Ono Pharmaceutical Co | Method of screening remedy for heart disease and medicinal composition for treating heart disease |
| CN102266569A (en) * | 2010-06-04 | 2011-12-07 | 中国人民解放军第二军医大学 | Application of miR-199a and inhibitor thereof |
| WO2018002215A1 (en) * | 2016-06-30 | 2018-01-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of cardiomyopathies |
| CN109663129A (en) * | 2019-02-27 | 2019-04-23 | 四川大学华西第二医院 | Dilated cardiomyopathy therapeutic agent and its application |
| CN109706241A (en) * | 2019-01-23 | 2019-05-03 | 华中科技大学同济医学院附属同济医院 | A kind of drug and its screening, preparation method for treating dilated cardiomyopathy |
-
2021
- 2021-01-08 CN CN202110025260.4A patent/CN112691193B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004091476A2 (en) * | 2003-04-16 | 2004-10-28 | Ono Pharmaceutical Co | Method of screening remedy for heart disease and medicinal composition for treating heart disease |
| CN102266569A (en) * | 2010-06-04 | 2011-12-07 | 中国人民解放军第二军医大学 | Application of miR-199a and inhibitor thereof |
| WO2018002215A1 (en) * | 2016-06-30 | 2018-01-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of cardiomyopathies |
| CN109706241A (en) * | 2019-01-23 | 2019-05-03 | 华中科技大学同济医学院附属同济医院 | A kind of drug and its screening, preparation method for treating dilated cardiomyopathy |
| CN109663129A (en) * | 2019-02-27 | 2019-04-23 | 四川大学华西第二医院 | Dilated cardiomyopathy therapeutic agent and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112691193B (en) | 2022-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mi et al. | SARS-CoV-2-induced overexpression of miR-4485 suppresses osteogenic differentiation and impairs fracture healing | |
| CN109852688B (en) | Diagnostic primer and kit for type 2 diabetes mellitus and application of non-coding RNA molecular marker | |
| US20190153446A1 (en) | Mir-149-3p and method for treating metabolic disease using the same | |
| CN106399309B (en) | A kind of long non-coding RNA and its application in diagnosis/treatment T2DM | |
| Huang et al. | miR-133 inhibits proliferation and promotes apoptosis by targeting LASP1 in lupus nephritis | |
| Yuan et al. | Effects of microRNA-208a on inflammation and oxidative stress in ketamine-induced cardiotoxicity through Notch/NF-κB signal pathways by CHD9 | |
| Sun et al. | Over-expression of VEGF165 in the adipose tissue-derived stem cells via the lentiviral vector | |
| Shao et al. | MiR-133 inhibits kidney injury in rats with diabetic nephropathy via MAPK/ERK pathway. | |
| Xuan et al. | Up‐regulation of miR‐195 contributes to cardiac hypertrophy‐induced arrhythmia by targeting calcium and potassium channels | |
| CN107326067B (en) | miRNA marker of non-alcoholic fatty liver | |
| Gao et al. | Cardiac hypertrophy is positively regulated by microRNA-24 in rats | |
| CN106420791B (en) | Application of miR-145-3p in preparation of medicine for preventing or treating multiple myeloma diseases | |
| Cabiati et al. | Sequencing and cardiac expression of natriuretic peptide receptors A and C in normal and heart failure pigs | |
| CN110295227B (en) | Preparation method of diabetes early warning and/or diagnosis kit based on hsa-miR-320a | |
| CN112691193B (en) | Drug for treating dilated cardiomyopathy and screening method and application | |
| CN111110691A (en) | Application of ginsenoside Rb2 in preparing medicament for preventing and/or treating atherosclerosis | |
| WO2016070798A1 (en) | Drug for inhibiting adipose cell differentiation and insulin resistance | |
| Wang et al. | Shengjie Tongyu decoction regulates cardiomyocyte autophagy through modulating ROS-PI3K/Akt/mTOR Axis by LncRNA H19 in diabetic cardiomyopathy | |
| CN109097358B (en) | Application of lncRNA in prevention or treatment of hypertension | |
| CN109706241B (en) | Medicine for treating dilated cardiomyopathy and screening and preparation method thereof | |
| Tang et al. | AK003290 Protects myocardial cells against apoptosis and promotes cardiac function recovery via miR-539-3p/ErbB4 axis in ischemic-reperfusion injury | |
| Guo et al. | NKRF in Cardiac Fibroblasts Protects against Cardiac Remodeling Post‐Myocardial Infarction via Human Antigen R | |
| CN112746101A (en) | Osteoporosis diagnosis marker and nucleic acid medicine for promoting osteoporosis bone regeneration | |
| Shi et al. | Long form PRLR (lPRLR) regulates genes involved in the triacylglycerol synthesis in goat mammary gland epithelial cells | |
| CN110699442A (en) | Application of LncRNA PEBP1P2, kit for diagnosing heart diseases and medicine for treating heart diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |