CN112680418A - Cell model for screening GPR109A receptor agonist and screening method - Google Patents
Cell model for screening GPR109A receptor agonist and screening method Download PDFInfo
- Publication number
- CN112680418A CN112680418A CN202011188737.2A CN202011188737A CN112680418A CN 112680418 A CN112680418 A CN 112680418A CN 202011188737 A CN202011188737 A CN 202011188737A CN 112680418 A CN112680418 A CN 112680418A
- Authority
- CN
- China
- Prior art keywords
- gpr109a
- screening
- cell
- hours
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cell model for screening GPR109A receptor agonist and a screening method, comprising the following steps of (1) constructing a lentiviral expression vector containing human GPR109A receptor gene; (2) transfecting the lentiviral expression vector into a normal 293T cell; (3) screening cell strains stably and highly expressing GPR109A receptor; (4) GPR109A receptor agonists were sought by dual luciferase assays for CRE transcriptional activity. The screening method greatly reduces the false positive result through the comparison of the experiment results of the 293T cell line of the high expression GPR109A and the 293T cell line of the idle running control, improves the screening accuracy, has high feasibility, is stable and accurate, can accurately and effectively screen the GPR109A receptor agonist, and has good application prospect.
Description
Technical Field
The invention relates to the technical field of cell biology, in particular to a cell model for screening GPR109A receptor agonist and a screening method.
Background
GPR109A, also known as hydroxy carboxylic acid receptor 2 (HCA 2), is known in humans as HM-74a and in mice as PUMA-G. The GPR109A receptor is a G protein-coupled receptor that functions as a membrane receptor and is activated by an acceptable extramembranous ligand to exert signal transduction. A number of studies have shown that GPR109A receptor plays an important role in a variety of cells, tissues and organs, including adipocytes, macrophages, microglia, and the like. GPR109A has been shown to have anti-inflammatory, anti-tumor, anti-hyperlipidemic and atherosclerotic effects in several studies.
The G protein-coupled receptor (GPRC) is a transmembrane protein receptor with seven alpha helices, and the transmembrane protein is characterized in that a peptide chain of the transmembrane protein receptor consists of an extracellular N terminal (ECD),7 transmembrane alpha helical regions (TM1-TM7, HD) and an intracellular C terminal (ICL). The peripheral proteins of GPRC located in the cell membrane generally have heterotrimers coupled to membrane receptors, consisting of Gα，GβAnd GγAnd (4) forming. The differences in the three subunit types and combinations lead to different biological effects. GPRC is classified according to characteristics into: gS，Gi/oAnd G12/13。
Ligand binding Gi/oAfter the protein is coupled with the receptor, activation of Adenylate Cyclase (AC) can be inhibited, so that the content of CAMP in cells can be reduced, and CAMP can activate downstream Protein Kinase (PKA), wherein the PKA mainly functions to phosphorylate transcription factor CAMP binding protein (CREB), and then the phosphorylated CREB can bind with specific promoter CAMP Response Element (CRE).
There is ample evidence to suggest that GPR109A belongs to Gi/oAfter the protein coupled receptor and the ligand activate a GPR109A receptor, the CAMP content in cells can be reduced, thereby playing roles of resisting inflammation, regulating fat metabolism and the like.
In the invention, the transcription activity of the CRE promoter is detected by adopting a dual-luciferase method, and the content of CAMP in cells is reflected by the transcription activity of CRE. Because the property of GPR109A to inhibit CAMP after ligand activation results in consistent CRE transcriptional activity in treated versus untreated cells, AC agonists (Forskolin) need to be added in advance to increase intracellular CAMP concentrations to more accurately reflect the activation properties of GPR 109A.
In the cell model, as the GPR109A receptor is highly expressed, the obvious CAMP reduction can occur after the GPR109A receptor is activated, so that the phenomenon of obvious CRE transcription activity reduction can be found by a dual-luciferase detection technology. Ligands for the GPR109A receptor can then be further screened by comparison to normal 293T cells.
In recent years, research on GPR109A and the determined ligands thereof such as butyric acid, nicotinic acid and the like is more and more related at home and abroad, but establishment of a cell model and a screening method for screening GPR109A receptor ligands is not found so far.
Disclosure of Invention
Technical problem to be solved
Aiming at the defects of the prior art, the invention provides a cell model for screening GPR109A receptor agonist and a screening method thereof, so as to solve the problems.
(II) technical scheme
In order to achieve the purpose, the invention provides the following technical scheme: a cell model for screening GPR109A receptor agonists comprising the steps of (1) constructing a lentiviral expression vector containing a human GPR109A receptor gene; (2) transfecting the lentiviral expression vector into a normal 293T cell; (3) screening cell strains stably and highly expressing GPR109A receptor; (4) GPR109A receptor agonists were sought by dual luciferase assays for CRE transcriptional activity.
Preferably, the GPR109A gene sequence number in the step (1) is NM-177551.4.
Preferably, the virus vector in the step (1) is formed by a pLVX-shRNA2-T2A-puro shRNA expression vector, psPAX2 and p MD2.G three plasmid system, and PCDH-CMV-GPR109A-EF1-copGFP-puro lentivirus is successfully constructed.
Preferably, the cell density of the six-well plate in the step (2) reaches about 60% the next day after the six-well plate is planted with the cells, and the operation of virus infection is performed in the six-well plateAdding 1.9ml culture medium of polybrene with final concentration of 10ug/ml, adding 100ul lentivirus into 6-well plate, shaking, mixing, transferring into CO2The incubator continues to culture.
Preferably, in step (3), the cells are passaged and continuously dosed by using a medium containing Puromycin at 1ug/ml for the transfected cells.
Preferably, the primer used in step (3) for GPR109A upstream and downstream is TGAGGCAGAGACAGATGGACAGAC and GAGAAGCCAGAAGATGCGGATGC, respectively, and the concentration of GPR109A protein primary antibody used in Western blot is 1: 3000.
in order to cooperate with the above cell model for screening GPR109A receptor agonists, a method for screening GPR109A receptor agonists is now provided: the method comprises the following steps: a, taking 10 as the number of the cell strains in the step (3)5The cell density of each cell/ml is passaged in a 96-well plate and cultured for 24 hours, and after the cell density reaches 60 percent, a non-complete DMEM culture medium is replaced;
b, after adding a incomplete culture medium for 4 hours, adding DMSO and a secondary CAMP agonist (Forskolin), after 6 hours, adding a reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ] and an internal reference plasmid PRL-TK for cotransfection, after 6 hours, changing the liquid, and after 24 hours to 36 hours of liquid changing, detecting CRE transcription activity by a dual-luciferase technology;
c, after adding a incomplete culture medium for 4 hours, adding a compound to be detected, treating for 0.5 to 1 hour, adding a CAMP agonist (Forskolin), adding a reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ] and an internal reference plasmid PRL-TK for cotransfection after 6 hours, changing the liquid after 6 hours, and detecting CRE transcription activity by a dual-luciferase technology after 24 to 36 hours of liquid changing.
Preferably, the cells used in step B are a 293T cell line highly expressing GPR109A and an idle control 293T cell line, the Forskolin concentration is 5. mu.M and 10. mu.M, and the action time is 6 h.
Preferably, the compound to be tested and its concentration in step C are: 1mM butyric acid, 1mM nicotinic acid and 1mM beta-hydroxybutyric acid, the concentration of Forskolin used is 5 mu M, and the action time is 6 h.
Preferably, the transfection reagent used for transfecting the plasmids in the steps B and C is lip2000, and the ratio of DNA to lip2000 in transfection is 1: 2.5.
(III) advantageous effects
Compared with the prior art, the invention provides a cell model for screening GPR109A receptor agonist and a screening method, and the cell model has the following beneficial effects:
1. the screening method greatly reduces the false positive result through the comparison of the experiment results of the 293T cell line of the high expression GPR109A and the 293T cell line of the idle running control, improves the screening accuracy, has high feasibility, is stable and accurate, can accurately and effectively screen the GPR109A receptor agonist, and has good application prospect.
Drawings
FIG. 1 is a green fluorescent marker map of successful transfection in 293T cells of the present invention;
FIG. 2 is a qRT-PCR assay of 293T cells and control cell GPR109A after successful transfection in the present invention;
FIG. 3 is a western blot assay of successfully transfected 293T cells and control cells GPR109A in accordance with the present invention;
FIG. 4 is a graph showing the results of dual-luciferase assays performed on control cells stimulated with Forskolin in accordance with the present invention;
FIG. 5 is a graph showing the results of dual-luciferase assay of the high-expression GPR109A cell line stimulated by Forskolin in the present invention;
FIG. 6 is a graph of the feasibility of testing cell models overexpressing the GPR109A receptor and screening methods of the invention with the addition of GPR109A agonist.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
A cell model for screening GPR109A receptor agonists comprising the steps of (1) constructing a lentiviral expression vector containing a human GPR109A receptor gene; (2) transfecting the lentiviral expression vector into a normal 293T cell; (3) screening cell strains stably and highly expressing GPR109A receptor; (4) GPR109A receptor agonists were sought by dual luciferase assays for CRE transcriptional activity.
Preferably, the GPR109A gene sequence number in the step (1) is NM-177551.4.
Preferably, the virus vector in the step (1) is formed by a pLVX-shRNA2-T2A-puro shRNA expression vector, psPAX2 and p MD2.G three plasmid system, and PCDH-CMV-GPR109A-EF1-copGFP-puro lentivirus is successfully constructed.
Preferably, after the next day of planting the six-well plate by using the cells in the step (2), the cell density reaches about 60 percent, the operation of virus infection is carried out, 1.9ml of polybrene culture medium with the final concentration of 10ug/ml is added into the six-well plate, 100ul of lentivirus is taken out and added into the 6-well plate, the mixture is shaken and mixed evenly, and then the mixture is transferred into CO2The incubator continues to culture.
Preferably, in step (3), the cells are passaged and continuously dosed by using a medium containing Puromycin at 1ug/ml for the transfected cells.
Preferably, the primer used in step (3) for GPR109A upstream and downstream is TGAGGCAGAGACAGATGGACAGAC and GAGAAGCCAGAAGATGCGGATGC, respectively, and the concentration of GPR109A protein primary antibody used in Western blot is 1: 3000.
in order to cooperate with the above cell model for screening GPR109A receptor agonists, a method for screening GPR109A receptor agonists is now provided: the method comprises the following steps: a, taking 10 as the number of the cell strains in the step (3)5The cell density of each cell/ml is passaged in a 96-well plate and cultured for 24 hours, and after the cell density reaches 60 percent, a non-complete DMEM culture medium is replaced;
b, after adding a incomplete culture medium for 4 hours, adding DMSO and a secondary CAMP agonist (Forskolin), after 6 hours, adding a reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ] and an internal reference plasmid PRL-TK for cotransfection, after 6 hours, changing the liquid, and after 24 hours to 36 hours of liquid changing, detecting CRE transcription activity by a dual-luciferase technology;
c, after adding a incomplete culture medium for 4 hours, adding a compound to be detected, treating for 0.5 to 1 hour, adding a CAMP agonist (Forskolin), adding a reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ] and an internal reference plasmid PRL-TK for cotransfection after 6 hours, changing the liquid after 6 hours, and detecting CRE transcription activity by a dual-luciferase technology after 24 to 36 hours of liquid changing.
Preferably, the cells used in step B are a 293T cell line highly expressing GPR109A and an idle control 293T cell line, the Forskolin concentration is 5. mu.M and 10. mu.M, and the action time is 6 h.
Preferably, the concentration of the test compound in step C is: phytic acid 1mM, Atorvastatin calcium salt trihydrate 0.5. mu.g/ml, Fmoc-Thr (HPO3Bzl) -OH 0.5. mu.g/ml, Dabigatran 1nmol/ml, Forskolin concentration 5. mu.M, duration of action 6 h.
Preferably, the transfection reagent used for transfecting the plasmids in the steps B and C is lip2000, and the ratio of DNA to lip2000 in transfection is 1: 2.5.
example 1: pCDH-CMV-GPR109A-EF1-copGFP-T2A-Puro lentivirus package
Preparing recombinant virus plasmids for encoding lentiviral particles and two auxiliary packaging original vector plasmids thereof, respectively carrying out high-purity endotoxin-free extraction on three plasmid vectors, and designing GPR109A overexpression plasmids and lentiviral overexpression backbone plasmids: and packaging pCDH-CMV-MCS-EF1-copGFP-T2A-Puro and Amp +, and successfully constructing pCDH-CMV-GPR109A-EF1-copGFP-T2A-Puro lentivirus.
1.293T cells after recovery, on the day before transfection, passaged cells were prepared: digesting 293T cells by using 0.25% trypsin, adjusting cell density by using DMEM medium containing 10% serum, and inoculating 6-8 multiplied by 10 per 10cm of cell culture dish6cells to 10cm cell culture dish, placed at 37 deg.C, 5% CO2Culturing in an incubator for 16-24 h, and then using for transfection when the cell density grows to 80-90%.
2. The following day, 2h before transfection, medium exchange was performed with 5ml complete medium (DMEM + 10% FBS).
3. Transfection was performed according to the following experimental procedure:
24h before A transfection, 293T cells in the logarithmic growth phase were trypsinized and adjusted to a cell density of 1.2X 10 in a medium containing 10% serum7Cells/20 ml, reseeded in 15cm cell culture dishes at 37 ℃ with 5% CO2The culture box is cultured for 16 hours until the cell density is reachedCan be used for transfection when reaching 70-80%, and the cell state is very important for virus packaging, so that a good cell state and fewer passage times need to be ensured.
Cell culture medium was changed to serum-free medium 2h before B transfection.
C to a sterilized centrifuge tube, 15. mu.g of Plvx-shRNA2-T2a-puro recombinant vector, 11.25. mu.g of psPAX2 vector, 3.75. mu.g of pMD2.G vector were added, mixed well with the corresponding volume of Opti-MEM, adjusted to a total volume of 2.5ml, and incubated at room temperature for 5 minutes.
D Lipofectamine 2000 was gently shaken, 100. mu.l of Lipofectamine 2000 was mixed with 2.4ml of Opti-MEM in another tube, and incubated at room temperature for 5 minutes.
E mix the diluted DNA with diluted Lipofectamine 2000, mix by gentle inversion without shaking, and mix within 5 minutes.
F after mixing, incubation for 20 minutes at room temperature to form a transfection complex of DNA with Lipofectamine 2000 dilution.
H transferring the mixed solution of DNA and Lipofectamine 2000 to 293T cell culture solution, mixing uniformly, and performing reaction at 37 ℃ and 5% CO2Culturing in a cell culture box.
I after 8h of incubation, the medium containing the transfection mixture was poured off, 20ml of PBS was added to each flask of cells, the flask was gently shaken side to wash the residual transfection mixture, and then poured off.
J cell culture medium (25 ml) containing 10% serum was added to each flask of cells at 37 ℃ with 5% CO2The incubator was allowed to incubate for 48 hours.
4. On the third day, the medium was discarded after 12-16 h of culture, and the medium was replaced with 10ml of fresh complete medium (DMEM + 10% FBS).
5. On day four, 24h after the change, the supernatant was collected, stored in a refrigerator at 4 ℃, added with 10ml of fresh complete medium (DMEM + 10% FBS) to a 10cm cell culture dish, and placed at 37 ℃ with 5% CO2The incubator continues to culture.
6. On the fifth day, the supernatant was collected again, mixed with the first collected supernatant, centrifuged at 1000rpm for 5min, the cell debris was discarded, and the supernatant was filtered through a 0.45 μm PVDF filter into a 50ml round bottom centrifuge tube.
7. Centrifuging at 50000g for 2h at 4 deg.C, and marking the virus precipitate with marker pen.
8. Carefully discarding the supernatant, air-drying, adding PBS according to the amount of 200ul/10cm culture dish to resuspend virus precipitate, standing at room temperature for 2h, gently blowing uniformly by using a pipette to avoid generating bubbles, standing at room temperature for 30min, subpackaging into clean 1.5ml EP tubes according to the amount of virus used each time, and storing in a refrigerator at-80 ℃.
EXAMPLE two construction of Stable overexpression GPR109A cell line
Firstly, cell planting: 293T cells were plated in 6-well plates (2X 10) 1 day before preparation for virus infection5Per well), 2 wells were planted in total.
Secondly, lentivirus infection: observing the cell fusion degree to about 60% the next day after the cell planting, and performing virus infection operation at the moment, wherein the specific steps comprise preparing 10ml of culture medium in a 15ml centrifugal tube, adding polybrene with the final concentration of 10ug/ml to promote the efficiency of virus infection cells, then removing the old culture medium in a 6-well plate, replacing 1.9ml of culture medium containing polybrene, taking out the lentivirus from a refrigerator at-80 ℃, thawing, adding 100ul of each virus liquid into the 6-well plate, shaking and mixing uniformly, transferring into CO2The incubator continues to culture.
Thirdly, screening stable cell lines: the morning after the virus infection, the virus-containing culture medium is replaced, a fresh culture medium is added, the culture is continued for 2 days, the cells are overgrown at the moment, the cells are digested by pancreatin, the cells are transferred into a 10cm cell culture dish, the next day, after the cells adhere to the wall, Puromycin (1ug/ml) is added for screening, after 2 days, the control cells are all dead, the cells are subjected to passage and continuously added with the medicine, and a small amount of cells are left for QPCR identification of the GPR109A gene overexpression.
Example three qRT-PCR detection of GPR109A Gene expression
Transferring Trizol lysate of GPR109A-PCDH-293T and PCDH-293T cells into an EP tube, and standing for 5min at room temperature of 15-30 ℃;
adding 0.2ml of chloroform into the EP tube, covering the EP tube with a cover, reversing and uniformly mixing for 15s, standing at the temperature of 15-30 ℃ for 2-3 min, and then centrifuging for 15min at 12000g (2-8 ℃);
placing the upper water phase in a new EP tube, adding 0.5ml of isopropanol into 1ml of TRIZOL, placing for 10min at the temperature of 15-30 ℃, and then centrifuging for 10min at 12000g (2-8 ℃);
discarding the supernatant, washing by adding 1ml of 75% ethanol into 1ml of TRIZOL, mixing by vortex, centrifuging for 5min in 7500g (2-8 ℃), and discarding the supernatant;
allowing the precipitated RNA to dry naturally at room temperature; the RNA pellet was dissolved with RNase-free water.
Synthesis of cDNA template
1, adding the following components into a micro-centrifugal tube without nuclease
TABLE 1 Real-Time qRT-PCR reaction System-1 (20ul)
After heating the mixture at 65 ℃ for 5min, it was rapidly cooled on ice and briefly centrifuged, and the following ingredients were added:
chari Real-Time qRT-PCR reaction System-2 (20ul)
The ingredients were gently mixed in a centrifuge tube and incubated at 37 ℃ for 2 min.
2, add 1ul (200 units) M-MLV reverse transcriptase at room temperature, gently blow and mix well, incubate centrifuge tube at 25 ℃ for 10 min.
3, and then incubated at 37 ℃ for 50 min.
4, finally heating at 70 ℃ for 15min to terminate the reaction, and the cDNA product directly serves as a template for qRT-PCR.
Example four western blot detection of GPR109A Gene expression
1. The cells were lysed with RIPA cell lysate containing protease inhibitors (Roche Diagnostics, Swissland) at 4 ℃ for 15min, removed, mixed well and then placed on ice for 10 min.
2. Following centrifugation, the supernatant was removed as a protein sample, and protein concentration was calculated using BSA according to the instructions and protein encapsulation was completed.
3. 60. mu.g of protein was separated using 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred onto a polyvinylidene fluoride (PVDF) membrane.
4. Membranes were incubated with primary anti-GPR 109A as 1: 3000 in a ratio of 3000 were incubated together at 4 ℃ for 8 h.
5. Subsequently, the membrane was incubated with a goat anti-rabbit secondary antibody (1: 5000) at room temperature for 1 hour, with β -actin protein as an internal reference protein.
EXAMPLE five feasibility of adding GPR109A agonist and Forskolin to test cell model screens
Cell lines overexpressing GPR109A and idle control cells were seeded in 96-well plates at a cell density of 105Culturing for 24h, growing the cells to 60% in the holes, removing the culture medium, and adding incomplete DMEM culture medium;
after adding incomplete culture medium for 4h, DMSO and Forskolin with 5. mu.M or 10. mu.M are added into the culture medium, or after adding 1mM butyric acid, 1mM nicotinic acid and 1mM beta-hydroxybutyric acid and acting for 1h, 5. mu.M Forskolin is added, and after acting for 6h, lip2000 is adopted to co-transfect reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ], internal reference plasmid PRL-TK.
50. mu.l of Opti-MEM I modified Serum Medium containing 0.2. mu.g of DNA and 0.5. mu.L of lip2000 was added to each well of cells to be transfected in a 96-well plate, and the DNA diluent and the lip2000 diluent were allowed to stand at room temperature for 20min and then added.
After 6h of transfection completion, the medium was discarded and replaced with incomplete medium for 24h-36h, followed by dual luciferase assay.
Firefly luciferase assay a:
(1) the cell culture plates were removed and allowed to equilibrate at room temperature for 10 minutes and no more than 30 minutes.
(2) Add 100. mu. Dual-Lumi to 96-well plateTMII, mixing the firefly luciferase detection reagent uniformly.
(3) Incubation for 10 minutes at room temperature allowed the luminescence signal to stabilize.
(4) And performing chemiluminescence detection by using a multifunctional microplate reader with a chemiluminescence detection function.
B firefly luciferase assay:
(5) add 100. mu. Dual-Lumi to 96-well plateTMII, mixing the sea cucumber luciferase detection reagent uniformly.
(6) Incubation for 10 minutes at room temperature allowed the luminescence signal to stabilize.
(7) And performing chemiluminescence detection by using a multifunctional microplate reader with a chemiluminescence detection function.
And C, under the condition that the sea cucumber firefly luciferase is taken as an internal reference, determining the RLU value by using the firefly luciferase, and comparing the activation degrees of the target reporter genes among different samples according to the obtained ratio.
The following experimental results were obtained from the above experiments, and the statistical analysis was as follows:
FIG. 1293 successful transfection of T cells with green fluorescent marker
The successful lentivirus transfection can be seen, and the lentivirus transfection efficiency reaches more than 70% no matter whether the GPR109A gene is carried or not.
FIG. 2 qRT-PCR detection of 293T cells and control GPR109A after successful transfection
293T fine transfected with GPR109A gene was found to have significantly increased gene expression of GPR109A compared with the control group, which is 100 times higher than that of the control group, by using qRT-PCR detection.
FIG. 3 Western blot assay of 293T cells and control GPR109A cells after successful transfection
Protein expression of GPR109A was found to be significantly increased in 293T cells transfected with GPR109A gene compared to control by using western blot assay.
FIG. 4 results of dual-luciferase assays of control cells stimulated by Forskolin
The results show that the control cells significantly enhanced the transcriptional activity of the promoter CRE as expected after addition of AC agonist (Forskolin), and it was never demonstrated that AC agonist could normally raise CAMP content in the idling control cells, and Forskolin solvent DMSO had no effect.
FIG. 5 shows the results of dual-luciferase assay of the high-expression GPR109A cell line stimulated by Forskolin
The results show that after addition of AC agonist (Forskolin), the transcriptional activity of promoter CRE was significantly enhanced by cells overexpressing GPR109A as expected, and also demonstrate that AC agonist can normally increase CAMP content in cells overexpressing GPR109A, and Forskolin solvent DMSO has no effect.
Figure 6 test the feasibility results of cell models overexpressing GPR109A receptor and screening methods with GPR109A agonist added.
First, the inhibition rate was calculated by the dual-luciferase reporter gene experiment compared with the Forskolin group, and the results showed that GPR109A agonists such as butyrate, nicotinic acid and β -hydroxybutyrate had a very significant effect of decreasing the transcriptional activity of promoter CRE (. indicates p <0.05 compared with the Forskolin group and. indicates p <0.01 compared with the Forskolin group).
Due to the complex intracellular signal path, in order to verify the accuracy of the screening method, the idle control cells are used for re-screening, and the experimental result shows that the P of three GPR109A agonist drug groups is less than 0.05 compared with the control group, so that the GPR109A receptor agonist can be specifically screened by the invention. (# represents p <0.05 compared to the agonist group and # represents p <0.01 compared to the agonist group).
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (10)
1. A cellular model for screening GPR109A receptor agonists comprising the steps of: (1) constructing a lentivirus expression vector containing a human GPR109A receptor gene; (2) transfecting the lentiviral expression vector into a normal 293T cell; (3) screening cell strains stably and highly expressing GPR109A receptor; (4) GPR109A receptor agonists were sought by dual luciferase assays for CRE transcriptional activity.
2. The cellular model for screening agonists of the GPR109A receptor of claim 1 wherein: wherein the gene sequence number of GPR109A in the step (1) is NM-177551.4.
3. The cellular model for screening agonists of the GPR109A receptor of claim 1 wherein: wherein the virus vector in the step (1) is formed by a pLVX-shRNA2-T2A-puro shRNA expression vector, a psPAX2 and a p MD2.G three-plasmid system, and PCDH-CMV-GPR109A-EF1-copGFP-puro lentivirus is successfully constructed.
4. The cellular model for screening agonists of the GPR109A receptor of claim 1 wherein: wherein the cell density reaches about 60% in the next day after the six-well plate is planted with the cells in the step (2), the operation of virus infection is carried out, 1.9ml of polybrene culture medium with the final concentration of 10ug/ml is added into the six-well plate, 100ul of lentivirus is taken out and added into the 6-well plate, the mixture is evenly mixed by shaking, and CO is transferred into the six-well plate2The incubator continues to culture.
5. The cellular model for screening agonists of the GPR109A receptor of claim 1 wherein: wherein in the step (3), a culture medium containing Puromycin 1ug/ml is used for the transfected cells, and the cells are subjected to passage and continuously added with drugs.
6. The cellular model for screening agonists of the GPR109A receptor of claim 1 wherein: the primer on the upper stream and the primer on the lower stream of GPR109A adopted in the step (3) are TGAGGCAGAGACAGATGGACAGAC and GAGAAGCCAGAAGATGCGGATGC respectively, and the concentration of GPR109A protein primary antibody used in Western blot is 1: 3000.
7. according to claim 1The cell model for screening the GPR109A receptor agonist is provided, and the method for screening the GPR109A receptor agonist is characterized by comprising the following steps: a, taking 10 as the number of the cell strains in the step (3)5The cell density of each cell/ml is passaged in a 96-well plate and cultured for 24 hours, and after the cell density reaches 60 percent, a non-complete DMEM culture medium is replaced;
b, after adding a incomplete culture medium for 4 hours, adding DMSO and a secondary CAMP agonist (Forskolin), after 6 hours, adding a reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ] and an internal reference plasmid PRL-TK for cotransfection, after 6 hours, changing the liquid, and after 24 hours to 36 hours of liquid changing, detecting CRE transcription activity by a dual-luciferase technology;
c, after adding a incomplete culture medium for 4 hours, adding a compound to be detected, treating for 0.5 to 1 hour, adding a CAMP agonist (Forskolin), adding a reporter gene plasmid pGL4.29[ luc2P/CRE/Hygro ] and an internal reference plasmid PRL-TK for cotransfection after 6 hours, changing the liquid after 6 hours, and detecting CRE transcription activity by a dual-luciferase technology after 24 to 36 hours of liquid changing.
8. The method of screening for agonists of the GPR109A receptor of claim 7 wherein: the cells used in step B were a 293T cell line highly expressing GPR109A and an idle control 293T cell line, Forskolin concentrations of 5. mu.M and 10. mu.M, and an action time of 6 h.
9. The method of screening for agonists of the GPR109A receptor of claim 7 wherein: the compound to be tested in step C and its concentration are: 1mM butyric acid, 1mM nicotinic acid and 1mM beta-hydroxybutyric acid, the concentration of Forskolin used is 5 mu M, and the action time is 6 h.
10. The method of screening for agonists of the GPR109A receptor of claim 7 wherein: the transfection reagent used for transfection of plasmids in steps B and C was lip2000, and the ratio of DNA to lip2000 during transfection was 1: 2.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011188737.2A CN112680418A (en) | 2020-10-30 | 2020-10-30 | Cell model for screening GPR109A receptor agonist and screening method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011188737.2A CN112680418A (en) | 2020-10-30 | 2020-10-30 | Cell model for screening GPR109A receptor agonist and screening method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112680418A true CN112680418A (en) | 2021-04-20 |
Family
ID=75445734
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011188737.2A Pending CN112680418A (en) | 2020-10-30 | 2020-10-30 | Cell model for screening GPR109A receptor agonist and screening method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112680418A (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6403305B1 (en) * | 1997-02-06 | 2002-06-11 | Cornell Research Foundation, Inc. | Methods of identifying peptide agonists or negative antagonists of a G protein coupled receptor |
| US20060078498A1 (en) * | 2002-03-28 | 2006-04-13 | Bayer Pharmaceuticals Corporatioh | Methods for the identification of novel ligands for the g protein-coupled receptor (gpcr) 192 |
| CN101333555A (en) * | 2007-12-25 | 2008-12-31 | 浙江大学 | Novel horizontal screening system construct by recipient cell G protein coupling and applications |
| CN102604947A (en) * | 2011-01-24 | 2012-07-25 | 华中农业大学 | Porcine adipose tissue-specific chimeric promoters |
| CN103484498A (en) * | 2013-09-04 | 2014-01-01 | 广州医科大学 | High-flux screening cell model of alpha1-AR subtype selective antagonist, and construction method and application thereof |
| CN110376366A (en) * | 2019-07-19 | 2019-10-25 | 吉林大学 | A kind of niacin is applied to the experimental method for the treatment of mastadenitis of cow by GPR109A receptor |
| CN113564221A (en) * | 2021-07-27 | 2021-10-29 | 吉林大学 | Application of nicotinic acid in preparation of medicine for relieving cow's milk gland fibrosis through GPR109A receptor |
| CN114231493A (en) * | 2021-11-16 | 2022-03-25 | 宁波熙宁检测技术有限公司 | Construction and application of GIPR reporter gene stable cell strain |
-
2020
- 2020-10-30 CN CN202011188737.2A patent/CN112680418A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6403305B1 (en) * | 1997-02-06 | 2002-06-11 | Cornell Research Foundation, Inc. | Methods of identifying peptide agonists or negative antagonists of a G protein coupled receptor |
| US20060078498A1 (en) * | 2002-03-28 | 2006-04-13 | Bayer Pharmaceuticals Corporatioh | Methods for the identification of novel ligands for the g protein-coupled receptor (gpcr) 192 |
| CN101333555A (en) * | 2007-12-25 | 2008-12-31 | 浙江大学 | Novel horizontal screening system construct by recipient cell G protein coupling and applications |
| CN102604947A (en) * | 2011-01-24 | 2012-07-25 | 华中农业大学 | Porcine adipose tissue-specific chimeric promoters |
| CN103484498A (en) * | 2013-09-04 | 2014-01-01 | 广州医科大学 | High-flux screening cell model of alpha1-AR subtype selective antagonist, and construction method and application thereof |
| CN110376366A (en) * | 2019-07-19 | 2019-10-25 | 吉林大学 | A kind of niacin is applied to the experimental method for the treatment of mastadenitis of cow by GPR109A receptor |
| CN113564221A (en) * | 2021-07-27 | 2021-10-29 | 吉林大学 | Application of nicotinic acid in preparation of medicine for relieving cow's milk gland fibrosis through GPR109A receptor |
| CN114231493A (en) * | 2021-11-16 | 2022-03-25 | 宁波熙宁检测技术有限公司 | Construction and application of GIPR reporter gene stable cell strain |
Non-Patent Citations (4)
| Title |
|---|
| GUO LI等: "Internalization of the human nicotinic acid receptor GPR109A is regulated by G(i), GRK2, and arrestin3", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| HOLLY DRESSLER等: "The CRE luc Bioluminescence Transgenic Mouse Model for Detecting Ligand Activation of GPCRs", 《JOURNAL OF BIOMOLECULAR SCREENING》 * |
| 张赟等: "《细胞和分子免疫学实用实验技术》", 30 April 2013 * |
| 李果: "烟酸受体GPR109A信号转导和内吞分子机制研究", 《中国优秀博硕士学位论文全文数据库(博士)医药卫生科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107630027B (en) | Preparation and application of medicine for over-expressing PCNP gene | |
| CN115029351A (en) | Application of shRNA or BACH1 deletion macrophage-derived EVs in preparation of medicine for treating hypertension | |
| CN109576227B (en) | Luciferase reporter virus-based autophagy cell line construction method | |
| CN110511903A (en) | A kind of Study on Molecular Mechanism method and its application of miR-21-5p targeting Smad7 regulation pig ovary granular cell | |
| CN112680418A (en) | Cell model for screening GPR109A receptor agonist and screening method | |
| CN108913695B (en) | Application of ZEB1 in human heart fibroblast | |
| CN111481672A (en) | Use of agent for inhibiting SGCE gene | |
| CN113265428B (en) | Detection system for constructing copper change in living cells by utilizing metallothionein and application | |
| CN109929843B (en) | Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function | |
| CN106177906B (en) | The application of Ddb1 albumen | |
| CN106075396B (en) | The application of Cul4 albumen | |
| CN113493770A (en) | Human GLUT5 stable transfection cell strain and application thereof in screening GLUT5 inhibitor | |
| CN115181756B (en) | Recombinant lentiviral vector, recombinant lentiviral plasmid, cell model and related applications | |
| CN110343752A (en) | A method of Wnt signal and histone cooperate with target gene mechanism in research PGCs atomization | |
| Anuj et al. | BASP1 down-regulates RANKL-induced osteoclastogenesis | |
| CN114214362B (en) | Application of EHBP1L1 gene inhibitor as human breast cancer treatment drug | |
| EP4009051A1 (en) | Use of dkk1 inhibitor in prevention and/or treatment of tumor cachexia and diseases associated with diabetes | |
| CN110846338B (en) | Method for constructing high-efficiency expression vector by using activating RNA | |
| CN108060134B (en) | HPMC cell strain for stably over-expressing miR-497 and application thereof | |
| CN108060133B (en) | HPMC cell strain for stably and lowly expressing miR-497 and application thereof | |
| CN112852814A (en) | SiRNA for silencing GIPC1 gene, recombinant vector and application thereof | |
| CN117844762A (en) | Sensitive cell line for efficient replication of African swine fever virus and establishment method thereof | |
| CN116814622A (en) | Application of chicken circular RNA circSLC2A13 in promotion of chicken muscle formation | |
| CN113403283A (en) | Application of ETV4 gene in reprogramming hypertrophic scar fibroblast | |
| CN117625774A (en) | Application of AATF in preparation of alcoholic liver disease drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210420 |